FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2068163116> ?p ?o ?g. }

• W2068163116 endingPage "44376" @default.
• W2068163116 startingPage "44369" @default.
• W2068163116 abstract "Phosphorylation of SNARE proteins may provide a critical link between cell activation and secretory processes. Platelets contain all three members of the SNAP-23/25/29 gene family, but by comparison to brain tissue, SNAP-23 is the most highly enriched of these proteins in platelets. SNAP-23 function is required for exocytosis from platelet α, dense, and lysosomal granules. SNAP-23 was phosphorylated largely on serine residues in platelets activated with thrombin. Phosphorylation kinetics paralleled or preceded granule secretion. Inhibition studies suggested that SNAP-23 phosphorylation proceeds largely through a protein kinase C (PKC) mechanism and purified PKC directly phosphorylated recombinant (r-) SNAP-23 (up to 0.3 mol of phosphate/mol of protein). Five major tryptic phosphopeptides were identified in cellular SNAP-23 isolated from activated platelets; three phosphopeptides co-migrated with those identified in PKC-phosphorylated r-SNAP-23. In contrast, only one major phosphopeptide was identified when SNAP-23, engaged in a ternary SNARE complex, was phosphorylated by PKC. Ion trap mass spectrometry revealed that platelet SNAP-23 was phosphorylated at Ser23/Thr24 and Ser161, after cell activation by thrombin; these sites were also identified in PKC-phosphorylated r-SNAP-23. SNAP-23 mutants that mimic phosphorylation at Ser23/Thr24 inhibited syntaxin 4 interactions, whereas a phosphorylation mutant of Ser161 had only minor effects. Taken together these studies show that SNAP-23 is phosphorylated in platelets during cell activation through a PKC-related mechanism at two or more sites with kinetics that parallel or precede granule secretion. Because mutants that mimic SNAP-23 phosphorylation affect syntaxin 4 interactions, we hypothesize that SNAP-23 phosphorylation may be important for modulating SNARE-complex interactions during membrane trafficking and fusion. Phosphorylation of SNARE proteins may provide a critical link between cell activation and secretory processes. Platelets contain all three members of the SNAP-23/25/29 gene family, but by comparison to brain tissue, SNAP-23 is the most highly enriched of these proteins in platelets. SNAP-23 function is required for exocytosis from platelet α, dense, and lysosomal granules. SNAP-23 was phosphorylated largely on serine residues in platelets activated with thrombin. Phosphorylation kinetics paralleled or preceded granule secretion. Inhibition studies suggested that SNAP-23 phosphorylation proceeds largely through a protein kinase C (PKC) mechanism and purified PKC directly phosphorylated recombinant (r-) SNAP-23 (up to 0.3 mol of phosphate/mol of protein). Five major tryptic phosphopeptides were identified in cellular SNAP-23 isolated from activated platelets; three phosphopeptides co-migrated with those identified in PKC-phosphorylated r-SNAP-23. In contrast, only one major phosphopeptide was identified when SNAP-23, engaged in a ternary SNARE complex, was phosphorylated by PKC. Ion trap mass spectrometry revealed that platelet SNAP-23 was phosphorylated at Ser23/Thr24 and Ser161, after cell activation by thrombin; these sites were also identified in PKC-phosphorylated r-SNAP-23. SNAP-23 mutants that mimic phosphorylation at Ser23/Thr24 inhibited syntaxin 4 interactions, whereas a phosphorylation mutant of Ser161 had only minor effects. Taken together these studies show that SNAP-23 is phosphorylated in platelets during cell activation through a PKC-related mechanism at two or more sites with kinetics that parallel or precede granule secretion. Because mutants that mimic SNAP-23 phosphorylation affect syntaxin 4 interactions, we hypothesize that SNAP-23 phosphorylation may be important for modulating SNARE-complex interactions during membrane trafficking and fusion. SNAP 1The abbreviations used are: SNAP, soluble N-ethylmaleimide-sensitive factor attachment protein; SNARE, soluble N-ethylmaleimidesensitive factor attachment protein receptor; NSF, N-ethylmaleimidesensitive factor; VAMP, vesicle-associated membrane protein; PSP, platelet Sec1/Munc18 protein; PKC, protein kinase C; PMA, phorbol 12-myristate 