FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2069073973> ?p ?o ?g. }

• W2069073973 endingPage "405" @default.
• W2069073973 startingPage "399" @default.
• W2069073973 abstract "The combination of psoralens and UVA radiation (PUVA photochemotherapy) is an established treatment for many skin disorders. UVA-induced psoralen–DNA interactions are assumed to contribute to the cutaneous anti-inflammatory and anti-proliferative effects of PUVA. PUVA-induced DNA modifications might interfere not only with DNA replication, but also with gene transcription of proinflammatory genes. We therefore studied the effect of PUVA on cell proliferation and on the transcription of the c-jun and intercellular adhesion molecule-1 genes in a promyelocytic (HL60) and a keratinocyte (HaCaT) cell line. PUVA inhibited cell proliferation increasingly with increasing 8-methoxypsoralen concentrations or UVA doses. The inhibition was observed at conditions not affecting cell viability up to 48 h after PUVA. In contrast, PUVA did not inhibit gene transcription at anti-proliferative, yet nonlethal conditions. Baseline and phorbol-ester induced c-jun mRNA expression was not inhibited, nor was baseline and IFN-γ or phorbol-ester induced intercellular adhesion molecule-1 mRNA expression. In order to assess possible transcriptional effects of PUVA-generated reactive oxygen intermediates, the reactive oxygen intermediates-sensitive transcription factor nuclear factor κB was assayed in mobility shift experiments. Nuclear factor κB-specific binding activity was not induced 1–24 h after PUVA in extracts from PUVA-treated cells when compared with controls, whereas the pro-oxidant cytokine TNF-α caused a marked increase in nuclear factor κB binding. The presented data suggest that PUVA inhibits cell proliferation, but not transcription, at nonlethal PUVA conditions. Furthermore, the data do not support a major role for PUVA-generated reactive oxygen intermediates in the regulation of gene transcription. The combination of psoralens and UVA radiation (PUVA photochemotherapy) is an established treatment for many skin disorders. UVA-induced psoralen–DNA interactions are assumed to contribute to the cutaneous anti-inflammatory and anti-proliferative effects of PUVA. PUVA-induced DNA modifications might interfere not only with DNA replication, but also with gene transcription of proinflammatory genes. We therefore studied the effect of PUVA on cell proliferation and on the transcription of the c-jun and intercellular adhesion molecule-1 genes in a promyelocytic (HL60) and a keratinocyte (HaCaT) cell line. PUVA inhibited cell proliferation increasingly with increasing 8-methoxypsoralen concentrations or UVA doses. The inhibition was observed at conditions not affecting cell viability up to 48 h after PUVA. In contrast, PUVA did not inhibit gene transcription at anti-proliferative, yet nonlethal conditions. Baseline and phorbol-ester induced c-jun mRNA expression was not inhibited, nor was baseline and IFN-γ or phorbol-ester induced intercellular adhesion molecule-1 mRNA expression. In order to assess possible transcriptional effects of PUVA-generated reactive oxygen intermediates, the reactive oxygen intermediates-sensitive transcription factor nuclear factor κB was assayed in mobility shift experiments. Nuclear factor κB-specific binding activity was not induced 1–24 h after PUVA in extracts from PUVA-treated cells when compared with controls, whereas the pro-oxidant cytokine TNF-α caused a marked increase in nuclear factor κB binding. The presented data suggest that PUVA inhibits cell proliferation, but not transcription, at nonlethal PUVA conditions. Furthermore, the data do not support a major role for PUVA-generated reactive oxygen intermediates in the regulation of gene transcription. intercellular adhesion molecule nuclear factor κB psoralens and UVA radiation reactive oxygen intermediates The combination of psoralens with UVA radiation (PUVA photochemotherapy) has been used for more than 20 y to treat psoriasis and several other skin diseases (Parrish et al., 1974Parrish J.A. Fitzpatrick T.B. Tanenbaum L. Pathak M.A. Photochemotherapy of psoriasis with oral methoxalen and longwave ultraviolet light.N Engl J Med. 1974; 291: 1207-1211Crossref PubMed Scopus (1185) Google Scholar;Honig et al., 1994Honig B. Morison W.L. Karp D. Photochemotherapy beyond psoriasis.J Am Acad Dermatol. 