FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2069894990> ?p ?o ?g. }

• W2069894990 endingPage "4364" @default.
• W2069894990 startingPage "4357" @default.
• W2069894990 abstract "Hypermethylation of the FMR1 promoter reduces its transcriptional activity, resulting in the mental retardation and macroorchidism characteristic of Fragile X syndrome. How exactly methylation causes transcriptional silencing is not known but is relevant if current attempts to reactivate the gene are to be successful. Understanding the effect of methylation requires a better understanding of the factors responsible for FMR1 gene expression. To this end we have identified five evolutionarily conserved transcription factor binding sites in this promoter and shown that four of them are important for transcriptional activity in neuronally derived cells. We have also shown that USF1, USF2, and α−Pal/Nrf-1 are the major transcription factors that bind the promoter in brain and testis extracts and suggest that elevated levels of these factors account in part for elevated FMR1 expression in these organs. We also show that methylation abolishes α−Pal/Nrf-1 binding to the promoter and affects binding of USF1 and USF2 to a lesser degree. Methylation may therefore inhibit FMR1 transcription not only by recruiting histone deacetylases but also by blocking transcription factor binding. This suggests that for efficient reactivation of the FMR1 promoter, significant demethylation must occur and that current approaches to gene reactivation using histone deacetylase inhibitors alone may therefore have limited effect. Hypermethylation of the FMR1 promoter reduces its transcriptional activity, resulting in the mental retardation and macroorchidism characteristic of Fragile X syndrome. How exactly methylation causes transcriptional silencing is not known but is relevant if current attempts to reactivate the gene are to be successful. Understanding the effect of methylation requires a better understanding of the factors responsible for FMR1 gene expression. To this end we have identified five evolutionarily conserved transcription factor binding sites in this promoter and shown that four of them are important for transcriptional activity in neuronally derived cells. We have also shown that USF1, USF2, and α−Pal/Nrf-1 are the major transcription factors that bind the promoter in brain and testis extracts and suggest that elevated levels of these factors account in part for elevated FMR1 expression in these organs. We also show that methylation abolishes α−Pal/Nrf-1 binding to the promoter and affects binding of USF1 and USF2 to a lesser degree. Methylation may therefore inhibit FMR1 transcription not only by recruiting histone deacetylases but also by blocking transcription factor binding. This suggests that for efficient reactivation of the FMR1 promoter, significant demethylation must occur and that current approaches to gene reactivation using histone deacetylase inhibitors alone may therefore have limited effect. nuclear respiratory factor cAMP-response element-binding protein base pair(s) electrophoretic mobility shift assay Fragile X syndrome is caused by the expansion of a CGG repeat in the 5′-untranslated region of the fragile X mental retardation (FMR1) gene (1Kremer E.J. Pritchard M. Lynch M., Yu, S. Holman K. Baker E. Warren S.T. Schlessinger D. Sutherland G.R. Richards R.I. Science. 1991; 252: 1711-1714Crossref PubMed Scopus (796) Google Scholar, 2Verkerk A.J. Pieretti M. Sutcliffe J.S. Fu Y.H. Kuhl D.P. Pizzuti A. Reiner O. Richards S. Victoria M.F. Zhang F.P. Cell. 1991; 65: 905-914Abstract Full Text PDF PubMed Scopus (2946) Google Scholar). This results in hypermethylation of the promoter and transcriptional silencing (3Pieretti M. Zhang F.P. Fu Y.H. Warren S.T. Oostra B.A. Caskey C.T. Nelson D.L. Cell. 1991; 66: 817-822Abstract Full Text PDF PubMed Scopus (1241) Google Scholar). The major symptoms of fragile X syndrome, mental retardation and macroorchidism, are consistent with the observation that high levels of FMR1 expression occurs in specific cells in brain and testis (4Hinds H.L. Ashley C.T. Sutcliffe J.S. Nelson D.L. Warren S.T. Housman D.E. Schalling M. Nat. Genet. 