FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2068105796> ?p ?o ?g. }

• W2068105796 endingPage "26576" @default.
• W2068105796 startingPage "26570" @default.
• W2068105796 abstract "Long interspersed nuclear elements (LINEs) are mobile DNA elements which propagate by reverse transcription of RNA intermediates. LINEs lack long terminal repeats, and their expression is controlled by promoters located inside to the transcribed region of unit-length DNA copies. Doc elements constitute one of the seven families of LINEs found in Drosophila melanogaster. Plasmids in which the chloramphenicol acetyltransferase (CAT) gene is preceded by DNA segments from different Doc family members were used as templates for transient expression assays in Drosophila S2 cells. Transcription is initiated at the 5′ end of Doc elements within hexamers fitting the consensus (C/G)AYTCG and is regulated by a DNA region which is located Ȭ20 base pairs (bp) downstream from the RNA start site(s). The region includes a sequence (RGACGTGY motif, or DE2) which stimulates transcription in other Drosophila LINEs, and two adjacent elements, DE1 and DE3. Moving the downstream region either 4 bp away from, or 5 bp closer to the RNA start site region inhibited transcription. Sequences located Ȭ200 bp downstream from the Doc 5′ end repressed CAT expression in an orientation- and position-dependent manner. The inhibition reflects impaired translation of the CAT gene possibly consequent to the interaction of specific Doc RNA sequences with a cellular component. Long interspersed nuclear elements (LINEs) are mobile DNA elements which propagate by reverse transcription of RNA intermediates. LINEs lack long terminal repeats, and their expression is controlled by promoters located inside to the transcribed region of unit-length DNA copies. Doc elements constitute one of the seven families of LINEs found in Drosophila melanogaster. Plasmids in which the chloramphenicol acetyltransferase (CAT) gene is preceded by DNA segments from different Doc family members were used as templates for transient expression assays in Drosophila S2 cells. Transcription is initiated at the 5′ end of Doc elements within hexamers fitting the consensus (C/G)AYTCG and is regulated by a DNA region which is located Ȭ20 base pairs (bp) downstream from the RNA start site(s). The region includes a sequence (RGACGTGY motif, or DE2) which stimulates transcription in other Drosophila LINEs, and two adjacent elements, DE1 and DE3. Moving the downstream region either 4 bp away from, or 5 bp closer to the RNA start site region inhibited transcription. Sequences located Ȭ200 bp downstream from the Doc 5′ end repressed CAT expression in an orientation- and position-dependent manner. The inhibition reflects impaired translation of the CAT gene possibly consequent to the interaction of specific Doc RNA sequences with a cellular component. INTRODUCTIONDoc is one of 50 or more mobile DNA elements that have been identified in the fruit fly Drosophila melanogaster (Finnegan and Fawcett, 1986). Doc elements lack terminal repeats, instead terminating at the 3′ end in runs of adenine residues flanked by polyadenylation signals. They differ in size, being variously truncated at the 5′ end, and are flanked by target site duplications which vary in length from 10 to 14 bp 1The abbreviations used are: bpbase pairs(s)LINElong interspersed nuclear elementS2Schneider cells line 2LTRlong terminal repeat, Inr, initiatorhsp70heat shock protein 70 geneUTRuntranslated regionCATchloramphenicol acetyltransferaseRSVRous sarcoma viruskbkilobase(s)DEdistal elementHIV-1human immunodeficiency virus 1. (Schneuwly et al., 1987; Driver et al., 1989). Complete family members are Ȭ4.7 kb in length and potentially encode a putative nucleic acid binding protein and a reverse transcriptase (O'Hare et al., 1991). The structure and coding capacity of Doc is typical of LINEs, nomadic DNA sequences conserved in evolution from protozoa to man (Doolittle et al., 1989; Xiong and Eickbush, 1990). LINEs, also known as type II retrotransposons, use self-encoded proteins to reverse transcribe their own mRNA and integrate cDNA copies at new locations in the genome. This hypothesis has been experimentally supported by the analysis of transgenic flies carrying