13-acetate; MAPK, mitogen-activated protein kinase; PGI2, prostaglandin I2; MS/MS, tandem mass spectrometry; r-, recombinant; GST, glutathione S-transferase; PRP, platelet-rich plasma; BSA, bovine serum albumin; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid; PIPES, 1,4-piperazinediethanesulfonic acid; PVDF, polyvinylidene difluoride.1The abbreviations used are: SNAP, soluble N-ethylmaleimide-sensitive factor attachment protein; SNARE, soluble N-ethylmaleimidesensitive factor attachment protein receptor; NSF, N-ethylmaleimidesensitive factor; VAMP, vesicle-associated membrane protein; PSP, platelet Sec1/Munc18 protein; PKC, protein kinase C; PMA, phorbol 12-myristate 13-acetate; MAPK, mitogen-activated protein kinase; PGI2, prostaglandin I2; MS/MS, tandem mass spectrometry; r-, recombinant; GST, glutathione S-transferase; PRP, platelet-rich plasma; BSA, bovine serum albumin; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid; PIPES, 1,4-piperazinediethanesulfonic acid; PVDF, polyvinylidene difluoride. receptor proteins (SNAREs) play a critical role in intracellular membrane trafficking/fusion in all eukaryotes (1Sollner T. Bennett M.K. Whiteheart S.W. Scheller R.H. Rothman J.E. Cell. 1993; 75: 409-418Abstract Full Text PDF PubMed Scopus (1564) Google Scholar, 2Rothman J.E. Nature. 1994; 372: 55-63Crossref PubMed Scopus (1993) Google Scholar). SNAREs assemble into tight complexes that connect membranes and may induce membrane fusion. The prototypic SNARE complex contains one member from three different gene families: SNAP-25, syntaxin, and VAMP. The SNARE proteins contribute four α-helices to produce an extremely stable four-helix bundle with 16 highly conserved layers of interacting amino acid side chains (for classification of SNAREs and numbering the layers, see Refs. 3Fasshauer D. Sutton R.B. Brunger A.T. Jahn R. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 15781-15786Crossref PubMed Scopus (726) Google Scholar and 4Sutton R.B. Fasshauer D. Jahn R. Brunger A.T. Nature. 1998; 395: 347-353Crossref PubMed Scopus (1881) Google Scholar). The assembly and disassembly of the SNARE complexes are under the kinetic control of N-ethylmaleimide-sensitive factor (NSF) and soluble NSF attachment proteins (SNAPs), as well as Rab GTPases and Sec1/Munc18 family proteins (reviewed in Ref. 5Jahn R. Sudhof T.C. Annu. Rev. Biochem. 1999; 68: 863-911Crossref PubMed Scopus (1008) Google Scholar). Regulated exocytosis or secretion from cells is a subset of intracellular membrane trafficking and fusion. In specialized secretory cells, such as neurons, neuroendocrine cells, or platelets, exocytosis from secretory vesicles is triggered by intracellular signals produced by cell activation through cell surface receptors or membrane depolarization. Phosphorylation of SNARE machinery proteins may be an important signal in regulated secretion. Phosphorylation of synaptic vesicle proteins has been implicated in the regulation of neurotransmitter release (6Greengard P. Valtorta F.C. Czernik A.J. Benfenati F. Science. 1993; 259: 780-785Crossref PubMed Scopus (1110) Google Scholar). SNAREs have been shown to be substrates of purified or recombinant kinases in vitro (7Nielander H.B. Onofri F. Valtorta F. Schiavo G. Montecucco C. Greengard P. Benfenati F. J. Neurochem. 1995; 65: 1712-1720Crossref PubMed Scopus (84) Google Scholar, 8Hirling H. Scheller R.H. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 11945-11949Crossref PubMed Scopus (157) Google Scholar, 9Foster L.J. Yeung B. Mohtashami M. Ross K. Trimble W.S. Klip A. Biochemistry. 1998; 37: 11089-11096Crossref PubMed Scopus (112) Google Scholar, 10Risinger C. Bennett M.K. J. Neurochem. 1999; 72: 614-624Crossref PubMed Scopus (147) Google Scholar), as well as of endogenous kinases in some neuroendocrine cells or yeast (11Shimazaki Y. Nishiki T. Omori A. Sekiguchi M. Kamata Y. Kozaki S. Takahashi M. J. Biol. Chem. 1996; 271: 14548-14553Abstract Full Text Full Text PDF PubMed Scopus (220) Google Scholar, 12Genoud S. Pralong W. Riederer B.M. Eder L. Catsicas S. Muller D. J. Neurochem. 1999; 72: 1699-1706Crossref PubMed Scopus (55) Google Scholar, 13Foletti D.L. Lin R. Finley M.A.F. Scheller R.H. J. Neurosci. 2000; 20: 4535-4544Crossref PubMed Google Scholar, 14Marash M. Gerst J.E. EMBO J. 2001; 20: 411-421Crossref PubMed Scopus (54) Google Scholar) (for review, see Ref. 15Vaughan P.F. Walker J.H. Peers C. Mol. Neurobiol. 