FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2070073216> ?p ?o ?g. }

• W2070073216 endingPage "17801" @default.
• W2070073216 startingPage "17795" @default.
• W2070073216 abstract "Biosynthesis of tumor necrosis factor-α (TNF-α) is predominantly by cells of the monocytic lineage. This study examined the role of various cis-acting regulatory elements in the lipopolysaccharide (LPS) induction of the human TNF-α promoter in cells of monocytic lineage. Functional analysis of monocytic THP-1 cells transfected with plasmids containing various lengths of TNF-α promoter localized enhancer elements in a region (−182 to −37 base pairs (bp)) that were required for optimal transcription of the TNF-α gene in response to LPS. Two regions were identified: region I (−182 to −162 bp) contained an overlapping Sp1/Egr-1 site, and region II (−119 to −88) contained CRE and NF-κB (designated κB3) sites. In unstimulated THP-1, CRE-binding protein and, to a lesser extent, c-Jun complexes were found to bind to the CRE site. LPS stimulation increased the binding of c-Jun-containing complexes. In addition, LPS stimulation induced the binding of cognate nuclear factors to the Egr-1 and κB3 sites, which were identified as Egr-1 and p50/p65, respectively. The CRE and κB3 sites in region II together conferred strong LPS responsiveness to a heterologous promoter, whereas individually they failed to provide transcriptional activation. Furthermore, increasing the spacing between the CRE and the κB3 sites completely abolished LPS induction, suggesting a cooperative interaction between c-Jun complexes and p50/p65. These studies indicate that maximal LPS induction of the TNF-α promoter is mediated by concerted participation of at least two separatecis-acting regulatory elements. Biosynthesis of tumor necrosis factor-α (TNF-α) is predominantly by cells of the monocytic lineage. This study examined the role of various cis-acting regulatory elements in the lipopolysaccharide (LPS) induction of the human TNF-α promoter in cells of monocytic lineage. Functional analysis of monocytic THP-1 cells transfected with plasmids containing various lengths of TNF-α promoter localized enhancer elements in a region (−182 to −37 base pairs (bp)) that were required for optimal transcription of the TNF-α gene in response to LPS. Two regions were identified: region I (−182 to −162 bp) contained an overlapping Sp1/Egr-1 site, and region II (−119 to −88) contained CRE and NF-κB (designated κB3) sites. In unstimulated THP-1, CRE-binding protein and, to a lesser extent, c-Jun complexes were found to bind to the CRE site. LPS stimulation increased the binding of c-Jun-containing complexes. In addition, LPS stimulation induced the binding of cognate nuclear factors to the Egr-1 and κB3 sites, which were identified as Egr-1 and p50/p65, respectively. The CRE and κB3 sites in region II together conferred strong LPS responsiveness to a heterologous promoter, whereas individually they failed to provide transcriptional activation. Furthermore, increasing the spacing between the CRE and the κB3 sites completely abolished LPS induction, suggesting a cooperative interaction between c-Jun complexes and p50/p65. These studies indicate that maximal LPS induction of the TNF-α promoter is mediated by concerted participation of at least two separatecis-acting regulatory elements. Tumor necrosis factor (TNF-α), 1The abbreviations used are: TNF-α, tumor necrosis factor-α LPS, lipopolysaccharide; bp, base pair(s); PMA, phorbol 12-myristate 13-acetate; EMSA, electrophoretic mobility shift assay; CRE, cAMP-responsive element; CREB, CRE-binding protein. produced primarily by cells of monocytic lineage, is involved in a plethora of cell regulatory and differentiative processes. TNF-α is also a vital mediator of the host defense against infection and tumor formation. On the other hand, TNF-α is involved in the pathophysiology of numerous diseases including septic shock, cachexia, and various autoimmune diseases (1Tracey K.J. Cerami A. Annu. Rev. Med. 1994; 45: 491-503Crossref PubMed Scopus (953) Google Scholar). Therefore, TNF-α exhibits both beneficial and pathologic effects, a feature that requires rigorous control of its expression. Regulation of human TNF-α expression in cells of monocytic lineage is quite complex, involving controls at both transcriptional and post-transcriptional levels (2Han J. Brown T. Beutler B. J. Exp. Med. 1990; 171: 465-475Crossref PubMed Scopus (431) Google Scholar). In addition, both 5′ and 3′ nucleotide sequences influence LPS-induced transcription of human TNF-α cDNA transfected into the murine macrophage RAW264.7 cell line (3Han J. Huez G. Beutler B. J. Immunol. 