1994; 31: 775-790Abstract Full Text PDF PubMed Scopus (54) Google Scholar;Lüftl et al., 1997Lüftl M. Degitz K. Plewig G. Röcken R. Psoralen bath plus UV-A therapy – possibilities and limitations.Arch Dermatol. 1997; 133: 1597-1603Crossref PubMed Google Scholar). The exact molecular mechanisms responsible for the therapeutic efficacy of PUVA are still a matter of debate. It is generally believed that DNA modifications may represent one therapeutic mode of action. Psoralens intercalate DNA. UVA induces the formation of psoralen-DNA photoadducts in direct photochemical reactions (oxygen-independent type I reaction) that may result in cross-linking of the DNA double helix and inhibition of DNA replication (Song and Tapley, 1979Song P.-S. Tapley K.J. Photochemistry and photobiology of psoralens.Photochem Photobiol. 1979; 29: 1177-1197Crossref PubMed Scopus (547) Google Scholar). Additional DNA modifications may indirectly result from the generation of intracellular reactive oxygen intermediates (ROI) by PUVA (oxygen-dependent type II reaction) (Hönigsmann et al., 1993Hönigsmann H. Fitzpatrick T.B. Pathak M.A. Wolff K. Oral photochemotherapy with psoralens and UVA (PUVA): principles and practice.in: Fitzpatrick T.B. Eisen A.Z. Wolff K. Freedberg I.M. Austen K.F. Dermatology in General Medicine. McGraw-Hill, New York1993: 1728-1754Google Scholar). PUVA-induced psoralen-DNA photoadducts inhibit cell proliferation. Interference with DNA synthesis has been demonstrated in the skin in vivo (Walter et al., 1973Walter J.F. Kelsey W.H. Voorhees J.J. Duell E.A. Psoralen plus black light inhibits epidermal DNA synthesis.Arch Dermatol. 1973; 107: 861-865Crossref PubMed Scopus (122) Google Scholar;Epstein and Fukuyama, 1975Epstein J.H. Fukuyama K. Effects of 8-methoxypsoralen-induced phototoxic effects on mammalian epidermal macromolecule synthesis.In Vivo. Photochem Photobiol. 1975; 21: 325-330Crossref PubMed Scopus (63) Google Scholar;Fritsch et al., 1979Fritsch P.O. Gschnait F. Kaaserer G. Brenner W. Chaikittisilpa S. Hönigsmann H. Wolff K. PUVA suppresses the proliferative stimulus produced by stripping on hairless mice.J Invest Dermatol. 1979; 73: 188-190Abstract Full Text PDF PubMed Scopus (20) Google Scholar) and in dermatologically relevant cell types in vitro, including fibroblasts (Baden et al., 1972Baden H.P. Parrington J.M. Delhanty J.D.A. DNA synthesis in normal and xeroderma pigmentosum fibroblasts following treatment with 8-methoxypsoralen and long wave ultraviolet light.Biochim Biophys Acta. 1972; 262: 247-255Crossref PubMed Scopus (111) Google Scholar;Cohen et al., 1981Cohen S.R. Carter D.M. Gala M. Proliferative response patterns of human fibroblasts after photoinjury with 4,5′,8-trimethylpsoralen.J Invest Dermatol. 1981; 76: 10-14Abstract Full Text PDF PubMed Scopus (5) Google Scholar), keratinocytes (Tokura et al., 1991Tokura Y. Yagi J. Edelson R.L. Gasparro F.P. Inhibitory effect of 8-methoxypsoralen plus ultraviolet-A on interleukin-1 production by murine keratinocytes.Photochem Photobiol. 1991; 53: 517-523Crossref PubMed Scopus (24) Google Scholar;Vallat et al., 1994Vallat V.P. Gilleaudeau P. Battat L. et al.PUVA bath therapy strongly suppresses immunological and epidermal activation in psoriasis: a possible cellular basis for remittive therapy.J Exp Med. 1994; 180: 283-296Crossref PubMed Scopus (173) Google Scholar), melanocytes (Kao and Yu, 1992Kao C.H. Yu H.S. Comparison of the effect of 8-methoxypsoralen (8-MOP) plus UVA (PUVA) on human melanocytes in vitiligo vulgaris and in vitro.J Invest Dermatol. 1992; 98: 734-740Crossref PubMed Scopus (62) Google Scholar), or leukocytes (Scherer et al., 1977Scherer R. Kern B. Braun-Falco O. The human peripheral lymphocyte – a model system for studying the combined effect of psoralen plus black light.Klin Wschr. 1977; 55: 137-140Crossref PubMed Scopus (19) Google Scholar;Morison et al., 1981Morison W.L. Parrish J.A. McAuliff D.J. Bloch K.L. Sensitivity of mononuclear cells to PUVA. effect on subsequent stimulation with mitogens and on exclusion of trypan blue dye.Clin Exper Dermatol. 