intron-marked Drosophila I factors (Pelisson et al., 1991; Jensen and Heidmann, 1991) and baby hamster kidney cells transfected with mouse LINE-1 elements (Evans and Palmiter, 1991).Mammalian genomes harbor >105 LINEs that belong to a single superfamily (Singer and Skowronski, 1985; Hutchison et al., 1989). By contrast, distinct LINE families, each including 50-80 members, coexist in D. melanogaster. In addition to Doc, six other families of LINE elements have been described so far in this organism, including the I factor (Fawcett et al., 1986), F (Di Nocera and Casari, 1987), G (Di Nocera, 1988), and jockey (Priimagi et al., 1988) elements, and type I and type II ribosomal DNA insertions (Jacubczak et al., 1990).LINEs differ markedly from other mobile DNA sequences that also propagate by the retrotranscription of RNA intermediates such as copia-like elements in D. melanogaster (Finnegan and Fawcett, 1986) and the Ty element (Boeke et al., 1985) in Saccharomyces cerevisiae. These elements, also known as viral retrotransposons, resemble the integrated genomes of retroviruses as they carry LTRs. LINEs lack LTRs, and their expression is controlled by promoters which are located within the transcribed region (Mizrokhi et al., 1988; Swergold, 1990; Minchiotti and Di Nocera, 1991; Minakami et al., 1992; Contursi et al., 1993; McLean et al., 1993).By means of transient transfection assays we monitored the expression of constructs in which the reporter CAT gene was under the control of various Doc DNA segments in Drosophila Schneider II (S2) cells. We show that distinct cis-acting DNA elements, clustered in a Ȭ50-bp long DNA region located at the 5′ end of unit-length Doc copies, cooperate to control RNA initiation. In addition, we found that sequences located Ȭ200 bp downstream from the 5′ end inhibit the expression of the reporter CAT gene in a position- and orientation-dependent manner. The inhibition appears to be due to reduced translation rather than to impaired synthesis of CAT mRNA.MATERIALS AND METHODSPlasmidsThe clones suN, 6N, and 11N, in which the 5′ end regions of the elements su(f)S2, Doc6, and Doc11, respectively, precede the CAT gene, were obtained by cloning SalI-NaeI (suN), XhoI-NaeI (6N), and EcoRI-NaeI(11N) fragments, isolated, respectively, from pDoc, λDoc6, and λDoc11, into the AvaI site of pEMBL8CAT. pDoc, λDoc6, and λDoc11, described in Driver et al.(1989), were kindly provided by Dr. Kevin O'Hare. The clones suA, 11A, and 6A were obtained by cloning an EcoRI-AluI fragment from suN (suA), or AluI fragments from either 6N (6A) or 11N (11A), into the BamHI site of pEMBL8CAT. Plasmids su132 and su218 carry DNA fragments that span the 5′ end region of su(f)S2 and terminate 3′ at residue 132 or 218, respectively. These fragments were synthesized by polymerase chain reaction experiments in which suN DNA was amplified by using as primers the reverse sequencing primer (Biolabs) and either the D132 or the D218 oligomers, which are complementary to residues 112-132 and 202-218 of su(f)S2, respectively. The amplified DNA was digested with XbaI, and the fragments were gel-purified and cloned into the AvaI site of pEMBL8CAT.Doc DNA called δ corresponds to a HinfI-NaeI fragment spanning residues 219-267 of su(f)S2. δ was cloned in the plasmid suA, either in the AvaI site upstream of the su(f)S2 promoter (constructs δ1suA and δ2suA), or in the HindIII site downstream from the su(f)S2 promoter (constructs suAδ1 and suAδ2). δ was also cloned into the HindIII site of RSVCAT downstream from the RSV promoter (constructs RSVδ1 and RSVδ2). The subregions ϵ and η (see Fig. 2A), obtained by digestion of suN with DdeI and AvaI, were cloned in the HindIII site of plasmid suA downstream from the su(f)S2 promoter (constructs suAϵ1 and suAη1, respectively). RSVϵ1 and RSVη1 were constructed by replacing the HindIII-NcoI fragment spanning the 5′ end region of the CAT gene in RSVCAT with HincII-NcoI fragments from suAϵ1 and suAη1. In all of these constructs, numbers indicate if the DNA of interest has been cloned in the direct (1Arkhipova I.R. Ilyin Y.V. EMBO J. 1991; 10: 1169-1177Crossref PubMed Scopus (50) Google Scholar) or reverse (2Ayer D.E. Dynan W.S. Mol. Cell. Biol. 1988; 8: 2021-2033Crossref PubMed Scopus (47) Google Scholar) orientation. Plasmids