1998; 18: 125-155Crossref PubMed Scopus (98) Google Scholar). Still, a clear picture has yet to emerge about the functional significance, the cell or developmental specificity, and the control of SNARE phosphorylation. Platelets play an important role in thrombosis, arteriosclerosis, and vascular remodeling through regulated secretion of effector molecules from platelet granules. The molecular secretory machinery in platelets has important homologies to the machinery found in neurons and other cells (reviewed in Ref. 16Reed G.L. Fitzgerald M.L. Polgar J. Blood. 2000; 96: 3334-3342PubMed Google Scholar). Platelets contain SNARE proteins (17Lemons P.P. Chen D. Bernstein A.M. Bennett M.K. Whiteheart S.W. Blood. 1997; 90: 1490-1500Crossref PubMed Google Scholar, 18Reed G.L. Houng A.K. Fitzgerald M.L. Blood. 1999; 93: 2617-2626Crossref PubMed Google Scholar, 19Polgar J. Reed G.L. Blood. 1999; 94: 1313-1318Crossref PubMed Google Scholar, 20Flaumenhaft R. Croce K. Chen E. Furie B. Furie B.C. J. Biol. Chem. 1999; 274: 2492-2501Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar) that form SNARE complexes in vitro that support SNAP-dependent NSF-ATPase activity (17Lemons P.P. Chen D. Bernstein A.M. Bennett M.K. Whiteheart S.W. Blood. 1997; 90: 1490-1500Crossref PubMed Google Scholar). SNAP-dependent NSF is critical for exocytosis of α and dense granules (19Polgar J. Reed G.L. Blood. 1999; 94: 1313-1318Crossref PubMed Google Scholar), as well as lysosomes (21Chen D. Lemons P.P. Schraw T. Whiteheart S.W. Blood. 2000; 96: 1782-1788Crossref PubMed Google Scholar). Platelet membranes contain syntaxins 2 and 4, and they have been shown to be required for platelet secretion (18Reed G.L. Houng A.K. Fitzgerald M.L. Blood. 1999; 93: 2617-2626Crossref PubMed Google Scholar, 20Flaumenhaft R. Croce K. Chen E. Furie B. Furie B.C. J. Biol. Chem. 1999; 274: 2492-2501Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar, 21Chen D. Lemons P.P. Schraw T. Whiteheart S.W. Blood. 2000; 96: 1782-1788Crossref PubMed Google Scholar, 22Chen D. Bernstein A.M. Lemons P.P. Whiteheart S.W. Blood. 2000; 95: 921-929Crossref PubMed Google Scholar). VAMPs have been shown to be present in platelets (20Flaumenhaft R. Croce K. Chen E. Furie B. Furie B.C. J. Biol. Chem. 1999; 274: 2492-2501Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar, 23Bernstein A.M. Whiteheart S.W. Blood. 1999; 93: 571-579Crossref PubMed Google Scholar, 24Polgar J. Chung S.H. Reed G.L. Blood. 2002; 100: 1081-1083Crossref PubMed Scopus (129) Google Scholar), and VAMP 3 and 8 are required for granule secretion (24Polgar J. Chung S.H. Reed G.L. Blood. 2002; 100: 1081-1083Crossref PubMed Scopus (129) Google Scholar). Platelets also contain SNAP-23, but less is known about SNAP-25 and SNAP-29. SNAP-23 is a ubiquitously expressed non-neuronal homolog (25Ravichandran V. Chawla A. Roche P.A. J. Biol. Chem. 1996; 271: 13300-13303Abstract Full Text Full Text PDF PubMed Scopus (288) Google Scholar) that shares 59% identity with SNAP-25 at the amino acid level. Like SNAP-25, SNAP-23 does not possess a transmembrane domain but it is palmitoylated on one or more cysteine residues present in a central palmitoylation domain, which allows anchoring to membranes (26Vogel K. Roche P.A. Biochem. Biophys. Res. Commun. 1999; 258: 407-410Crossref PubMed Scopus (81) Google Scholar). There is 32% identity between SNAP-29 and SNAP-25, and 26% identity between SNAP-29 and SNAP-23. It is likely that SNAP-29, like other two members of this subfamily, contributes two helical domains to the formation of a four-helix SNARE bundle (27Steegmaier M. Bin Yang B. Yoo J.S. Huang B. Shen M. Yu S. Luo Y. Scheller R.H. J. Biol. Chem. 1998; 273: 34171-34179Abstract Full Text Full Text PDF PubMed Scopus (163) Google Scholar). Recent data show that the SNAREs are key players in the membrane trafficking/fusion events that accompany platelet granule secretion. It is poorly understood how platelet activation by agonists acting on cell surface receptors is linked to SNARE-mediated platelet granule secretion. We have shown that platelet Sec1/Munc18 (PSP) (8Hirling H. Scheller R.H. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 11945-11949Crossref PubMed Scopus (157) Google Scholar) and syntaxin 4 (28Chung S.H. Polgar J. Reed G.L. J. Biol. Chem. 2000; 275: 25286-25291Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar) are phosphorylated in a protein kinase C (PKC)-dependent fashion when the platelet is activated. Phosphorylation of PSP and syntaxin 4 modulates their interactions with other proteins, and thus may regulate secretion (8Hirling H. Scheller R.H. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 11945-11949Crossref PubMed Scopus (157) Google Scholar, 28Chung S.H. Polgar J. Reed G.L. J. Biol. Chem. 2000; 275: 25286-25291Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar). These recent findings establish a possible link of the SNARE machinery through PKC signaling to receptor-mediated cell activation in platelets. In this report we examine the expression of members of the SNAP-25 family in platelets. SNAP-23 is an abundantly expressed member of this family and is required for secretion from all three types of platelet granules. Inhibition studies indicate that phosphorylation of SNAP-23 is PKC-dependent. With cell activation, SNAP-23 is phosphorylated at two sites in platelets, Ser23/Thr24 and Ser161. Both of these sites were also identified as phosphorylation sites when recombinant (r-) SNAP-23 was phosphorylated by purified PKC. Thus, SNAP-23 is a target for phosphorylation in platelets when cells are activated to secrete by thrombin. SNAP-23 phosphorylation kinetics parallel or precede granule secretion, suggesting that SNARE phosphorylation may play a functional role in exocytosis. This hypothesis was supported by the finding that mutants of SNAP-23 that mimic phosphorylation at Ser23/Thr24 showed reduced binding to syntaxin 4, indicating that phosphorylation of SNAP-23 at these sites may affect SNARE interactions. Materials—Antibodies against human r-SNAP-23 were generated in rabbits and affinity-purified using immobilized antigens. Rabbit polyclonal anti-SNAP-23 peptide (amino acids 192–216) antisera were from Synaptic Systems (Gottingen, Germany). Anti-syntaxin 4 monoclonal antibodies were purchased from Transduction Laboratories (Lexington, KY). Anti-phosphotyrosine monoclonal antibodies, 4G10, and purified PKC were from Upstate Biotechnology (Lake Placid, NJ); anti-P-selectin monoclonal antibodies (AK-6) were from Biodesign (Kennebunk, ME). Monoclonal antibodies against human recombinant PSP were generated in mice. All kinase inhibitors and recombinant PKC isozymes were from Calbiochem (San Diego, CA). 5-Hydroxy-[2-14C]tryptamine creatinine sulfate ([14C]serotonin) was from Amersham Biosciences. Preparation of Recombinant SNAREs and SNARE Complexes— SNAP-23 and the cytosolic domain of syntaxin 4 were produced as described (28Chung S.H. Polgar J. Reed G.L. J. Biol. Chem. 2000; 275: 25286-25291Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar). SNAP-23 Ser23 → Asp/Thr24 → Asp and Ser161 → Asp mutants were produced by overlap PCR using the following primers: for Ser23 → Asp/Thr24 → Asp, CCATGGATAATCTGTCATCAGA and CTAAACCCAGGATTCTCC, GATGAGTCTCTGGAAGATGATAGGAGAATCCTGGGTTTAG and CGATCGTTAGCTGTCAATGAGTTTC, CCATGGATAATCTGTCATCAGA and CGATCGTTAGCTGTCAATGAGTTTC; for Ser161 → Asp, CCATGGATAATCTGTCATCAGA and CTTTTAGATTTACCAGGATATCGCCCACTTGAGTCAG, CGATCGTTAGCTGTCAATGAGTTTC and GATATCCTGGGAAATCTAAAAG, CCATGGATAATCTGTCATCAGA and CGATCGTTAGCTGTCAATGAGTTTC. DNA from two clones each for Ser23 → Asp/Thr24 → Asp and Ser161 → Asp mutants with correct sequences (verified with double-stranded DNA sequencing) were ligated in-frame into the NcoI and KpnI sites of pProEX HTA expression vector (Invitrogen). Recombinant SNAP-23 proteins were produced as described for SNAP-23 (28Chung S.H. Polgar J. Reed G.L. J. Biol. Chem. 2000; 275: 25286-25291Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar). Six recombinant GST-tagged proteins representing the native N- and C-terminal SNARE motifs of SNAP-23 as well as the Asp or Ala mutants in positions Ser23/Thr24 and Ser161 were also produced using standard protocols (29Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A. Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar) and the GST tag was cleaved with thrombin. The cytosolic domain of human VAMP 2 was produced as recombinant GST-tagged (Amersham Biosciences) protein in Escherichia coli using standard protocols (29Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A. Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar), the GST tag was cleaved with thrombin, and VAMP 2 was further purified by FPLC as described (30Fasshauer D. Otto H. Eliason W.K. Jahn R. Brunger A.T. J. Biol. Chem. 1997; 272: 28036-28041Abstract Full Text Full Text PDF PubMed Scopus (273) Google Scholar). Ternary complexes of SNAP-23, syntaxin 4, and VAMP 2 were produced and purified as described (31Fasshauer D. Eliason W.K. Brunger A.T. Jahn R. Biochemistry. 1998; 37: 10354-10362Crossref PubMed Scopus (203) Google Scholar). Binding Assays—The binding of SNAP-23 and SNAP-23 mutants to syntaxin 4 was studied in a solid-phase assay similar as described previously (18Reed G.L. Houng A.K. Fitzgerald M.L. Blood. 1999; 93: 2617-2626Crossref PubMed Google Scholar, 28Chung S.H. Polgar J. Reed G.L. J. Biol. Chem. 2000; 275: 25286-25291Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar). Wells of a microtiter plate were coated with recombinant syntaxin 4 (50 μl of 10 μg/ml) for 1–2 h and blocked with 2% bovine serum albumin. Coated syntaxin 4 was incubated with native or mutated SNAP-23 (using the indicated concentrations, time, and temperatures). The wells were washed to remove unbound proteins, and polyclonal anti-SNAP-23 antiserum (200-fold dilution) was added for 1 h. (Preliminary experiments confirmed that the SNAP-23 antibody bound equally well to the SNAP-23 point mutants). After washing, the bound antibody was detected by 125I-protein A (50,000 cpm/50 μl). In Vitro Phosphorylation of Recombinant Proteins—Phosphorylation of recombinant SNAP-23 and SNAP-23/syntaxin 4/VAMP 2 complexes with PKC was performed as described for the phosphorylation of syntaxin 4 (28Chung S.H. Polgar J. Reed G.L. J. Biol. Chem. 2000; 275: 25286-25291Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar). Phosphoamino Acid Analysis and Phosphopeptide Fingerprinting— SNAP-23 (immunoprecipitated from 32P-labeled platelets, and r-SNAP-23 phosphorylated with PKC and [32P]ATP) was separated from other proteins by SDS-PAGE and immobilized on PVDF membranes by electroblotting. Phosphoamino acid analysis and two-dimensional (tryptic) phosphopeptide mapping (phosphopeptide fingerprinting) were performed as described by Sefton (32Sefton B.M. Chanda V.B. Current Protocols in Molecular Biology. Wiley and Sons, Edison, NJ1995: 18.3.1-18.3.8Google Scholar) and Meisenhelder et al. (33Meisenhelder J. Hunter T. van der Geer P. Taylor G. Current Protocols in Protein Science. Wiley and Sons, Edison, NJ1999: 13.9.1-13.9.27Google Scholar). For phosphopeptide fingerprinting, first dimension electrophoresis was performed at pH 1.9 and second dimension chromatography was performed in n-butyl alcohol:pyridine:glacial acetic acid:water (5:3.3:1:4). Platelet and Recombinant SNAP-23 Phosphorylation Site Determination by Ion Trap Mass Spectrometry—Platelet-rich plasma (PRP) from four healthy volunteers was prepared as described (19Polgar J. Reed G.L. Blood. 1999; 94: 1313-1318Crossref PubMed Google Scholar). Platelets were pelleted with centrifugation and resuspended at a 10-fold concentration in a modified Tyrode's buffer containing 137 mm NaCl, 2.8 mm KCl, 1 mm MgCl2, 12 mm NaHCO3, 0.4 mm Na2HPO4, 5.5 mm glucose, 1 mm EDTA, 10 mm Hepes, pH 7.4. The samples were kept in a 37 °C water bath; a small portion of the sample was used to measure the platelet count and P-selectin expression. P-selectin expression on non-stimulated cells was <2% of that in thrombin-stimulated cells, confirming that the platelets were not activated. The samples were combined and diluted with buffer to 1.4 × 109 platelets/ml of suspension. Half of the platelet sample was activated with 1 unit/ml thrombin, whereas the other half was treated with 1 μm prostaglandin I2 (PGI2) for 30 s. Platelets were then solubilized by adding 0.1 volume of lysis buffer (2.5% SDS, 50 mm EDTA, 100 mm Na3VO4, 100 mm NaF, 1 mg/ml leupeptin) and 0.05 volume of freshly dissolved 20 mm phenylmethylsulfonyl fluoride, and samples were put on ice. The samples were boiled in 1-ml aliquots for 5 min, allowed to cool to room temperature, and diluted with 4 volumes of 1.25× buffer A (buffer A: 1% Triton X-100, 5 mm EDTA, 5 mm Na3VO4, 5 mm NaF, 100 μg/ml leupeptin, 100 μg/ml aprotinin, 20 mm Tris-HCl, pH 7.4). Anti-SNAP-23 antibodies (affinity-purified using immobilized SNAP-23) were coupled to cyanogen bromide-activated Sepharose 4B (Sigma). The gel (1 ml of settled gel, 4 mg of coupled IgG/ml) was equilibrated with buffer A before adding it to the platelet lysate. After a 2-h rotation at room temperature, the gel was settled in a small column and washed first with 10 ml of buffer A followed with 40 ml of 140 ml NaCl, 20 mm Tris-HCl, pH 7.4. Bound proteins were eluted with 5 ml of 20 mm CHAPS, 0.1 mm glycine, pH 2.9. The pH was neutralized with 50 μl of 3 m Tris, and the sample was concentrated to 100 μl using Centricon 10 (Amicon, Beverly, MA) concentrator. The concentrated sample contained ∼4 μg of SNAP-23 as determined by quantitative immunoblotting with calibration curves obtained with human r-SNAP-23. After reducing SDS-PAGE (12% gel) and visualization with traditional Coomassie staining, the band corresponding to SNAP-23 was subjected to in gel reduction, carboxyamidomethylation, and tryptic digestion (Promega). Phosphorylated peptide sequences were determined using a 75-μm reverse phase microcolumn terminating in a custom nanoelectrospray source directly coupled to a LCQ DECA XP Plus quadrupole ion trap mass spectrometer (ThermoFinnigan). The flow rate was nominally 200 nl/min. The ion trap repetitively surveyed the range m/z 395–1600, executing data-dependent tandem mass spectrometry (MS/MS) for peptide sequence information on the four most abundant ions in each survey scan. MS/MS spectra were acquired with a relative collision energy of 30% and an isolation width of 2.5 daltons, and recurring ions were dynamically excluded. After data base correlation with the algorithm SEQUEST (34Eng J.K. McCormack A.L. Yates J.R.I. J. Am. Soc. Mass Spectrom. 1994; 5: 976-989Crossref PubMed Scopus (5314) Google Scholar), phosphorylated peptides were confirmed by manual, de novo interpretation of the MS/MS spectra using FuzzyIons (35Chittum H. Lane W. Carlson B. Roller P. Lung F. Lee B. Hatfield D. Biochemistry. 1998; 37: 10866-10870Crossref PubMed Scopus (184) Google Scholar). Measurement of the Effects of Kinase Inhibitors on Thrombin-induced SNAP-23 Phosphorylation in Platelets—Thrombin-induced SNAP-23 phosphorylation in intact (not permeabilized) platelets was measured as described for syntaxin 4 phosphorylation (28Chung S.H. Polgar J. Reed G.L. J. Biol. Chem. 2000; 275: 25286-25291Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar) with the modification that the 32P-loaded platelets were incubated with the kinase inhibitors at room temperature for 30 min instead of at 30 °C for 15 min. Measurement of Granule Secretion and SNAP-23 Phosphorylation in Parallel Assays—Human PRP was prepared from freshly drawn blood as described (9Foster L.J. Yeung B. Mohtashami M. Ross K. Trimble W.S. Klip A. Biochemistry. 1998; 37: 11089-11096Crossref PubMed Scopus (112) Google Scholar). PGI2 (0.2 μm) was added, and the PRP was incubated in a 37 °C water bath for 1 h with and without [14C]serotonin addition (3 μlof50 μCi/ml, 57 mCi/mmol [14C]serotonin per ml of PRP). Platelets were pelleted with centrifugation and resuspended in 0.33 volume of the original PRP in a buffer containing 137 mm NaCl, 2.8 mm KCl, 1 mm MgCl2, 12 mm NaHCO3, 5.5 mm glucose, 1 mm EDTA, 0.2 μm PGI2, 10 mm Hepes, pH 7.4. Then 0.1 volume of water or 32P-labeled inorganic phosphate (10 mCi/ml, specific activity of 285 Ci/mg) was added. The samples were incubated in a 30 °C water bath for 1 h. Then 0.01 volume of 10% bovine serum albumin (BSA) was added, and the platelets were pelleted by centrifugation and resuspended in the above buffer now containing 0.1% BSA and no PGI2. Platelets loaded with [14C]serotonin or 32P were used to measure granule secretion or phosphorylation of SNAP-23, respectively. Non-stirred platelet samples were activated with various concentrations of thrombin at room temperature (22 ± 1.5 °C). For granule secretion measurements, platelet activation was terminated by adding 1 volume of 2% ice-cold paraformaldehyde and putting the samples on ice. α granule secretion was monitored by measuring P-selectin expression with phycoerythrin-conjugated anti-CD62 antibodies AC1.2 (Becton Dickinson) and flow cytometry (FACSCalibur, Becton Dickinson) as described (36Michelson A.D. Shattil S.J. Watson S.P. Authi K.S. Platelets: A