1981; 108: 273-277Crossref Scopus (16) Google Scholar;Kraemer, 1982Kraemer K.H. In vitro assay of the effects of psoralens plus ultraviolet radiation on human lymphoid cells.J Natl Cancer Inst. 1982; 69: 219-227PubMed Google Scholar). At low doses, PUVA-induced growth inhibition may be fully reversible and may not affect cell viability (Kao and Yu, 1992Kao C.H. Yu H.S. Comparison of the effect of 8-methoxypsoralen (8-MOP) plus UVA (PUVA) on human melanocytes in vitiligo vulgaris and in vitro.J Invest Dermatol. 1992; 98: 734-740Crossref PubMed Scopus (62) Google Scholar). At somewhat higher doses, however, PUVA also induces apoptosis and cell necrosis (Marks and Fox, 1991Marks D.I. Fox R.M. Mechanisms of photochemotherapy-induced apoptotic cell death in lymphoid cells.Biochem Cell Biol. 1991; 69: 754-760Crossref PubMed Scopus (54) Google Scholar;Yoo et al., 1996Yoo E.K. Rook A.H. Elenitsas R. Gasparro F.P. Vowels B.R. Apoptosis induction by ultraviolet light a and photochemotherapy in cutaneous T cell lymphoma: relevance to mechanism of therapeutic action.J Invest Dermatol. 1996; 107: 235-242Crossref PubMed Scopus (253) Google Scholar). In addition to interfering with DNA replication, PUVA may also affect the transcription of genes, if the photoadducts are located at promoters or transcribed gene segments. Inflammatory diseases could thus be ameliorated by inhibiting the expression of proinflammatory cytokines or adhesion molecules. Studies addressing the effect of PUVA on gene expression have so far produced divergent results. Both inhibitions (Tokura et al., 1991Tokura Y. Yagi J. Edelson R.L. Gasparro F.P. Inhibitory effect of 8-methoxypsoralen plus ultraviolet-A on interleukin-1 production by murine keratinocytes.Photochem Photobiol. 1991; 53: 517-523Crossref PubMed Scopus (24) Google Scholar;Neuner et al., 1994Neuner P. Charvat B. Knobler R. Kirnbauer R. Schwarz A. Luger T.A. Schwarz T. Cytokine release by peripheral blood mononuclear cells is affected by 8-methoxypsoralen plus UV-A.Photochem Photobiol. 1994; 59: 182-188Crossref PubMed Scopus (48) Google Scholar) and increases (Moor et al., 1995Moor A.C. Schmitt I.M. Beijersbergen van Henegouwen G.M. Chimenti S. Edelson R.L. Gasparro F.P. Treatment with 8-MOP and UVA enhances MHC class I synthesis in RMA cells: preliminary results.J Photochem Photobiol. 1995; 29: 193-198Crossref PubMed Scopus (47) Google Scholar;Bernstein et al., 1996Bernstein E.F. Gasparro F.P. Brown D.B. Takeuchi T. Kong S.K. Uitto J. 8-methoxypsoralen and ultraviolet a radiation activate the human elastin promoter in transgenic mice: in vivo.Photochem Photobiol. 1996; 64: 369-374Crossref PubMed Scopus (19) Google Scholar;Mohamadzadeh et al., 1996Mohamadzadeh M. McGuire M.J. Dougherty I. Cruz P.D. Interleukin-15 expression by human endothelial cells: up-regulation by ultraviolet B and psoralen plus ultraviolet A treatment.Photodermatol Photoimmunol Photomed. 1996; 12: 17-21Crossref PubMed Scopus (20) Google Scholar) of gene expression have been reported. In this study we have investigated the effects of PUVA on DNA replication and promoter function at dosages not affecting cell viability, and show that in such a situation PUVA results in the inhibition of cell proliferation, but not in the inhibition of gene transcription. The human promyelocytic leukemia cell line HL60 was obtained from American Type Culture Collection (Rockville, MD). The spontaneously immortalized, nontumorigenic keratinocyte-derived cell line HaCaT was a kind gift from N. Fusenig (DKFZ, Heidelberg, Germany) (Boukamp et al., 1988Boukamp P. Petrussevska R.T. Breitkreuz D. Hornung J. Markham A. Fusenig N.E. Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line.J Cell Biol. 1988; 106: 761-771Crossref PubMed Scopus (3325) Google Scholar). Cells were cultured in Dulbecco’s modified Eagle’s medium (HaCaT) or RPMI 1640 (HL60) supplemented with 2 mM L-glutamine, antibiotics (100 U penicillin per ml and 100 μg streptomycin per ml), 1 μg amphotericin B per ml (all from Gibco/BRL, Eggenstein, Germany), and 10% fetal calf serum (Biochrom, Berlin, Germany), at 37°C and 5% CO2. In some experiments, IFN-γ, TNF-α (both Pharma Biotechnologie, Hannover, Germany), or the phorbol ester phorbol-12-myristate-13-acetate (PMA; Sigma, Deisenhofen, Germany) were added to cultures. Crystalline 8-methoxypsoralen (8-MOP; Gerot, Vienna, Austria) was dissolved in absolute ethanol at a concentration of 1 mg per ml. This stock solution was always kept in the dark and used for appropriate dilutions for experiments. PUVA