s26 and Doc6-21 were constructed by first annealing the complementary oligonucleotides SA1/SA2 (s26) and 6A1/6A2 (Doc6-21). The double-stranded products, which are blunt at one end and give SalI 5′ plus-strand overhangs at the other end, were cloned between the AvaI and SalI sites of pEMBL8CAT. Plasmids s47 and Doc6-42 were similarly obtained by first annealing the complementary oligonucleotides SB1/SB2 (s47) and 6B1/6B2 (Doc6-42). The double-stranded DNA fragments, which had SalI 5′ minus-strand overhangs at one end and were blunt at the other end, were cloned between the SalI and HindIII sites of s26 and Doc6-21, respectively. To obtain s47 + 4 and Doc6-42 + 4, s47, and Doc6-42 DNAs were digested with SalI, and the SalI termini were made blunt-ended by the Klenow enzyme. To construct s47 - 5, s47 was digested with SalI, and SalI termini were made blunt-ended with mung bean nuclease. Mutations were introduced in the s47 context by annealing complementary oligonucleotides carrying specific base changes. Double-stranded oligonucleotides were cloned into s26 either between the SalI and HindIII sites (s47a, oligonucleotides 47a1 and 47a2; s47b, oligonucleotides 47b1 and 47b2; s47c, oligonucleotides 47c1 and 47c2), or between the AvaI and SalI sites (s47in1; oligonucleotides 47in1a and 47in1b; s47in2, oligonucleotides 47in2a and 47in2b). Constructs s/Doc6 and Doc6/s were obtained by exchanging the SalI-NcoI fragments, which span the Doc DE1-DE3 array and the 5′ end portion of the CAT gene, between s47 and Doc6-42. Oligonucleotides used are as follows, listed in a 5′ to 3′ configuration: D132, GTTAGTTGTGCAAACTGCAC; D218, CATTGTTCTAAGTCCAC; SA1, GAATTGATTCGGCATTCCACAG; SA2, TCGACTGTGGAATGCCGAATCAATTC; 6A1, CACTCGTGGATTCGCAG; 6A2, TCGACTGCGAATCCACGAGTG; SB1, TCGACGGGTGGAGACGTGTTTCTTT; SB2, AAAGAAACACGTCTCCACCCG; 6B1, TCGACATTCGCGGACGTGTTTCTTT; 6B2, AAAGAAACACGTCCGCGAATG; 47a1, TCGACTTCATGAGACGTGTTTCTTT; 47a2, AAAGAAACACGTCTCATGAAG; 47b1, TCGACGGGTGGCTCATGCATTCTTT; 47b2, AAAGAATGCATGAGCCACCCG; 47c1, TCGACGGGTGGAGACGTGTTGAAGA; 47c2, TCTTCAACACGTCTCCACCCG; 47in1a, GAATTCGTGAGGCATTCCACAG; 47in1b, TCGACTGTGGAATGCCTCACGAATTC; 47in2a, CCCGGGTGCCTCTTTCGGCATTCCACAG; and 47in2b, TCGACTGTGGAATGCCGAAAGAGGCAC. In all cloning procedures, incompatible termini were made blunt-ended by T4 DNA polymerase before ligation (Sambrook et al., 1989). The orientation of cloned DNA was assessed in all recombinants by nucleotide sequence analysis according to standard procedures (Hattori and Sakaki, 1986).DNA Transfections and CAT AssaysThree ml of D. melanogaster S2 cells, seeded at a density of 1 × 106 to 2 × 106 per ml, were transfected as described previously (Di Nocera and Dawid, 1983). Five μg of the plasmid of interest and 5 μg of λF-gal were cotransfected per 65-mm diameter culture dish. λF-gal is a reference construct in which the Escherichia coli β-galactosidase gene is under the control of the D. melanogaster hsp70 core promoter, flanked 5′ by a DNA segment from the D. melanogaster F element. Forty-eight hours after transfection, cells were harvested, resuspended in 0.2 ml of 0.25 M Tris (pH 7.8), and lysed by three cycles of freeze-thawing. The amount of β-galactosidase activity in each lysate was used to normalize the amount of extract with which CAT assays were performed. CAT and β-galactosidase activities were measured according to standard procedures (Sambrook et al., 1989).RNA AnalysesTotal RNA was analyzed by primer extension according to Grimaldi and Di Nocera(1988). Reaction products were resolved on 6% polyacrylamide, 8 M urea gels. Sequencing ladders were generated by the dideoxy chain termination method utilizing double-stranded DNA templates. The CAT primer was described previously (Minchiotti and Di Nocera, 1991). Northern analyses were carried out according to standard procedures (Sambrook et al., 1989). Thirty μg of total RNA from Schneider II cells co-transfected with 5 μg of λF-gal and 5 μg of suAδ1 or suAδ2 were electrophoresed on a 1% formaldehyde-agarose gel. The gel, blotted onto a HyBond+ membrane, was hybridized to an HindIII-NcoI fragment from pEMBL8CAT spanning the CAT gene. The filter was subsequently hybridized to a EcoRI-XhoI fragment from pC4βgal (Thummel et al., 1988) spanning the β-galactosidase gene. Hybridization