Practical Approach. IRL Press, Oxford1996: 111-129Google Scholar). Typically, 2.5 μl of fixed platelets were added to 97.5 μl of antibody solution. After 15 min the samples were diluted with 1 ml of Tyrode's buffer containing 0.35% BSA and analyzed. Total or 100% P-selectin expression was defined as that induced in 10 min by 1 unit/ml thrombin. P-selectin expression on non-stimulated platelets was <2%. The remaining samples were centrifuged at 2500 × g for 1 min, and the supernatants were used for scintillation counting of [14C]serotonin to assess dense granule secretion. Total or 100% [14C]serotonin secretion was defined as the [14C]serotonin secreted from platelets activated with 1 unit/ml thrombin for 10 min. For the measurement of SNAP-23 phosphorylation (32P samples), platelet activation was terminated by adding lysis buffer and phenylmethylsulfonyl fluoride (above) and the samples were put on ice. The samples were boiled for 5 min, cooled to room temperature, and diluted with 4 volumes of 1.25× radioimmunoprecipitation assay buffer as described (28Chung S.H. Polgar J. Reed G.L. J. Biol. Chem. 2000; 275: 25286-25291Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar). Immunoprecipitation with anti-SNAP-23 antibodies and immunoblotting was performed as described (28Chung S.H. Polgar J. Reed G.L. J. Biol. Chem. 2000; 275: 25286-25291Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar). Phospho-SNAP-23 was detected by phosphorimaging, whereas SNAP-23 protein in the membrane was detected with chemifluorescence imaging (Storm 840, Molecular Dynamics). To allow comparison between individual experiments, the phosphorimaging pixel values for each SNAP-23 band were normalized to the corresponding chemifluorescence pixel values. Measurement of Granule Secretion in Permeabilized Platelets—Platelets were pelleted from PRP by centrifugation and resuspended to a concentration of 8 × 108/ml in a Ca2+ -buffering solution (buffer B, 20 mm PIPES, pH 7.4, 150 mm potassium glutamate, 5 mm glucose, 2.5 mm EDTA, 2.5 mm EGTA, 0.05% BSA). Streptolysin O (Sigma) was dissolved in buffer B at a concentration of 25,000 units/ml, reduced with 2 mm dithiothreitol at 4 °C for 1 h, and stored at –70 °C in aliquots. Platelets (20 μl) were mixed with buffer B (25 μl) containing 200–400 units/ml streptolysin O and 150 μg/ml anti-SNAP-23 antibodies or pre-immune rabbit IgG. The samples were incubated first at room temperature for 10 min and on ice for 30 min. Then ATP (50 mm) and magnesium diacetate (125 mm) in 5 μl of buffer B were added, and the samples were incubated at room temperature for 10 min. Granule secretion was induced by increasing the free calcium ion concentration to 10 μm by adding CaCl2 in buffer B. The free calcium ion concentration was determined by the calcium ion titration curves described by Knight and Scrutton (37Knight D.E. Scrutton M.C. Methods Enzymol. 1993; 221: 123-138Crossref PubMed Scopus (5) Google Scholar). After 5 min of incubation, 3-μl samples were used for the measurement of α granule secretion (as described below), the remaining samples were put on ice and centrifuged at 2500 × g for 1 min, and the supernatants were used for scintillation counting of [14C]serotonin to assess dense granule secretion and for the measurement of hexosaminidase activity to assess lysosomal secretion as described (21Chen D. Lemons P.P. Schraw T. Whiteheart S.W. Blood. 2000; 96: 1782-1788Crossref PubMed Google Scholar). α granule secretion was monitored by measuring P-selectin expression with phycoerythrin-conjugated anti-CD62 antibodies AC1.2 and flow cytometry as described (36Michelson A.D. Shattil S.J. Watson S.P. Authi K.S. Platelets: A Practical Approach. IRL Press, Oxford1996: 111-129Google Scholar). Total (100%) P-selectin expression was defined as that induced by 1 unit/ml thrombin" @default.
• W2068163116 created "2016-06-24" @default.
• W2068163116 creator A5004790643 @default.
• W2068163116 creator A5008678762 @default.
• W2068163116 creator A5050492805 @default.
• W2068163116 creator A5055736230 @default.
• W2068163116 creator A5057334965 @default.
• W2068163116 date "2003-11-01" @default.
• W2068163116 modified "2023-10-17" @default.
• W2068163116 title "Phosphorylation of SNAP-23 in Activated Human Platelets" @default.
• W2068163116 cites W1219610608 @default.