treatment of cells was carried out using 8-MOP and UVA irradiation. Cells were preincubated in Petri dishes at varying concentrations of 8-MOP in culture medium at 37°C for 30 min in the dark until immediately before irradiation. During irradiation Petri dishes were floated in a water bath at 37°C for temperature control. Dishes were kept at a fixed location by a rack whose poles extended above water level. UVA was applied with a PUVA 200 light arch (Waldmann, Villingen-Schwenningen, Germany) containing 14 F8T5 PUVA bulbs, whose emission spectrum is mainly between 315 and 365 nm. The energy output was determined by a UV meter (Waldmann) and was 3.8 mW per cm2 at a 28 cm source to target distance. Irradiation times were calculated for the desired range of UVA dosages and were corrected for the loss of energy caused by the passage of radiation through the medium. Immediately after irradiation, cells were provided with fresh medium and incubated at 37°C and 5% CO2 for varying time periods. Unirradiated controls were removed from the incubator during irradiation procedures, but kept from UV exposure. For assessment of PUVA effects on proliferative activity, 10,000 HaCaT or 30,000 HL60 cells were seeded in 96 well plates in quadruplicates in 100 μl culture medium. Immediatly after PUVA 0.5 μCi [3H]thymidine (New England Nuclear, Bad Homburg, Germany) was added to treated cells and to untreated control cells. After 24 h, cells were washed, harvested, and [3H]thymidine incorporation into newly synthesized DNA was determined by scintillation counting. Total cellular RNA was isolated by guanidinium isothiocyanate lysis, acid phenol extraction, and isopropyl alcohol precipitation. Subsequently, the RNA was size-fractioned by formaldehyde/agarose gel electrophoresis and blotted to nylon membranes as described (Sambrook et al., 1989Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: a Laboratory Manual. Harbor Laboratory Press, Cold Spring Harbor, Cold Spring1989Google Scholar). A 1.2 kb Sal I-Kpn I-fragment of an intercellular adhesion molecule (ICAM)-1 cDNA clone (kindly provided by D. Staunton, Dana-Farber Cancer Institute, Boston, MA) and a 1.1 kb fragment of c-jun c-DNA (kindly provided by G. Messer, Department of Dermatology, Ludwig-Maximilians University, Munich, Germany) (Kick et al., 1996Kick G. Messer G. Plewig G. Goetz A.E. Strong and prolonged induction of c-jun and c-fos proto-oncogenes by photodynamic therapy.Br J Cancer. 1996; 74: 30-36Crossref PubMed Scopus (88) Google Scholar) were radiolabeled with [32P]-dCTP (Hartmann, Braunschweig, Germany) via random hexamer primer extension and used as hybridization probes. As a control probe for loading uniformity, a 0.21 kb PCR product amplified from a human glyceraldehyde-3-phosphate dehydrogenase cDNA was used as previously described (Behrends et al., 1994Behrends U. Peter R.U. Hintermeier-Knabe R. Eißner G. Holler E. Bornkamm G.W. Caughman S.W. Degitz K. Ionizing radiation induces human intercellular adhesion molecule-1.In Vitro. J Invest Dermatol. 1994; 103: 726-730Abstract Full Text PDF PubMed Google Scholar). Prehybridization and hybridization were carried out at 42°C in 50% formamide, 1 M NaCl, 10% dextran, 1% sodium dodecyl sulfate, 100 μg per ml yeast tRNA, and 10 mg per ml Salmon sperm DNA. After hybridization overnight, nylon membranes were washed under increasingly stringent salt conditions and autoradiography was performed using XAR-5 films with one intensifying screen at –70°C. ICAM-1 cell surface expression was assessed by a one step staining procedure and subsequent immunofluorescence flow cytometry (FACS analysis). Untreated or PUVA-treated cells were incubated with a fluoroscein isothiocyanate-coupled murine anti-human ICAM-1 monoclonal antibody (Bender Med Systems, Vienna, Austria) or with an fluoroscein isothiocyanate-coupled isotype-matched control monoclonal antibody (mouse IgG1, Dianova, Hamburg, Germany). Subsequently, cells were analyzed in a FACScan II flow cytometer using the Lysis II analysis program (Becton Dickinson, Heidelberg, Germany). As a parameter for cell viability, cell membrane permeability was assessed at varying time points after PUVA by dye-exclusion experiments (trypan blue and propidium iodide staining). Propidium iodide staining was assessed by flow cytometry as described previously (Behrends et al., 1994Behrends U. Peter R.U. Hintermeier-Knabe R. Eißner G. Holler E. Bornkamm G.W. Caughman S.W. Degitz K. Ionizing radiation induces human intercellular adhesion molecule-1.In Vitro. J Invest Dermatol. 