was carried out in 4 × SSC, 50% formamide for 16 h at 45°C. The filter was washed two times in 2 × SSC for 30 min at 65°C, and three times in 0.1 × SSC for 30 min at 65°C before autoradiography.RESULTSThe 5′ End Regions of Distinct Doc Elements Promote CAT Expression in S2 CellsThe promoters of different LINE elements are located in the 5′ end region of unit-size family copies (Mizrokhi et al., 1988; Minchiotti and Di Nocera, 1991; Minakami et al., 1992; McLean et al., 1993). Since complete Doc elements are heterogeneous at the 5′ end both in length and sequence content (Driver et al., 1989), we checked the template competence of three different unit-length Doc copies: su(f)S2, Doc6, and Doc11 (Driver et al., 1989). The element su(f)S2, associated with a spontaneous lethal mutation of the suppressor of forked (su(f)), transposed in the recent past (Schalet, 1986), and should have a functional promoter region. This is the case, since a restriction fragment spanning the interval 1-267 of su(f)S2 stimulated the expression of the CAT gene in Drosophila S2 cells (Fig. 1, suN). The elements Doc6 and Doc11 were both isolated from a genomic DNA library. Doc11 is homologous to su(f)S2, but is 7 bp shorter at the 5′ end. Doc6 is 5 bp shorter than su(f)S2 and also differs at the 5′ end by an additional 29 residues (Driver et al., 1989; see Fig. 6). Aside from these differences, the three elements are identical in sequence down to the NaeI sites used for cloning (data not shown). Despite the extensive changes, plasmid 6N, which carries residues 1-262 of Doc6, directed CAT expression nearly at the same levels of suN. In contrast, the construct 11N, which carries residues 1-260 of Doc11, was Ȭ10-fold less efficient than suN in directing the expression of the CAT gene (Fig. 1).Figure 1Expression of Doc-CAT plasmids in S2 cells. Thick bars denote Doc DNA from the elements su(f)S2, Doc11, and Doc6 flanking 5′ the CAT gene in the various constructs analyzed. Thin bars denote flanking genomic DNA. The interval of Doc DNA included in each construct is given. Restriction sites within Doc DNA used for cloning are indicated. S2 cells, transfected with 5 μg of each of the listed recombinants and 5 μg of the internal control plasmid λF-gal, were assayed for CAT activity. The amount of lysate used in each assay was normalized to the expression of the cotransfected λF-gal plasmid. Numbers express relative enzymatic activities, obtained by dividing the specific activities by the level of suN expression, and represent average values of three to four independent transfections carried out with different cell populations. S.D. are indicated.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 6Alignment of the 5′ end regions of Doc, F, I factor, and jockey elements. (C/G)ATTCG motifs in Doc6 and su(f)S2 are underlined. Site(s) of transcription initiation and the regions defined as DE1, DE2, and DE3 are boxed. The regions of su(f)S2 and Doc6 in which SalI sites have been created are highlighted. References (in parentheses) are as follows: Doc6, su(f)S2 and Doc 11 (this work; Driver et al., 1989), F (Minchiotti and Di Nocera, 1991), I factor (Fawcett et al., 1986), and jockey (Mizrokhi et al. 1988). Residues flanking the element Doc11 are in lowercase letters.View Large Image Figure ViewerDownload Hi-res image Download (PPT)An AluI site conserved in the Doc 5′ UTR was used to construct three clones (Fig. 1, suA, 11A, and 6A) in which Ȭ50 bp from the 5′ end of each element preceded the CAT gene. These constructs directed CAT expression at higher (5-8-fold) levels than the parental ones, suN, 11N, and 6N (Fig. 1).Information sufficient to direct transcription is thus restricted in Doc to a relatively small DNA interval. This contrasts what has been reported for the F element, in which basal transcription is stimulated by sequences located far downstream from the 5′ end region (Contursi et al., 1993).Doc Sequences Inhibit CAT Expression in an Orientation- and Position-dependent MannerData shown in Fig. 1 suggest that the AluI-NaeI interval, which was removed in plasmids of the A series, contains sequences which inhibit CAT expression. Via polymerase chain reaction cloning (see “Materials and Methods”), we obtained two 3′ deletion derivatives of suN in which Doc DNA