1993; 3: 36-43Crossref PubMed Scopus (315) Google Scholar). The GC-rich human FMR1 promoter lacks a typical TATA-box and contains several potential Sp1 binding sites as well as an E-box and putative binding sites for the transcription factors α-Pal/Nrf-1,1 AP2, AGP/EBP, and Zeste (5Drouin R. Angers M. Dallaire N. Rose T.M. Khandjian W. Rousseau F. Hum. Mol. Genet. 1997; 6: 2051-2060Crossref PubMed Scopus (56) Google Scholar). Four regions of protein binding in the unmethylated promoter of the FMR1 gene have been described by in vivo dimethyl sulfate footprinting analysis in human fibroblasts, peripheral lymphocytes, and lymphoblastoid cell lines (5Drouin R. Angers M. Dallaire N. Rose T.M. Khandjian W. Rousseau F. Hum. Mol. Genet. 1997; 6: 2051-2060Crossref PubMed Scopus (56) Google Scholar,6Schwemmle S. de Graaff E. Deissler H. Glaser D. Wohrle D. Kennerknecht I. Just W. Oostra B.A. Dorfler W. Vogel W. Steinbach P. Am. J. Hum. Genet. 1997; 60: 1354-1362Abstract Full Text PDF PubMed Scopus (46) Google Scholar). These footprints correspond to the α-Pal/Nrf-1 site, 2 GC-boxes, and the E-box. However, the transcription factors that interact with these sites have not yet been identified. Moreover, whereas these footprints do reflect in vivo interactions, their relevance to the regulation of FMR1 transcription in brain and testis, the two major affected organs, is unknown. Because FMR1 knockout mice demonstrate learning deficits and macroorchidism similar to those seen in fragile X patients (7The Dutch-Belgian Fragile X Consortium Cell. 1994; 78: 23-33PubMed Google Scholar), and mice show patterns of temporal and tissue-specific FMR1 expression similar to humans (8Bachner D. Manca A. Steinbach P. Wohrle D. Just W. Vogel W. Hameister H. Poustka A. Hum. Mol. Genet. 1993; 2: 2043-2050Crossref PubMed Scopus (107) Google Scholar), many of the control elements important for FMR1 gene regulation are also likely to be evolutionarily conserved. To identify conserved promoter elements, we compared the sequence of the human FMR1 promoter with that from two other primates: Pan troglodytes (chimpanzee) and Macaca arctoides(stump-tailed macaque) as well as two more evolutionarily distant species: Mus domesticus (mouse) and Canis familiaris (dog). We also examined the activity of promoter mutations in transient expression assays using a neuronally derived cell line, PC12, and identified the major transcription factors that bind the FMR1 promoter in nuclear extracts of brain and testis. We also demonstrate that binding of one of these factors is abolished by methylation, and binding of the other two factors is also affected. This may have implications for therapeutic strategies aimed at reactivating the gene, since it indicates that methylation of the FMR1 promoter in Fragile X patients does not simply inhibit transcription via the formation of transcriptionally inactive chromatin, as suggested from in vivo dimethyl sulfate footprinting in lymphoblasts (6Schwemmle S. de Graaff E. Deissler H. Glaser D. Wohrle D. Kennerknecht I. Just W. Oostra B.A. Dorfler W. Vogel W. Steinbach P. Am. J. Hum. Genet. 1997; 60: 1354-1362Abstract Full Text PDF PubMed Scopus (46) Google Scholar) and from the presence of deacetylated histones on the FMR1 promoter in individuals with Fragile X syndrome (9Coffee B. Zhang F. Warren S.T. Reines D. Nat. Genet. 1999; 22: 98-101Crossref PubMed Scopus (268) Google Scholar). A 129/SVJ mouse (M. domesticus) BAC library was screened by polymerase chain reaction using two primers from exon 1 of the mouse FMR1 gene (Genome Systems, St. Louis. MI). The resultant clone was subcloned and mapped using standard procedures. Exon 1 of the mouse FMR1 gene was localized to a 3.1-kilobase Eco RI fragment that was subcloned into pZero (Invitrogen, Carlsbad, CA). This clone designated pEco3.3 was then sequenced using standard procedures. Sequence comparison was done using the GCG package (Wisconsin Package Version 10.0, Genetics Computer Group (GCG), Madison, WI). The mouse sequence was scanned against the GenBankTM data base. The only significant matches were to the human FMR1 5′ end (including GenBankTM/EBI locus HUMFMR1S). The sequence was submitted to GenBankTM/EBI (Accession Number:AF251347). Polymerase chain reaction amplification of FMR1 promoter from the genomic DNA of chimpanzee (P. troglodytes), macaque (M. arctoides), and dog (C. familiaris) was carried out using the ExpandTM HiFidelity polymerase chain