1994; 103: 726-730Abstract Full Text PDF PubMed Google Scholar). Briefly, 50 ng propidium iodide (Sigma) were added to cells and FACS analysis performed for the distinction of viable (propidium iodide negative) from dead (propidium iodide positive) cells. Nuclear extracts were prepared as previously described (Ausubel et al., 1989Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. New York, Wiley1989Google Scholar). Briefly, cells were kept in serum-free medium 16 h prior to lysis. Nuclei were isolated either from untreated control cells, from PUVA treated cells at various time points after treatment, or from cells stimulated with TNF-α. Protein content of extracts was quantitated photometrically using the Coomassie protein assay reagent (Pierce, Rochford, Ill). Extracts were normalized for protein concentration prior to analysis. Nuclear extracts from HL60 or HaCaT cells were incubated with 32P-radiolabeled DNA fragments. The incubation was carried out in a 20 μl reaction containing 0.225 mg bovine serum albumin per ml (Sigma), 0.2 mg poly dI/dC per ml (Pharmacia, Uppsala, Sweden), 12 mM HEPES, 4 mM Tris (pH 7.9), 100 mM KCl, 1 mM ethylenediamine tetraacetic acid, 1 mM dithiothreitol, 12.5% (wt/vol) glycerol. A blunt ended double-stranded oligonucleotide containing a consensus-binding sequence for nuclear factor κB (NFκB) that is identical to the NFκB-binding sites of HIV-1 (top strand 5′AGTTGAGGGGACTTTCCCAGGC, binding sequence displayed in bold letters; Promega, Madison, WI) was labeled with [γ-32P] adenosine triphosphate (Hartmann) as previously described (Mueller et al., 1995Mueller S. Kammerbauer C. Simons U. Shibagaki N. Li L.J. Caughman S.W. Degitz K. Transcriptional regulation of intercellular adhesion molecule-1: PMA-induction is mediated by NF kappa B.J Invest Dermatol. 1995; 104: 970-975Crossref PubMed Scopus (38) Google Scholar). For competition studies an unlabeled double-stranded oligonucleotide containing a consensus-binding sequence for AP1 (top strand 5′ CGCTTGATGAGTCAGCCGGAA, binding sequence displayed in bold letters; Promega) was used. Additionally, a blunt ended double-stranded oligonucleotide containing a consensus-binding sequence for SP1 (top strand 5′ ATTCGATCGGGGCGGGGCGAGC, binding sequence displayed in bold letters; Promega) was used. DNA-protein-binding complexes were resolved by electrophesis on nondenaturing 5% polyacrylamide gels in a high ionic strength glycine (14.3% wt/vol) running buffer. Gels were run at 12 V per cm for 2 h, dried, and exposed to Kodak XAR-5 film at –70°C with one intensifying screen. In order to establish a range of psoralen concentrations and UVA dosages that would allow us to study cellular PUVA effects without destroying the investigated cell lines, viability of PUVA-treated cells was analyzed by propidium iodide incorporation 24 h and 48 h after PUVA and compared with untreated controls (Table 1). At 500 ng 8-MOP per ml, cell viability was not reduced after 24 h, when up to 0.25 J per cm2 (HL60) or up to 1 J per cm2 (HaCaT) UVA were applied. UVA doses not reducing viability 48 h after PUVA were only slightly lower, i.e., 0.125 J per cm2 (HL60) and 0.5 J per cm2 (HaCaT). In HL60 cells reduction of the 8-MOP concentration from 500 ng per ml to 100 ng per ml increased the lowest UVA dose not affecting viability 4-fold from 0.125 to 0.5 J per cm2 at 24 h post-PUVA (Table 1). Treatment with either 8-MOP (up to 1000 ng per ml) or UVA (up to 5 J per cm2) alone did not affect cell viability (data not shown). Analysis of cell viability by trypan blue staining gave concordant results.Table IEffect of PUVA on cell viability aCell viability expressed as the percentage (%) of propidium-iodide negative cells determined as described in Materials and Methods.HL 60100 ng 8-MOP per mlcCells treated with 8-MOP as described in Materials and Methods.HL 60 500 ng 8-MOP per ml500 ng 8-MOHaCaT P per ml24 h post-PUVA48 h post-PUVA24 h post-PUVA48 h post-PUVA24 h post-PUVA48 h post-PUVAno UVA8589979495970.05bUVA-irradiation dose in J per cm2.NDND9595NDND0.1258087988392970.258085961794960.57641261291861.06918NDND93692.0NDNDNDND7943a Cell viability