extended 3′ to residue 218 (construct su218) or 132 (construct su132). The removal of the region 219-267 was sufficient to delete inhibitory sequences from suN (Fig. 2A). Construct su132 directed CAT expression Ȭ2-fold less efficiently than su218. This may denote either that positive DNA sequences are located between residues 132 and 218, or that transcripts directed by the two constructs have different stability.One interpretation of the data is that the region 219-267, which we will call herein δ, hosts a silencer-like element. Silencers generally inhibit transcription in a position and orientation independent manner (Laurenson and Rine, 1992). δ, cloned in either orientation upstream of a copy of the D. melanogaster hsp70 promoter transcribing the CAT gene, did not reduce CAT expression (data not shown). Subsequently, δ was cloned into the plasmid suA, either upstream (δ1suA and δ2suA) or downstream (suAδ1 and suAδ2) of the su(f)S2 promoter. We found that CAT expression was inhibited only when δ flanked 3′, in direct orientation, the su(f)S2 promoter (Fig. 2B). CAT levels were reduced, again in an orientation-dependent fashion (control data not shown) in cells transfected with RSVδ1, a construct in which δ had been cloned between the CAT gene and the Rous sarcoma virus (RSV) promoter (Fig. 2B).The position- and orientation-dependent mode of action suggests that inhibitory sequences within δ act at the RNA, rather than at the DNA level. This hypothesis is supported by Northern blot analyses showing that suAδ1 transcripts accumulated at levels 2-3-fold higher than suAδ2 transcripts (Fig. 2C). Northern data also ruled out that the inhibition is associated to enhanced degradation of CAT transcripts.Upstream AUG triplets may inhibit translation initiation at natural AUGs (Liu et al., 1984), and an ATG is present within δ (see Fig. 2A). However, by assaying derivatives of both suA and RSVCAT in which the CAT gene is flanked 5′ by either the left-hand (ϵ) or the right-hand (η) portion of δ (Fig. 2A), we observed CAT inhibition with the ϵ, but not with the η subregion, which includes the δ ATG (Fig. 2B). The ϵ subregion extends 5′ to residue 208 and carries an ATG, not present in δ (Fig. 2A). We cannot therefore rule out that data obtained with suAϵ1 and RSVϵ1 reflect an inhibitory action of the ϵ ATG, which is the codon for the initiating methionine of the hypothetical Doc open reading frame 1, on the translation of the CAT mRNA.Functional Organization of the Doc Promoter RegionSites of transcription initiation in su(f)S2, Doc6, and Doc11 were determined by RNA primer extension analyses by using total RNA from cells transfected with suA, 6A, 11A, and an oligomer complementary to the CAT coding region as a primer. To set unambiguously the RNA 5′ ends, reaction products were electrophoresed along with sequencing ladders of the three plasmids (Fig. 3). Transcription initiates predominantly at 6 and 7 in su(f)S2 and at 1 and 2 in Doc6 (in both elements 1 refers to the first residue flanking the target site). Faint bands of elongation may be artifactual or mark minor sites of RNA initiation at −20, 9, and 19 in su(f)S2 and at −19, −3, 5, and 16 in Doc6. A faint band, corresponding to transcripts initiating at 17 in Doc11, was the only discrete product of extension detected with RNA from cells transfected with 11A.Figure 3Primer extension analysis of Doc-CAT RNAs. Total RNA (40 μg) from S2 cells transfected with 11A, suA, or 6A was hybridized to a 32P-5′-end-labeled 30-mer (CAT primer) complementary to the CAT gene sense strand. Annealed primer moieties were extended, in the presence of deoxynucleoside triphosphates, by avian reverse transcriptase. Reaction products were run on a 6% acrylamide, 8 M urea gel, along with sequencing ladders of the 11A, suA, and 6A templates obtained by the dideoxy chain termination method using the CAT primer. Predominant RNA start sites, marked by arrows, are shown along with the DNA sequence of the 5′ end of each element at the bottom. Lowercase letters denote flanking DNA; target sites setting the 5′ boundaries of su(f)S2 and Doc6 are underlined. Residue 2 in the su(f)S2element is A and not G as previously reported (Driver et al., 1989).View Large Image Figure ViewerDownload Hi-res image Download (PPT)The