reaction system (Roche Molecular Biochemicals) and the primers Fraxa f (5′-dAGCCCCGCACTTCCACCACCAGCTCCTCCA-3′ from exon 1 and FMRUP2 (5′-dGCNTTCCCGCCNTNCACCAAG-3′) homologous to the 5′ end of the promoter that is conserved in mice and humans. The polymerase chain reaction product was directly sequenced using the Thermosequenase radiolabeled terminator cycle sequencing kit (U. S. Biochemicals Corp.) according to the manufacturer's recommendations. The sequences obtained were aligned initially using Macvector™ version 5.0.2 (Oxford Molecular Group, Inc., Campbell, CA), followed by visual inspection. The transcription factor binding sites in the human sequence were analyzed using TESS (Transcription Element Search Software, available on the World Wide Web 2Schug, J. and Overton, G. C. (1997) Technical Report CBIL-TR-1997-1001-v0.0 , Computational Biology and Informatics Laboratory, School of Medicine, University of Pennsylvania.). The sequences were submitted to GenBankTM (accession numbersAF251349, AF251350, and AF251348 for chimpanzee, macaque, and dog, respectively). A single base insertion was introduced into the middle of the E-box site in p32.9 (10Lavedan C. Grabczyk E. Usdin K. Nussbaum R.L. Genomics. 1998; 50: 229-240Crossref PubMed Scopus (51) Google Scholar) using the QuickChange Mutagenesis™ protocol (Stratagene, La Jolla, CA) and the primer pair 5′-GAACAGCGTTGATCACTGTGACGTGGTTTCAGTGTTTAC-3′ and 5′-dGTAAACACTGAAACCACGTCACAGTGATCAACGCTGTTC-3′. The introduction of the single base change to the resultant plasmid (pUSFmut) was confirmed by sequencing. A 909-bp fragment from the original FMR1 promoter in p32.9 and a 910-bp fragment from the mutated promoter from pUSFmut containing 869 and 870 bases from the human FMR1 promoter, respectively, were cloned intoKpn I-Nhe I-digested plasmid pGL3-basic (Promega, Madison, WI), which contains the firefly (Photinus pyralis) luciferase reporter gene to make pGL-FMR and pGL-USFmut. The 909-bp wild-type FMR1 promoter was also cloned intoHin dIII-Spe I digested plasmid pRL-null (Promega), which contains the sea pansy (Renilla reniformis) luciferase-coding sequence, to make the control plasmid pRL-FMR. Deletions in the promoter were created either by Exonuclease III and S1 nuclease treatment or by digestion with a combination of restriction enzymes followed by T4 DNA polymerase. Specifically plasmids pΔ−88/+244, pΔ+55/+244, and pΔ−447/+244 were generated by digesting pGL-FMR with Bgl II and filling in the recessed 3′ ends with α−phosphothioate deoxyribonucleotides followed by digestion with Nhe I, Exonuclease III, and S1 nuclease according to standard procedures. Plasmids pΔ−131/−123 were made by digesting pGL-FMR with Bss HII followed by ligation. pΔ−131/−123/USFmut was generated from pGL-USFmut in the same way. Plasmids pΔ−149/−116 and pΔ−151/−81 were generated bySph I digestion followed by T4 DNA polymerase treatment and ligation. Plasmid pΔ−85/−9 was obtained by digestion of pGL-FMR with Pml I and treatment with Exonuclease III and S1 nuclease. A 6-base pair deletion was made in the Initiator (Inr)-like element in the FMR1 promoter using the QuickChange Mutagenesis™ protocol and the primer pair 5′-dGGCCGGGGGTTCGGCCAGGCGCTCAGCTCC-3′ and 5′-dGGAGCTGAGCGCCTGGCCGAACCCCCGGCC-3′. This resulted in plasmid pΔ+5/+10. The deletion was confirmed by sequencing. Similarly, a four-base pair change was made in the two GC-boxes by QuickChange Mutagenesis™ protocol, and the mutation was confirmed by sequencing. Specifically, Sp1 site was mutated using primers 5′-dCACTTGAAGAGAGAGGATCTGGCCGAGGGGCTGAGC-3′ and 5′-dGCTCAGCCCCTCGGCCAGATCCTCTCTCTTCAAGTG-3′ to get plasmid pS1mut, and the Sp1-like site was mutated using primers 5′-dGCTGAGCCCGCGGGGGATCTGAACAGCGTTGATCAC-3′ and 5′-dGTGATCAACGCTGTTCAGATCCCCCGCGGGCTCAGC-3′ to get plasmid pS2mut. The plasmids pS1mut and pS2mut were digested with Bss HII and ligated to get pΔ−131/−123/S1mut and pΔ−131/−123/S2mut, respectively. Specific methylation of the E-box and α−Pal/NRF-1 sites were achieved by in vivo methylation with Pml I and Bss HII, methylases, respectively. This was accomplished using pLG339 as the vector for the methylase genes. pLG339 containing the BssHIIM gene (pLG339/BssHIIM) was a gift of New England Biolabs, Beverly, MA. A similar clone was constructed for the Pml I methylase by subcloning the 