expressed as the percentage (%) of propidium-iodide negative cells determined as described in Materials and Methods.b UVA-irradiation dose in J per cm2.c Cells treated with 8-MOP as described in Materials and Methods. Open table in a new tab PUVA-induced DNA-psoralen photoadducts are assumed to inhibit cell proliferation by interference with DNA replication. As a read out for PUVA inhibition of DNA replication, proliferative activity was measured as [3H]thymidine incorporation. Proliferation of HL60 and HaCaT cells was markedly inhibited 24 h after PUVA (Figure 1a,b. Inhibition increased with increasing UVA dosages and was also influenced by the psoralen concentration. When the 8-MOP concentration was reduced, a higher UVA dose was required to achieve a similar inhibition of cell proliferation in HL60 cells (Figure 1a). When cells were incubated with 500 ng 8-MOP per ml, a 50% inhibition of proliferation was achieved with 0.125 J UVA per cm2 in HL60 cells and with 0.25 J UVA per cm2 in HaCaT cells. Thus, proliferation of HL60 and HaCaT cells was markedly inhibited at PUVA conditions not affecting viability of the respective cell line (Table 1). Treatment with 8-MOP (500 ng per ml) or UVA (1 J per cm2) alone did not affect proliferative activity. In order to explore the possibility that PUVA-induced psoralen-DNA photoadducts not only interfere with DNA replication, but also with the transcription of proinflammatory genes at their promoters or at transcribed gene segments, the effects of PUVA on mRNA expression of the immediate early gene c-jun and the adhesion molecule ICAM-1 were studied. The expression of both molecules in response to various inducers is strongly regulated at the transcriptional level (Stein et al., 1992Stein B. Angel P. Van Dam H. Ponta H. Herrlich P. Van der Eb A. Rahmsdorf H.J. Ultraviolet-radiation induced c-jun gene transcription: two AP-1 like binding sites mediate the response.Photochem Photobiol. 1992; 55: 409-415Crossref PubMed Scopus (119) Google Scholar;Van de Stolpe and Van der Saag, 1996Van de Stolpe A. Van der Saag P.T. Intercellular adhesion molecule-1.J Mol Med. 1996; 74: 13-33Crossref PubMed Scopus (632) Google Scholar). Untreated HL60 cells displayed a low baseline c-jun mRNA expression that was not altered by treatment with 8-MOP (500 ng per ml) or UVA (0.25 J per cm2) alone (Figure 2). PUVA effects on mRNA levels were assessed 2 h and 6 h after PUVA. At treatment conditions that markedly inhibit proliferative activity (500 ng 8-MOP per ml, 0.25 J UVA per cm2), PUVA did not reduce baseline c-jun mRNA expression (Figure 2). Rather, a slight mRNA induction was observed 6 h after PUVA. A negative interference of PUVA with transcription might become more obvious in an actively transcribing promoter compared with a promoter with a low baseline activity. Therefore, HL60 cells were treated with PMA, a known inducer of c-jun transcription (Stein et al., 1992Stein B. Angel P. Van Dam H. Ponta H. Herrlich P. Van der Eb A. Rahmsdorf H.J. Ultraviolet-radiation induced c-jun gene transcription: two AP-1 like binding sites mediate the response.Photochem Photobiol. 1992; 55: 409-415Crossref PubMed Scopus (119) Google Scholar), immediately after PUVA. PMA strongly increased the c-jun mRNA level (Figure 2); similar to baseline expression, PMA-induced c-jun mRNA expression was not inhibited by PUVA at conditions that reduce proliferative activity (500 ng 8-MOP per ml, 0.25 J UVA per cm2). Untreated HL60 cells displayed a low baseline ICAM-1 mRNA expression, which was not altered by treatment with 8-MOP (500 ng per ml) or UVA (0.25 J per cm2) alone (Figure 3a). PUVA did not decrease this baseline ICAM-1 mRNA expression at conditions that markedly reduce proliferation (500 ng 8-MOP per ml, 0.25 J UVA per cm2). In order to assess PUVA effects in the situation of a strongly transcribed ICAM-1 gene, ICAM-1 transcription was induced by treating HL60 cells with either IFN-γ (100 U per ml) or PMA (100 ng per ml) immediately after PUVA. IFN-γ and PMA are both inducers of ICAM-1 transcription (Look et al., 1994Look D.C. Pelletier M.R. Holtzman M.J. Selective interaction of a subset of interferon-gamma response element-binding proteins with the intercellular adhesion molecule-1 (ICAM-1) gene promoter controls the pattern of expression on epithelial cells.J Biol Chem. 1994; 269: 8952-8958Abstract Full Text PDF PubMed Google Scholar;Mueller et al., 1995Mueller S. Kammerbauer C. Simons U. Shibagaki N. Li L.J. Caughman S.W. Degitz K. Transcriptional regulation of intercellular adhesion molecule-1: PMA-induction is mediated by NF kappa B.J Invest Dermatol. 