organization of the cis-acting elements involved in the control of Doc transcription was investigated by assaying plasmids in which the CAT gene is under the control of different versions of the su(f)S2 promoter region. A construct carrying the interval 1-26 directed CAT expression, but could not drive faithful RNA initiation (Fig. 4, construct s26). A 10-fold increase in CAT levels, and a correct transcription pattern, was observed by using as template a construct carrying the interval 1-47 (Fig. 4, s47). In s26 and s47, the dinucleotide TT, found in su(f)S2 at residues 25-26, is replaced by GA. The change, which created in s47 a SalI site between residues 22 and 27 (Fig. 4A), did not perturb promoter function, as judged by comparing the expression of suA and s47 (data not shown). By repairing the termini of s47 DNA after SalI cleavage with either the Klenow enzyme or the mung bean nuclease, we obtained constructs in which the interval 27-47 of su(f)S2 was moved either 4 bp away from (s47 + 4) or 5 bp closer to (s47 - 5) the RNA start site(s). Both space changes severely reduced CAT expression (Fig. 4A). Primer extension data showed that faithful RNA initiation was abolished in the construct s47 + 4 (Fig. 4B).Figure 4A, effect of base and space changes within the su(f)S2 promoter. The sequence of the interval 1-47 from su(f)S2 flanking the CAT gene in s47 is shown at the top. Lowercase letters denote residues mutated to create a SalI site. Sequence identities are denoted by dashes in the clones listed below. Residues deleted in s47 - 5 are denoted by asterisks. The site of insertion of extra nucleotides in s47 + 4 is marked by an arrow. The RNA start site region and the RGAGCTGY motif are boxed. Sites of RNA initiation at residues 6 and 7 and the SalI site between residues 22 and 27 are underlined. The regions denoted in the text as DE1, DE2, and DE3 are indicated. Relative CAT activities and S.D. were calculated as described in the legend to Fig. 1. B, transcription initiation in different su(f)S2 derivatives. Total RNA (30 μg) from S2 cells transfected with the constructs listed below was analyzed by primer extension as described in the legend to Fig. 3. Lanes: 1, s26; 2, s47; 3, s47 + 4; 4, s47; 5, s47a; 6, s47b; 7, s47c. Sequencing ladders of either s26 (lane R, G + A reactions; lane Y, C + T reactions) or s47 (lanes G, A, T, and C) were obtained by the dideoxy chain termination method with the same 30 mer (CAT primer) used for RNA extension. Taking into account the length of the vector DNA segment separating Doc from CAT sequences in the construct s26, bands in lane 1 corresponding to faithfully initiated transcripts should be 7-8 nucleotides shorter than the doublet detected in lane 2.View Large Image Figure ViewerDownload Hi-res image Download (PPT)The interval 25-47 spans a DNA sequence (AGACGTGT, residues 33-42; see Fig. 4A) which is conserved in all Drosophila LINEs (consensus RGACGTGY; see Fig. 6). The transcriptional pattern of the construct 47b indicates that this sequence has a key role in Doc transcription (Fig. 4, A and B). The reduced template activity of both s47 + 4 and s47 - 5 may be due to the novel position of the RGACGTGY motif, which is located in all Drosophila LINEs at the same distance from the RNA start site(s) (see Fig. 6). However, the situation is more complex, since we found that base changes introduced either to the left (residues 28-32, construct s47a) or to the right of the AGACGTGT sequence (residues 43-47, construct s47c) also impaired promoter function (Fig. 4, A and B). Results thus indicate that three adjacent downstream sequences, herein called DE1, DE2, and DE3 (Fig. 4A) stimulate transcription of the su(f)S2 element.Sequences spanning the RNA start sites also have a critical role in transcriptional promotion. The RNA start site regions of su(f)S2 (GATTCG, residues 6-11) and Doc6 (CACTCG, residues 1-6) fit the consensus (C/G)AYTCG (RNA start sites are underlined; see Fig. 3). The notion that the (C/G)AYTCG motif spans an initiator (Inr) module is supported by the analysis of the construct 47in1. This clone, in which residues 6-10 of su(f)S2 have been changed from GATTC to cgTga, directed CAT expression Ȭ70-fold less efficiently than the parental construct s47 (Fig. 4A). We have also constructed