3.5-kilobase Eco RI-Sal I fragment from pEco72m (a gift of MBI Fermentas Inc.) into pLG339 to generate pLG339/PmlIM. pGL-FMR was cotransformed into Escherichia coli along with either pLG339/BssHIIM or pLG339/PmlIM. Methylation in all cases was confirmed by digestion with Pml I orBss HII. Since the plasmids obtained by in vivo methylation are contaminated with the low copy number pLG339 derivative, an unmethylated control was prepared by cotransforming pGL-FMR with pLG339. Cells were grown in Dulbecco's modified Eagle's medium (Life Technologies, Inc.) supplemented with 5% fetal calf serum (Life Technologies Inc.), 10% heat-inactivated horse serum (Sigma), and 1× penicillin-streptomycin (Sigma) at 37 °C and 5% CO2 to ∼70% confluence. Culture medium was replaced 18–24 h before the transfection. Ten micrograms of test plasmid DNA together with 10 μg of the control plasmid pRL-FMR were introduced into ∼107cells by electroporation (300 V, 1180 capacitance; Cell-porater, Life Technologies). Transfected cells were plated in duplicate on 6-well plates. After 16 h, the culture medium was replaced with fresh medium. Cells were collected 42–44 h after transfection and assayed for luciferase using the Dual-Luciferase® Reporter assay system (Promega) and a MicroLumat LB 96 P luminometer (Berthold Systems, Inc. Aliquippa, PA). At least three independent transfections were performed for each plasmid. The mean of the luciferase activities was plotted after adjusting for the activity of pRL-FMR. Oligonucleotides used in the electrophoretic mobility shift assay are listed in Table I. The consensus binding sites for their cognate transcription factors are underlined. Double-stranded oligonucleotides containing the consensus binding sites for AP1, AP2, Sp1, OCT1, TFIID, and CREB were obtained from Promega. The top and bottom strands of two variants of the α-Pal/Nrf-1 site and that of consensus E-box and SREBP-1 sites were synthesized by Life Technologies. The complementary strands were annealed and used without further purification. Antibodies against USF1, USF2, Max, c-Myc, Sp1, Sp3, Sp4, and Egr-1 were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). CREB antibody was from New England BioLabs. α−Pal/Nrf-1 antibodies were a gift from Dr Brian Safer (NHLBI, NIH, Bethesda, MD).Table IOligonucleotides used for cold competition in EMSATranscription factorSequenceα-Pal/Nrf-1 a5′-d(GATAGCTGATGCGCATGCGCTGATGAT)-3′α-Pal/Nrf-1 b5′-d(GATGACTGCGCGCACGCGCGACGTAGC)-3′AP15′-d(CGCTTGATGAGTCAGCCGGAA)-3′AP25′-d(GATCGAACTGACCGCCCGCGGCCCGT)-3′CREB5′-d(AGAGATTGCCTGACGTCAGAGAGCTAG)-3′E-box5′-d(ATCTGTATCACGTGTGTAGTCGTGATG)-3′OCT15′-d(TGTCGAATGCAAATCACTAGAA)-3′Sp15′-d(ATTCGATCGGGGCGGGGCGAGC)-3′SREBP-15′-d(ATCTGGATCACCCCACATTTCGTGATG)-3′TFIID5′-d(GCAGAGCATATAAGGTGAGGTAGGA)-3′The consensus binding site is underlined. Open table in a new tab The consensus binding site is underlined. Nuclear extracts were prepared from the brain, testis, and liver of FVB/N mice (The Jackson Laboratory, Bar Harbor, ME) and from human lymphoblastoid cell lines (Coriell Cell Repositories, Camden, NJ) by a modification of the method of Dignam et al. (11Dignam J.D. Lebovitz R.M. Roeder R.G. Nucleic Acids Res. 1983; 11: 1475-1489Crossref PubMed Scopus (9164) Google Scholar). Briefly, the tissues and lymphoblastoid cells were washed with phosphate-buffered saline and resuspended in two volumes of ice-cold buffer A (10 mmHEPES, pH 7.9, 1.5 mm MgCl2, 10 mmNaCl, 0.5 mm dithiothreitol, 0.5 mmphenylmethylsulfonyl fluoride, 7 μg/ml calpain inhibitor II) containing 1 protease inhibitor mixture tablet (Complete™ mini, EDTA-free, Roche Molecular Biochemicals, Indianapolis, IN) per 10 ml of buffer A. The cells were lysed by 10 strokes of a Dounce homogenizer, and the tissues were homogenized using a VIRTIS 45 homogenizer (Virtis company Inc., Gardiner, NY). The lysed cells and tissues were then centrifuged at 3500 × g for 15 min to pellet the nuclei. The pellet was spun again at 25,000 ×g for 20 min to remove the residual cytosolic material. The nuclei were resuspended in 3 ml of buffer C/109 cells (20 mm HEPES, pH 7.9, 25% glycerol, 420 mm NaCl, 1.5 mm MgCl2, 0.2 mm EDTA, 0.5 mm phenylmethylsulfonyl fluoride, 0.5 mmdithiothreitol, 7 μg/ml calpain inhibitor II, and the same protease inhibitor mixture tablet used previously) and stirred at 4 °C for 30 