1995; 104: 970-975Crossref PubMed Scopus (38) Google Scholar). ICAM-1 mRNA expression was strongly increased by IFN-γ or PMA (Figure 3a). PUVA did not antagonize this induction at conditions that reduce proliferative activity (500 ng 8-MOP per ml, 0.25 J UVA per cm2). Similarly, PUVA also did not inhibit baseline and IFN-γ induced ICAM-1 mRNA expression in the keratinocyte cell line HaCaT (Figure 3b). In summary, no inhibitory PUVA effect on gene transcription was observed at anti-proliferative conditions. In addition to the assessment of PUVA effects on ICAM-1 mRNA expression, ICAM-1 cell surface expression was studied by flow cytometry in HaCaT cells (Figure 4). The baseline ICAM-1 cell surface expression in HaCaT cells was not reduced 24 h after PUVA (500 ng 8-MOP per ml and UVA dosages ranging from 0.05 to 0.5 J per cm2). ICAM-1 expression was markedly induced by 100 U IFN-γ per ml, and this upregulation was not antagonized by PUVA at strongly anti-proliferative conditions (500 ng 8-MOP per ml and UVA dosages ranging from 0.25 to 0.5 J per cm2, applied immediately before IFN-γ). Similar results were observed in HL60 cells both for baseline and for IFN-γ induced ICAM-1 cell surface expression (data not shown). Besides direct interference with transcription at promoters, PUVA may also affect gene expression indirectly by generating ROI (Potapenko, 1991Potapenko A.Y. Mechanisms of photodynamic effects of furocoumarins.J Photochem Photobiol. 1991; 9: 1-33Crossref PubMed Scopus (91) Google Scholar), which in turn may activate transcription factors and modulate transcription. The effect of PUVA on the activity of the ROI-activated transcription factor NFκB (Meyer et al., 1993Meyer M. Schreck R. Baeuerle P.A. H2O2 and antioxidants have opposite effects on activation of NF-kappa B and AP-1 in intact cells: aP-1 as secondary antioxidant-responsive factor.Embo J. 1993; 12: 2005-2015Crossref PubMed Scopus (1256) Google Scholar) was representatively investigated. A double-stranded oligonucleotide probe containing an NFκB consensus-binding site was tested in electrophoretic mobility shift assays against nuclear extracts prepared from untreated or PUVA-treated HaCaT or HL60 cells. The NFκB consensus-binding site binds a slower migrating p50/p65 heterodimer and a faster migrating p50 homodimer (Baeuerle and Henkel, 1994Baeuerle P.A. Henkel T. Function and activation of NF-kappaB in the immune system.Annu Rev Immunol. 1994; 12: 141-179Crossref PubMed Scopus (4531) Google Scholar). In HaCaT cells, baseline DNA–protein complexes were observed when extracts from untreated cells were used (Figure 5a). No clearly enhanced binding was observed in extracts from cells treated with 8-MOP (500 ng per ml for 1 h) or with UVA alone (1 J per cm2, cell extracts prepared 1 h after irradiation). No increased NFκB binding was noted 1 h after PUVA either at anti-proliferative, yet nonlethal, PUVA conditions (500 ng 8-MOP per ml; 0.5 J UVA per cm2) or at PUVA conditions that are even cytotoxic for HaCaT (500 ng 8-MOP per ml; 1.0 J UVA per cm2) (Figure 5a). Additionally, no NFκB activation was observed 3 h and 24 h after PUVA (data not shown). In contrast, in extracts from cells treated with the pro-oxidant cytokine TNF-α (extract preparation 1 h after addition of 10 ng TNF-α per ml), a marked increase in DNA–protein complex (p65 heterodimer) formation was noted. Similar results were obtained in HL60 cells (Figure 5a): baseline DNA–NFκB complexes were not increased 1 h after treatment with PU" @default.
• W2069073973 created "2016-06-24" @default.
• W2069073973 creator A5037118260 @default.
• W2069073973 creator A5068566263 @default.
• W2069073973 creator A5084171462 @default.
• W2069073973 creator A5090423715 @default.
• W2069073973 date "1998-09-01" @default.
• W2069073973 modified "2023-10-12" @default.
• W2069073973 title "PUVA Inhibits DNA Replication, but not Gene Transcription at Nonlethal Dosages" @default.
• W2069073973 cites W130210233 @default.
• W2069073973 cites W1530203607 @default.
• W2069073973 cites W1559573167 @default.