a derivative of s47 (s47in2) in which residues 1-7 of su(f)S2 have been replaced by the heptamer TGCCTCT, which is the sequence found at the same relative position in Doc11 (see Fig. 6). Base changes introduced in s47in2 did not impair CAT expression (Fig. 4A). This result suggests that the template activity of Doc11 does not correlate with base changes in the Inr region, but possibly reflects the negative interference of flanking genomic DNA.The organization of promoter sequences is similar, on the whole, in su(f)S2 and Doc6 (Fig. 5). The construct Doc6-21, which carries the interval 1-21 of Doc6, directed CAT expression Ȭ50-fold less efficiently than Doc6-42, a construct in which Doc6 DNA extended 3′ to residue 42 (Fig. 5). Faithful RNA initiation was observed with Doc6-42, but not with Doc6-21 (data not shown). By mutating residues 17 and 22 of Doc6, a SalI site was also introduced into Doc6-42. SalI sites in s47 and Doc6-42 are at the same distance from the RNA start site region (Fig. 5). Similarly to what was observed with the s47 + 4 construct (Fig. 4), the insertion of 4 bp in the Doc6 promoter region significantly reduced CAT expression (Fig. 5, construct Doc6-42 + 4) and abolished faithful RNA initiation (data not shown). The DNA region dislodged in Doc6-42 + 4 corresponds to the DE1-DE3 array. Interestingly, while DE2 (with a single base pair change) and DE3 are conserved in Doc6 and su(f)S2, the DE1 region varies (Fig. 5 and Fig. 6). Comparison of the template activities of Doc6-42, s47, and two chimeric clones (Doc6/s and s/Doc6) in which regulatory sequences of Doc6 and su(f)S2 have been exchanged, suggests that the two DE1-DE3 arrays are functionally equivalent (Fig. 5).Figure 5Analysis of the Doc6 promoter. Residues 1-42 from Doc6 flanking the CAT gene in Doc6-42 are shown at the top. In the clones listed below, sequence identities are denoted by dashes. Residues 1-47 from su(f)S2 flanking 5′ the CAT gene in s47 are shown at the bottom. In Doc6/s and s/Doc6, residues from s47 are in uppercase letters. The SalI sites in Doc6-42 and s47, underlined in the figure, have been exploited to exchange Doc6 and su(f)S2 regulatory sequences in constructs Doc6/s and s/Doc6 (see “Materials and Methods”). Sites of RNA initiation in Doc6 and su(f)S2 are boxed. The site of insertion of extra nucleotides in Doc6-42 + 4 is marked by an arrow. The regions denoted as DE1, DE2, and DE3 in su(f)S2 are shown. Relative CAT activities and S.D. were calculated as described in the legend to Fig. 1.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Doc Elements Lack an Antisense PromoterIn addition to a sense promoter (Fin) transcribing toward the 3′ end, the 5′ end region of the D. melanogaster F element also hosts an antisense promoter (Fout) located Ȭ100 bp downstream from the Fin RNA start site (Minchiotti and Di Nocera, 1991; Contursi et al., 1993). The relatedness of Doc and F elements (see O'Hare et al.(1991)) prompted the search for an antisense promoter in the 5′ end region of Doc. suN-inv, a construct in which the DNA region cloned in suN (Fig. 1) is reversed with respect to the CAT gene, directed CAT expression Ȭ60 times less efficiently than F-cat2, a construct in which the CAT gene is flanked 5′ by the 267/1 region from the F element (see Minchiotti and Di Nocera, 1991). We were unable to map, by primer extension and RNase protection experiments, specific sites of initiation of" @default.
• W2068105796 created "2016-06-24" @default.
• W2068105796 creator A5022425737 @default.
• W2068105796 creator A5036684517 @default.
• W2068105796 creator A5045965755 @default.
• W2068105796 date "1995-11-01" @default.
• W2068105796 modified "2023-09-26" @default.
• W2068105796 title "Identification of Sequences Which Regulate the Expression of Drosophila melanogaster Doc Elements" @default.
• W2068105796 cites W108099615 @default.
• W2068105796 cites W1230664046 @default.
• W2068105796 cites W1554644662 @default.
• W2068105796 cites W1580973227 @default.
• W2068105796 cites W1846058178 @default.
• W2068105796 cites W1867705227 @default.
• W2068105796 cites W188344188 @default.
• W2068105796 cites W1932076246 @default.
• W2068105796 cites W1968247607 @default.
• W2068105796 cites W1968458054 @default.
• W2068105796 cites W1972450504 @default.