min. The nuclear debris was removed by centrifugation at 25,000 ×g for 30 min. The supernatant was dialyzed against 50 volumes of buffer D (20 mm HEPES, pH 7.9, 20% glycerol, 100 mm NaCl, 0.2 mm EDTA, 0.5 mmphenylmethylsulfonyl fluoride, 0.5 mm dithiothreitol) at 4 °C overnight using a Slide-A-Lyzer® cassette (Pierce). The dialysate was centrifuged at 25,000 × g for 20 min. The supernatant was quick-frozen in a dry ice/ethanol bath and stored in aliquots at −80 °C. Protein concentrations were determined using the Bio-Rad protein assay reagent. Nuclear extracts from PC12 cell lines were purchased from Promega. A 200-bp mouse FMR1 promoter fragment was amplified with primers mba1 (5′-dCTTTAAGCTTTCCCGCCTTTCACCAAG-3′] and mba2 5′-dGCCAAAAGCTTCGCTGCGCCTCCTGTAAA-3′] from pEco3.3. The 202-bp human FMR1 promoter (−214 to −13) was amplified from plasmid p32.9 with primers hmba1 5′-dCTTTCAAGCTTCCCGCCCTCCACCAAG-3′) and hmba2 (5′-dGAACCCAAGCTTCGCTGCGGGTGTAAACA-3′). The amplified fragments were gel-purified and cloned into the Hin dIII site of pBS (SK+). For EMSA and DNase I footprinting experiments, a gel-purifiedSal I/Not I fragment containing the promoter was end-labeled at the Not I site using [α-32P]dCTP and Klenow DNA polymerase (Life Technologies). The labeled probe was extracted with phenol/chloroform and purified by passing through a Sephadex G-50 column. The promoter was methylated using Sss I methylase (New England BioLabs). Methylation was verified by digestion with the methylation-sensitive enzymes Pml I, Eag I, andHha I (New England BioLabs). Binding was carried out at 30 °C or 4 °C in 30 μl of reaction buffer containing 25 mm HEPES, pH 7.5, 5 mmMgCl2, 2 mm dithiothreitol, 100 mmNaCl, 0.25 ng of probe, 5 μg of protein, and 1 μg of poly[dA-dT][dA-dT] for 30 min. A 1000-fold excess of nonspecific DNA and transcription factor binding oligodeoxyribonucleotides were included in the reactions as nonspecific or specific competitors. For antibody supershift assays, 4 μg of antibody or BSA was incubated with the protein before the addition of the probe, and reactions were carried out for 40 min. The reactions were stopped by the addition of 30 μl of 2× gel loading buffer (200 mm Tris, pH 8.8, 10.5% glycerol, 0.002% bromphenol blue). Reactions were subjected to electrophoresis on a 4% polyacrylamide gel (60:1, acrylamide:bis) containing 1.6% glycerol in 1× Tris-glycine-EDTA buffer (50 mm Tris, 380 mmglycine, 2.1 mm EDTA, pH 8.5). Gels were dried and exposed to x-ray film. For DNase I footprinting, aPst I/EcoNI fragment of p32.9 was end-labeled atEco N I site by [α-32P]dGTP and Klenow DNA polymerase (Life Technologies). Binding reactions were carried out with 1 ng of 3′ end-labeled probe and 20 μg of protein in a 100-μl reaction volume containing poly[dA-dT][dA-dT]. The reactions were treated with 0.25 units of DNase I in the presence of 10 mmMgCl2 and 1 mm CaCl2 for 10 min at 30 °C. The reactions were phenol-extracted and ethanol-precipitated with tRNA as carrier. The sample was dissolved in 100 μl of TE (10 mm Tris-HCl, pH 8.0, 1 mm Na2EDTA) and butanol-precipitated. The pellet was washed with 70% ethanol, dried, and resuspended in 10 μl of formamide stop buffer (95% formamide, 20 mm EDTA, 0.05% bromphenol blue, 0.05% xylene cyanol FF). A 2-μl sample was electrophoresed on a 6% sequencing gel at 1600 V until the bromphenol blue dye reached the bottom of the gel. The gel was dried and exposed to x-ray film. The nuclear extracts were subjected to electrophoresis on 10% polyacrylamide gels containing SDS and electro-blotted to the NitroPure membrane (MSI, Westboro, MA) using standard procedures. Hybridization with primary antibody was carried out as specified by the supplier. Hybridization with the secondary antibody and signal detection were done using ECL Western blotting kit (Amersham Pharmacia Biotech) as per the manufacturer's recommendation. A 466-bp fragment including 272 bp of sequence upstream of the transcription start site of the human FMR1 gene has previously been shown to contain all the elements necessary for the appropriate tissue-specific expression of the FMR1 gene in transgenic mice (12Hergersberg M. Matsuo K. Gassmann M. Schaffner W. Luscher B. Rulicke T. Aguzzi A. Hum. Mol. Genet. 