• W2069073973 cites W1559906312 @default.
• W2069073973 cites W1577403013 @default.
• W2069073973 cites W1967470160 @default.
• W2069073973 cites W1976719569 @default.
• W2069073973 cites W1981414215 @default.
• W2069073973 cites W1982200691 @default.
• W2069073973 cites W1987243389 @default.
• W2069073973 cites W1993845216 @default.
• W2069073973 cites W2003410806 @default.
• W2069073973 cites W2008095691 @default.
• W2069073973 cites W2012338069 @default.
• W2069073973 cites W2014752700 @default.
• W2069073973 cites W2015092382 @default.
• W2069073973 cites W2019222650 @default.
• W2069073973 cites W2024495317 @default.
• W2069073973 cites W2024594863 @default.
• W2069073973 cites W2029249496 @default.
• W2069073973 cites W2038069443 @default.
• W2069073973 cites W2038634209 @default.
• W2069073973 cites W2041844070 @default.
• W2069073973 cites W2045610791 @default.
• W2069073973 cites W2046158761 @default.
• W2069073973 cites W2046953527 @default.
• W2069073973 cites W2050891413 @default.
• W2069073973 cites W2057873174 @default.
• W2069073973 cites W2060510291 @default.
• W2069073973 cites W2061899638 @default.
• W2069073973 cites W2062524418 @default.
• W2069073973 cites W2067366944 @default.
• W2069073973 cites W2074988901 @default.
• W2069073973 cites W2080876747 @default.
• W2069073973 cites W2085249569 @default.
• W2069073973 cites W2091822464 @default.
• W2069073973 cites W2115212640 @default.
• W2069073973 cites W2134443027 @default.
• W2069073973 cites W2143464311 @default.
• W2069073973 cites W2151892297 @default.
• W2069073973 cites W2154370041 @default.
• W2069073973 cites W2157348405 @default.
• W2069073973 cites W2336000290 @default.
• W2069073973 cites W274118413 @default.
• W2069073973 doi "https://doi.org/10.1046/j.1523-1747.1998.00316.x" @default.
• W2069073973 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9740231" @default.
• W2069073973 hasPublicationYear "1998" @default.
• W2069073973 type Work @default.
• W2069073973 sameAs 2069073973 @default.
• W2069073973 citedByCount "25" @default.
• W2069073973 countsByYear W20690739732012 @default.
• W2069073973 countsByYear W20690739732016 @default.
• W2069073973 countsByYear W20690739732021 @default.
• W2069073973 crossrefType "journal-article" @default.
• W2069073973 hasAuthorship W2069073973A5037118260 @default.
• W2069073973 hasAuthorship W2069073973A5068566263 @default.
• W2069073973 hasAuthorship W2069073973A5084171462 @default.
• W2069073973 hasAuthorship W2069073973A5090423715 @default.
• W2069073973 hasBestOaLocation W20690739731 @default.
• W2069073973 hasConcept C104317684 @default.
• W2069073973 hasConcept C12590798 @default.
• W2069073973 hasConcept C138885662 @default.
• W2069073973 hasConcept C159047783 @default.
• W2069073973 hasConcept C179926584 @default.
• W2069073973 hasConcept C41895202 @default.
• W2069073973 hasConcept C54355233 @default.
• W2069073973 hasConcept C552990157 @default.
• W2069073973 hasConcept C73573662 @default.
• W2069073973 hasConcept C86803240 @default.
• W2069073973 hasConceptScore W2069073973C104317684 @default.
• W2069073973 hasConceptScore W2069073973C12590798 @default.
• W2069073973 hasConceptScore W2069073973C138885662 @default.
• W2069073973 hasConceptScore W2069073973C159047783 @default.
• W2069073973 hasConceptScore W2069073973C179926584 @default.
• W2069073973 hasConceptScore W2069073973C41895202 @default.
• W2069073973 hasConceptScore W2069073973C54355233 @default.
• W2069073973 hasConceptScore W2069073973C552990157 @default.
• W2069073973 hasConceptScore W2069073973C73573662 @default.
• W2069073973 hasConceptScore W2069073973C86803240 @default.
• W2069073973 hasIssue "3" @default.
• W2069073973 hasLocation W20690739731 @default.
• W2069073973 hasLocation W20690739732 @default.
• W2069073973 hasOpenAccess W2069073973 @default.
• W2069073973 hasPrimaryLocation W20690739731 @default.
• W2069073973 hasRelatedWork W1600577375 @default.
• W2069073973 hasRelatedWork W2031325922 @default.
• W2069073973 hasRelatedWork W2249859249 @default.
• W2069073973 hasRelatedWork W2898161671 @default.
• W2069073973 hasRelatedWork W2901033488 @default.

• next