• W2068163116 cites W1547732923 @default.
• W2068163116 cites W1572613835 @default.
• W2068163116 cites W176610512 @default.
• W2068163116 cites W1787997737 @default.
• W2068163116 cites W1822252127 @default.
• W2068163116 cites W1931583840 @default.
• W2068163116 cites W1971016259 @default.
• W2068163116 cites W1972977742 @default.
• W2068163116 cites W1980169797 @default.
• W2068163116 cites W1982086194 @default.
• W2068163116 cites W1987974548 @default.
• W2068163116 cites W1990522517 @default.
• W2068163116 cites W1997205185 @default.
• W2068163116 cites W1997858399 @default.
• W2068163116 cites W1999213641 @default.
• W2068163116 cites W2005595613 @default.
• W2068163116 cites W2015713712 @default.
• W2068163116 cites W2016266703 @default.
• W2068163116 cites W2020929196 @default.
• W2068163116 cites W2024619588 @default.
• W2068163116 cites W2026465178 @default.
• W2068163116 cites W2031210286 @default.
• W2068163116 cites W2034200840 @default.
• W2068163116 cites W2042212641 @default.
• W2068163116 cites W2045144602 @default.
• W2068163116 cites W2045375596 @default.
• W2068163116 cites W2047808133 @default.
• W2068163116 cites W2051275839 @default.
• W2068163116 cites W2051719256 @default.
• W2068163116 cites W2055553278 @default.
• W2068163116 cites W2060175659 @default.
• W2068163116 cites W2063441753 @default.
• W2068163116 cites W2071540264 @default.
• W2068163116 cites W2085825273 @default.
• W2068163116 cites W2091259680 @default.
• W2068163116 cites W2107982867 @default.
• W2068163116 cites W2131653836 @default.
• W2068163116 cites W2147905210 @default.
• W2068163116 cites W2202062616 @default.
• W2068163116 cites W2272595293 @default.
• W2068163116 cites W3112667425 @default.
• W2068163116 cites W66055673 @default.
• W2068163116 cites W74426933 @default.
• W2068163116 doi "https://doi.org/10.1074/jbc.m307864200" @default.
• W2068163116 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12930825" @default.
• W2068163116 hasPublicationYear "2003" @default.
• W2068163116 type Work @default.
• W2068163116 sameAs 2068163116 @default.
• W2068163116 citedByCount "85" @default.
• W2068163116 countsByYear W20681631162012 @default.
• W2068163116 countsByYear W20681631162013 @default.
• W2068163116 countsByYear W20681631162014 @default.
• W2068163116 countsByYear W20681631162015 @default.
• W2068163116 countsByYear W20681631162016 @default.
• W2068163116 countsByYear W20681631162017 @default.
• W2068163116 countsByYear W20681631162018 @default.
• W2068163116 countsByYear W20681631162019 @default.
• W2068163116 countsByYear W20681631162020 @default.
• W2068163116 countsByYear W20681631162021 @default.
• W2068163116 countsByYear W20681631162022 @default.
• W2068163116 countsByYear W20681631162023 @default.
• W2068163116 crossrefType "journal-article" @default.
• W2068163116 hasAuthorship W2068163116A5004790643 @default.
• W2068163116 hasAuthorship W2068163116A5008678762 @default.
• W2068163116 hasAuthorship W2068163116A5050492805 @default.
• W2068163116 hasAuthorship W2068163116A5055736230 @default.
• W2068163116 hasAuthorship W2068163116A5057334965 @default.
• W2068163116 hasBestOaLocation W20681631161 @default.
• W2068163116 hasConcept C11960822 @default.
• W2068163116 hasConcept C121684516 @default.
• W2068163116 hasConcept C185592680 @default.
• W2068163116 hasConcept C203014093 @default.
• W2068163116 hasConcept C2779997099 @default.
• W2068163116 hasConcept C41008148 @default.
• W2068163116 hasConcept C86803240 @default.
• W2068163116 hasConcept C89560881 @default.
• W2068163116 hasConcept C95444343 @default.
• W2068163116 hasConceptScore W2068163116C11960822 @default.
• W2068163116 hasConceptScore W2068163116C121684516 @default.
• W2068163116 hasConceptScore W2068163116C185592680 @default.
• W2068163116 hasConceptScore W2068163116C203014093 @default.
• W2068163116 hasConceptScore W2068163116C2779997099 @default.
• W2068163116 hasConceptScore W2068163116C41008148 @default.
• W2068163116 hasConceptScore W2068163116C86803240 @default.
• W2068163116 hasConceptScore W2068163116C89560881 @default.
• W2068163116 hasConceptScore W2068163116C95444343 @default.
• W2068163116 hasIssue "45" @default.

• next