1995; 4: 359-366Crossref PubMed Scopus (67) Google Scholar). To define the minimal promoter region more closely and to identify those transcription factor binding sites that are evolutionarily conserved and that may therefore be important for regulation of this gene, we compared the sequences of the 5′ end of the FMR1 gene that we obtained from a number of different mammals. Fig. 1 shows a dot matrix comparison of the exon 1-containing portion of the mouse fmr1 gene with the corresponding region of the human FMR1 sequence (GenBankTM/EBI locus: HUMFMR1S). The homology between the two sequences is highest in the first exon, but islands of homology both 3′ and 5′ of exon 1 are also seen. The 5′ regions fall within the 272-bp previously defined minimal promoter fragment (12Hergersberg M. Matsuo K. Gassmann M. Schaffner W. Luscher B. Rulicke T. Aguzzi A. Hum. Mol. Genet. 1995; 4: 359-366Crossref PubMed Scopus (67) Google Scholar), the upstream border of which is marked by the black arrow in Fig. 1. No transcription factor binding sites were conserved between mouse and human 5′ of the α−Pal/Nrf-1 site, 131 bases 5′ of the start of transcription. This suggests that the minimal FMR1 promoter may only be 131 bp long. The conserved 3′ regions may represent regulatory elements in the first intron, but they have not been studied in any detail to date. We used a primer derived from the conserved 5′ boundary of the promoter and a primer from exon 1 to amplify the FMR1 5′ region from chimpanzee, Stump-tailed macaque, and dog. The sequences were then aligned with the human and mouse promoter sequences to identify those regions that are conserved in all five species (Fig. 2). The four described previously in vivo protein binding sites, α−Pal/Nrf-1, the 2 Sp1 or GC boxes, and the E-box (sometimes referred to as the c-Myc binding site) (5Drouin R. Angers M. Dallaire N. Rose T.M. Khandjian W. Rousseau F. Hum. Mol. Genet. 1997; 6: 2051-2060Crossref PubMed Scopus (56) Google Scholar, 6Schwemmle S. de Graaff E. Deissler H. Glaser D. Wohrle D. Kennerknecht I. Just W. Oostra B.A. Dorfler W. Vogel W. Steinbach P. Am. J. Hum. Genet. 1997; 60: 1354-1362Abstract Full Text PDF PubMed Scopus (46) Google Scholar) are conserved in all five species (shown in the dark gray boxes in Fig. 2). None of these sequences had a good TATA-box. However, they all contained a conserved motif close to the reported start of transcription (13Hwu W.L. Wang T.R. Lee Y.M. DNA Cell Biol. 1997; 16: 449-453Crossref PubMed Scopus (30) Google Scholar) that resembles an Initiator (Inr) element. Such elements direct transcription initiation in certain TATA-less promoters (14Breathnach R. Chambon P. Annu. Rev. Biochem. 1981; 50: 349-383Crossref PubMed Scopus (3298) Google Scholar). The region containing the dimethyl sulfate hyperreactive G residue close to the reported transcriptional start site (5Drouin R. Angers M. Dallaire N. Rose T.M. Khandjian W. Rousseau F. Hum. Mol. Genet. 1997; 6: 2051-2060Crossref PubMed Scopus (56) Google Scholar) is also well conserved (the complementary C is marked by an asterisk in Fig. 2). This region does not show a protein binding footprint in vivo, at least in cells with low FMR1 activity (5Drouin R. Angers M. Dallaire N. Rose T.M. Khandjian W. Rousseau F. Hum. Mol. Genet. 1997; 6: 2051-2060Crossref PubMed Scopus (56) Google Scholar). This hyperreactivity is absent in individuals with fragile X syndrome and is therefore thought to reflect some DNA structure that is associated with transcription (5Drouin R. Angers M. Dallaire N. Rose T.M. Khandjian W. Rousseau F. Hum. Mol. Genet. 1997; 6: 2051-2060Crossref PubMed Scopus (56) Google Scholar). The transcription factors Zeste (5Drouin R. Angers M. Dallaire N. Rose T.M. Khandjian W. Rousseau F. Hum. Mol. Genet. 