• W2068105796 cites W1973031832 @default.
• W2068105796 cites W1973312959 @default.
• W2068105796 cites W1977452020 @default.
• W2068105796 cites W1980483123 @default.
• W2068105796 cites W1980680952 @default.
• W2068105796 cites W1980878358 @default.
• W2068105796 cites W1998926449 @default.
• W2068105796 cites W2001497872 @default.
• W2068105796 cites W2005764402 @default.
• W2068105796 cites W2009358818 @default.
• W2068105796 cites W2012418253 @default.
• W2068105796 cites W2017049255 @default.
• W2068105796 cites W2019761115 @default.
• W2068105796 cites W2028542734 @default.
• W2068105796 cites W2028954926 @default.
• W2068105796 cites W2036080603 @default.
• W2068105796 cites W2041731107 @default.
• W2068105796 cites W2045309408 @default.
• W2068105796 cites W2055835650 @default.
• W2068105796 cites W2060573304 @default.
• W2068105796 cites W2061054814 @default.
• W2068105796 cites W2084265940 @default.
• W2068105796 cites W2086262494 @default.
• W2068105796 cites W2109664605 @default.
• W2068105796 cites W2109851339 @default.
• W2068105796 cites W2110925400 @default.
• W2068105796 cites W2124463201 @default.
• W2068105796 cites W2153554144 @default.
• W2068105796 cites W2165238976 @default.
• W2068105796 cites W2170072994 @default.
• W2068105796 cites W2171154002 @default.
• W2068105796 cites W60074620 @default.
• W2068105796 doi "https://doi.org/10.1074/jbc.270.44.26570" @default.
• W2068105796 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/7592878" @default.
• W2068105796 hasPublicationYear "1995" @default.
• W2068105796 type Work @default.
• W2068105796 sameAs 2068105796 @default.
• W2068105796 citedByCount "23" @default.
• W2068105796 countsByYear W20681057962014 @default.
• W2068105796 crossrefType "journal-article" @default.
• W2068105796 hasAuthorship W2068105796A5022425737 @default.
• W2068105796 hasAuthorship W2068105796A5036684517 @default.
• W2068105796 hasAuthorship W2068105796A5045965755 @default.
• W2068105796 hasBestOaLocation W20681057961 @default.
• W2068105796 hasConcept C104317684 @default.
• W2068105796 hasConcept C116834253 @default.
• W2068105796 hasConcept C199360897 @default.
• W2068105796 hasConcept C2776041557 @default.
• W2068105796 hasConcept C2776998849 @default.
• W2068105796 hasConcept C2780104201 @default.
• W2068105796 hasConcept C41008148 @default.
• W2068105796 hasConcept C54355233 @default.
• W2068105796 hasConcept C59822182 @default.
• W2068105796 hasConcept C70721500 @default.
• W2068105796 hasConcept C86803240 @default.
• W2068105796 hasConcept C90559484 @default.
• W2068105796 hasConcept C95444343 @default.
• W2068105796 hasConceptScore W2068105796C104317684 @default.
• W2068105796 hasConceptScore W2068105796C116834253 @default.
• W2068105796 hasConceptScore W2068105796C199360897 @default.
• W2068105796 hasConceptScore W2068105796C2776041557 @default.
• W2068105796 hasConceptScore W2068105796C2776998849 @default.
• W2068105796 hasConceptScore W2068105796C2780104201 @default.
• W2068105796 hasConceptScore W2068105796C41008148 @default.
• W2068105796 hasConceptScore W2068105796C54355233 @default.
• W2068105796 hasConceptScore W2068105796C59822182 @default.
• W2068105796 hasConceptScore W2068105796C70721500 @default.
• W2068105796 hasConceptScore W2068105796C86803240 @default.
• W2068105796 hasConceptScore W2068105796C90559484 @default.
• W2068105796 hasConceptScore W2068105796C95444343 @default.
• W2068105796 hasIssue "44" @default.
• W2068105796 hasLocation W20681057961 @default.
• W2068105796 hasOpenAccess W2068105796 @default.
• W2068105796 hasPrimaryLocation W20681057961 @default.
• W2068105796 hasRelatedWork W1980609583 @default.
• W2068105796 hasRelatedWork W2037025856 @default.
• W2068105796 hasRelatedWork W2900758826 @default.
• W2068105796 hasRelatedWork W4234538176 @default.
• W2068105796 hasRelatedWork W4234848017 @default.

• next