1997; 6: 2051-2060Crossref PubMed Scopus (56) Google Scholar), AP2 (15Carrillo C. Cisneros B. Montanez C. Neurosci. Lett. 1999; 276: 149-152Crossref PubMed Scopus (14) Google Scholar), and CREB (13Hwu W.L. Wang T.R. Lee Y.M. DNA Cell Biol. 1997; 16: 449-453Crossref PubMed Scopus (30) Google Scholar) have all been suggested to be important for FMR1 regulation. However the binding sites for these factors were not conserved (shown in the open boxes Fig. 2). Mutated versions of the human FMR1 promoter were assayed in PC12 cells, a neuronally derived cell line. Fig. 3shows that single base insertion in the E-box (pGL-USFmut) or the deletion of 9 bases from the α−Pal/Nrf-1 site (pΔ−131/−123) each reduced the expression of the reporter gene about 5-fold. Both mutations together (pΔ−131/−123/USFmut) reduced activity almost to that of a construct containing a deletion of almost all of the FMR1 sequence (pΔ−447/+244). Therefore the upstream boundary of the minimal promoter region is probably close to the 5′ end of the α−Pal/Nrf-1 site, as suggested by the phylogenetic footprinting. A deletion that included the α−Pal/Nrf-1 site and one of the GC-boxes (pΔ−151/−81) led to an increase in activity over that seen with the nine-base deletion in the α−Pal/Nrf-1 site alone (pΔ−131/−123). Similarly, a deletion that removes both the E-box sequence and its adjacent Sp1 site (pΔ−85/−9) produced a higher activity than the mutant with the single base insertion in the E-box. The activity of this construct was in fact higher than the full-length promoter (pGL-FMR). However, when a 4-base substitution mutation was made in either of the two GC boxes, the activity was reduced to 75 and 50%, respectively (pS1mut and pS2mut). This suggests that these two regions have a positive role in the control of gene expression. The increase in activity seen for deletion constructs pΔ−151/−81 and pΔ−85/−9 that lack these sites could be due to decreased distance between the α−Pal/Nrf-1 site and the transcription initiation site or to the deletion of additional sequences that contain negative regulators of FMR1 activity. Constructs containing both the α−Pal/Nrf-1 deletion and the point mutation in the first GC box (pΔ−131/−123/S1mut) had an activity similar to the α−Pal/Nrf-1 deletion alone, suggesting that there might be some interaction between factors that bind these two sites. However, a −131/−123:S2mut double mutant showed a slightly higher activity than the −131/−123 deletion by itself. Why this should be is not clear at this time but may be related to the uncovering of secondary transcription factor binding sites that can now be used. The pΔ−85/−9 construct lacks the TATA-like sequence upstream of the transcriptional start site. Since deletion of this sequence did not negatively affect promoter activity, it is possible that the TATA-like sequence is dispensable. However, although the initiator-like element is evolutionarily conserved, its deletion had no effect on the promoter activity in PC12 cells (construct pΔ+5/+10 in Fig. 3). Since the region that includes the putative transcriptional start site is not conserved, it may be that transcription initiation in the FMR1 promoter occurs via a novel mechanism that involves as yet undefined signals. Deletion of the region that included the CGG repeats in the 1st exon (pΔ+53/+244) produced a small increase in reporter gene activity. Since this sequence is located within the transcript, it is possible that this effect is mediated either at the level of transcription, mRNA stability, or translation. A negative effect of CGG repeats on translation has been suggested based on the observation that the levels of FMRP, the protein product of the FMR1 gene, are reduced in individuals with long premutation alleles (16Feng Y. Zhang F. Lokey L.K. Chastain J.L. Lakkis L. Eberhart D. Warren S.T. Science. 1995; 268: 731-734Crossref PubMed Scopus (262) Google Scholar). However, this effect is probably only significant at high repeat numbers. A 20-kDa protein has been shown to bind to CGG repeats and inhibit FMR1 transcription (17Muller-Hartmann H. Deissler H. Naumann F. Schmitz B. Schroer J. Doerfler W. J. Biol. Chem. 2000; 275: 6447-6452Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar). Deletion of the CGG repeat tract may simply eliminate the effect of these or similar proteins. The 200-bp region of both the mouse and human FMR1 promoters, which contains all the evolutionarily conserved putative transcription factor binding sites (shown in bold in Fig. 2) was used as a probe for binding factors in nuclear extracts from mouse brain, testis, and liver" @default.
• W2069894990 created "2016-06-24" @default.
• W2069894990 creator A5043197316 @default.
• W2069894990 creator A5064526624 @default.
• W2069894990 date "2001-02-01" @default.
• W2069894990 modified "2023-10-18" @default.
• W2069894990 title "Interaction of the Transcription Factors USF1, USF2, and α-Pal/Nrf-1 with the FMR1 Promoter" @default.
• W2069894990 cites W1558348929 @default.
• W2069894990 cites W1559737337 @default.
• W2069894990 cites W1784857457 @default.
• W2069894990 cites W1803277453 @default.
• W2069894990 cites W1969600436 @default.
• W2069894990 cites W1977735857 @default.
• W2069894990 cites W1989187665 @default.
• W2069894990 cites W1993243592 @default.
• W2069894990 cites W2002780348 @default.
• W2069894990 cites W2014102314 @default.
• W2069894990 cites W2029593825 @default.
• W2069894990 cites W2033790967 @default.
• W2069894990 cites W2040118711 @default.
• W2069894990 cites W2048555922 @default.
• W2069894990 cites W2051013729 @default.
• W2069894990 cites W2062113516 @default.
• W2069894990 cites W2071471236 @default.
• W2069894990 cites W2080352350 @default.
• W2069894990 cites W2083821124 @default.
• W2069894990 cites W2085987314 @default.
• W2069894990 cites W2106169455 @default.
• W2069894990 cites W2119787118 @default.
• W2069894990 cites W2133681744 @default.
• W2069894990 cites W2149919973 @default.
• W2069894990 cites W2151282569 @default.
• W2069894990 cites W2152413858 @default.
• W2069894990 cites W2161815236 @default.
• W2069894990 doi "https://doi.org/10.1074/jbc.m009629200" @default.
• W2069894990 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11058604" @default.
• W2069894990 hasPublicationYear "2001" @default.
• W2069894990 type Work @default.
• W2069894990 sameAs 2069894990 @default.
• W2069894990 citedByCount "87" @default.
• W2069894990 countsByYear W20698949902012 @default.
• W2069894990 countsByYear W20698949902013 @default.
• W2069894990 countsByYear W20698949902014 @default.
• W2069894990 countsByYear W20698949902015 @default.
• W2069894990 countsByYear W20698949902016 @default.
• W2069894990 countsByYear W20698949902017 @default.
• W2069894990 countsByYear W20698949902018 @default.
• W2069894990 countsByYear W20698949902019 @default.
• W2069894990 countsByYear W20698949902020 @default.
• W2069894990 countsByYear W20698949902021 @default.
• W2069894990 countsByYear W20698949902023 @default.
• W2069894990 crossrefType "journal-article" @default.
• W2069894990 hasAuthorship W2069894990A5043197316 @default.
• W2069894990 hasAuthorship W2069894990A5064526624 @default.
• W2069894990 hasBestOaLocation W20698949901 @default.
• W2069894990 hasConcept C104317684 @default.
• W2069894990 hasConcept C138885662 @default.
• W2069894990 hasConcept C179926584 @default.
• W2069894990 hasConcept C185592680 @default.
• W2069894990 hasConcept C41895202 @default.
• W2069894990 hasConcept C54355233 @default.
• W2069894990 hasConcept C86339819 @default.
• W2069894990 hasConcept C86803240 @default.
• W2069894990 hasConcept C95444343 @default.
• W2069894990 hasConceptScore W2069894990C104317684 @default.
• W2069894990 hasConceptScore W2069894990C138885662 @default.
• W2069894990 hasConceptScore W2069894990C179926584 @default.
• W2069894990 hasConceptScore W2069894990C185592680 @default.
• W2069894990 hasConceptScore W2069894990C41895202 @default.
• W2069894990 hasConceptScore W2069894990C54355233 @default.
• W2069894990 hasConceptScore W2069894990C86339819 @default.
• W2069894990 hasConceptScore W2069894990C86803240 @default.
• W2069894990 hasConceptScore W2069894990C95444343 @default.
• W2069894990 hasIssue "6" @default.
• W2069894990 hasLocation W20698949901 @default.
• W2069894990 hasOpenAccess W2069894990 @default.
• W2069894990 hasPrimaryLocation W20698949901 @default.
• W2069894990 hasRelatedWork W1920751942 @default.
• W2069894990 hasRelatedWork W1991523530 @default.
• W2069894990 hasRelatedWork W2002128513 @default.
• W2069894990 hasRelatedWork W2008301391 @default.
• W2069894990 hasRelatedWork W2020824267 @default.
• W2069894990 hasRelatedWork W2031436818 @default.
• W2069894990 hasRelatedWork W2057739827 @default.
• W2069894990 hasRelatedWork W2057841153 @default.
• W2069894990 hasRelatedWork W2075354549 @default.
• W2069894990 hasRelatedWork W2092874662 @default.
• W2069894990 hasVolume "276" @default.
• W2069894990 isParatext "false" @default.
• W2069894990 isRetracted "false" @default.
• W2069894990 magId "2069894990" @default.
• W2069894990 workType "article" @default.