1991; 146: 1843-1848PubMed Google Scholar). The promoter region of the human TNF-α gene contains a complex array of potential regulatory elements. In T cells, cooperation between the CRE and the adjacent κB3 sites is required for calcium-mediated TNF-α promoter activity (4Tsai E.Y. Jain J. Pesavento P.A. Rao A. Goldfeld A . E. Mol. Cell. Biol. 1996; 16: 459-467Crossref PubMed Scopus (228) Google Scholar), and cooperation between the CRE and the adjacent Ets sites for PMA-induced activity (5Kramer B. Weigmann K. Kronke M. J. Biol. Chem. 1995; 270: 6577-6583Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar). However, the role or these regulatory elements in transcriptional activation of the TNF-α gene in human monocytes remains unclear. To date, published reports indicate that activation of TNF-α gene transcription in human monocytes in response to various stimuli is mediated by a region within −200 bp upstream of the transcriptional start site (6Rhoades K.L. Golub S.H. Economou J.S. J. Biol. Chem. 1992; 267: 22102-22107Abstract Full Text PDF PubMed Google Scholar, 7Kramer B. Meichle A. Hensel G. Charnay P. Kronke M. Biochim. Biophys. Acta. 1994; 1219: 413-421Crossref PubMed Scopus (118) Google Scholar, 8Leitman D.C. Ribeiro R.C.J. Mackow E.R. Baxter J.D. West B.L. J. Biol. Chem. 1991; 266: 9343-9346Abstract Full Text PDF PubMed Google Scholar, 9Pope R.M. Leutz A. Ness S.A. J. Clin. Invest. 1994; 94: 1449-1455Crossref PubMed Scopus (166) Google Scholar, 10Rhoades K.L. Cai S. Golub S.H. Economou J.S. Cell. Immunol. 1995; 161: 125-131Crossref PubMed Scopus (28) Google Scholar, 11Trede N.S. Tsytsykova A.V. Chatila T. Goldfeld A.E. Geha R.S. J. Immunol. 1995; 155: 902-908PubMed Google Scholar, 12Leitman D.C. Mackow E.R. Williams T. Baxter J.D. West B.L. Mol. Cell. Biol. 1992; 12: 1352-1356Crossref PubMed Google Scholar). Using a promonocytic leukemia cell line, U937, several nuclear factor binding elements, including AP-1 (6Rhoades K.L. Golub S.H. Economou J.S. J. Biol. Chem. 1992; 267: 22102-22107Abstract Full Text PDF PubMed Google Scholar), Egr-1 (7Kramer B. Meichle A. Hensel G. Charnay P. Kronke M. Biochim. Biophys. Acta. 1994; 1219: 413-421Crossref PubMed Scopus (118) Google Scholar), CRE (8Leitman D.C. Ribeiro R.C.J. Mackow E.R. Baxter J.D. West B.L. J. Biol. Chem. 1991; 266: 9343-9346Abstract Full Text PDF PubMed Google Scholar), C/EBPβ (9Pope R.M. Leutz A. Ness S.A. J. Clin. Invest. 1994; 94: 1449-1455Crossref PubMed Scopus (166) Google Scholar), and AP-2 (10Rhoades K.L. Cai S. Golub S.H. Economou J.S. Cell. Immunol. 1995; 161: 125-131Crossref PubMed Scopus (28) Google Scholar), have been suggested to mediate TNF-α transcription in response to PMA or cytokines. These results appear to be incomplete and often conflicting. No consensus has been reached, and no cooperation between these regulatory elements was established. Although the reasons for these discrepancies are unclear, the U937 cell line may be too poorly differentiated to serve as a suitable model of gene expression in cells of monocytic lineage. Transcriptional activation of the murine TNF-α gene in murine macrophages has been demonstrated to be predominantly dependent on a region in the murine TNF-α promoter upstream of −451 bp, which contains NF-κB DNA binding motifs (13Shakhov A.N. Collat M.A. Vassalli P. Nedospasov S.A. Jongeneel V. J. Exp. Med. 1990; 171: 35-47Crossref PubMed Scopus (735) Google Scholar, 14Collart M.A. Baeuerle P. Vassalli P. Mol. Cell. Biol. 1990; 10: 1498-1506Crossref PubMed Google Scholar). A major histocompatibility complex class II Y box was also inferred to play a role in LPS inducibility (13Shakhov A.N. Collat M.A. Vassalli P. Nedospasov S.A. Jongeneel V. J. Exp. Med. 1990; 171: 35-47Crossref PubMed Scopus (735) Google Scholar, 14Collart M.A. Baeuerle P. Vassalli P. Mol. Cell. Biol. 1990; 10: 1498-1506Crossref PubMed Google Scholar). To date, the role of NF-κB in the transcriptional activation of the human TNF-α gene in human monocytes in response to LPS is controversial. An early study using murine monocytic cells failed to identify a role for the κB sites in transcriptional activation of human TNF-α in response to LPS or virus (15Goldfeld A.E. Doyle C. Maniatis T. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 9769-9773Crossref PubMed Scopus (214) Google Scholar). However, recent reports employing pharmacological agents that block the nuclear translocation of NF-κB, such as pyrrolidine dithiocarbamate (16Ziegler-Heitbrock L.H.W. Sternsdorf T. Liese J. Belohradsky B. Weber C. Wedel A. Schreck R. Bauerle P. Strobel M. J. Immunol. 1993; 151: 6986-6993PubMed Google Scholar), and sodium salicylate (17Oeth P. Mackman N. Blood. 1995; 86: 4144-4152Crossref PubMed Google Scholar), demonstrated a suppression of TNF-α gene expression. Moreover, LPS induction of the human TNF-α promoter in human monocytic THP-1 leukemia cells was mediated by the κB3 site at −97 bp (11Trede N.S. Tsytsykova A.V. Chatila T. Goldfeld A.E. Geha R.S. J. Immunol. 1995; 155: 902-908PubMed Google Scholar). Taken together, these results suggest a likelihood that murine monocytic cells are not suitable for the analysis of the regulation of the human TNF-α promoter. In this study, we have employed a line of THP-1 cells that exhibits high inducibility for TNF-α gene transcription similar to that of freshly isolated human monocytes. We have performed a comprehensive analysis of the role of various cis-acting regulatory elements in the transcriptional regulation of the human TNF-α gene. Using LPS stimulation as a paradigm, we find that a mechanism involving several transcription factors is required for maximal TNF-α promoter activity in human monocytes. THP-1 monocytic cells were maintained in medium RPMI 1640 with 8% fetal calf serum. Human peripheral blood monocytes were isolated by gradient centrifugation as described (18Fan S.-T. Mackman N. Cui M.-J. Edgington T.S. J. Immunol. 1995; 154: 3266-3274PubMed Google Scholar). Antibodies used in electrophoretic mobility shift assay (EMSA): anti-Egr-1, anti-CREB, anti-ATF-2, anti-c-Jun, anti-JunB, anti-JunD, anti-c-Fos, anti-Fos B, anti-p50, anti-p65, anti-c-Rel, and anti-Ets1/2 were form Santa Cruz Biotechnology (Santa Cruz, CA). pTNF(−1311)Luc, pTNF(−1185)Luc, pTNF(−615)Luc, pTNF(−479)Luc, pTNF(−295)Luc, pTNF(−120)Luc, pTNF(−95) Luc, and pTNF(−36)Luc (19Economou J.S. Rhoades K. Essner R. McBride W.H. Gasson J.C. Morton D.L. J. Exp. Med. 1989; 170: 321-326Crossref PubMed Scopus (100) Google Scholar) were generously provided by Dr. J. Economou (UCLA, Los Angeles, CA). pTNF(−182)Luc and pTNF(−161)Luc were produced by cloning polymerase chain reaction fragments containing sequences of −182 to +15 or −161 to +15, respectively, into the SmaI site of the pXP1 expression vector. Plasmids containing site-specific mutations at AP-1, AP-2, or CRE sites (6Rhoades K.L. Golub S.H. Economou J.S. J. Biol. Chem. 1992; 267: 22102-22107Abstract Full Text PDF PubMed Google Scholar) were provided by Dr. J. Economou. Additional mutant plasmids in this series were produced according to methods described in the Transformer site-directed mutagenesis kit (CLONTECH, Palo Alto, CA). The sequences of the oligonucleotides with site-specific mutations used for these constructs are listed in Table I.Table IOligonucleotides used in this studyNamePositionSequence (5′–3′)Egr-1−168 to −145CCCCGCCCCCGCGATGGAGAAGAAEgr-1m−168 to −145CCCCGCCCCAGATATCGAGAAGAACRE−112 to −92TCCAGATGAGCTCATGGGTTCCREm1−112 to −92TCCAGATGAGTGTATGGGTTCCREm2−112 to −92TCCAGATCTCATCATGGGTTCκB1−594 to −577AAGCCTGGGACAGCCCCGκB2−217 to −200TGTGAGGGGTATCCTTGAκB3−103 to −86GCTCATGGGTTTCTCCACκB3m1−103 to −86GCTCATTTATTTCTCCACκB3m2−105 to −82CAGCTCATGGATATCTCCACCAAG−182/−157−182 to −157CTTCCAAATCCCCGCCCCCGCGATG−182/−157ml−182 to −157CTTTCCAAATATTCGCCCCCGCGATG−110/−86−110 to −86CAGATGAGCTCATGGGTTTCTCCAC−110/−86ml−110 to −86CAGATCTCATCATGGGTTTCTCCAC−110/−86m2−110 to −86CAGATGAGCTCATGAATTTCTAAAC−110/−86+5−110 to −86CAGATGAGCTCATATCGTGGGTTTCTCCAC−110/−86+10−110 to −86CAGATGAGCTCATATCGTATCGTGGGTTTCTCCAC−110/−86+15−110 to −86CAGATGAGCTCATATCGTATCGTATCGTGGGTTTCTCCACRespective binding sequences are in bold type. Base substitutions or insertions are underlined. Open table in a new tab Respective binding sequences are in bold type. Base substitutions or insertions are underlined. Multiple copies of oligonucleotides containing sequences from the human TNF-α promoter were cloned upstream of the minimal SV40 promoter driving expression of the luciferase reporter gene in pGL2-promoter (Promega Corp.). Sequences of oligonucleotides used for producing these constructs are listed in Table I. All plasmids were verified by DNA sequencing. A DEAE-dextran transfection procedure (18Fan S.-T. Mackman N. Cui M.-J. Edgington T.S. J. Immunol. 1995; 154: 3266-3274PubMed Google Scholar, 20Mackman N. Brand K. Edgington T.S. J. Exp. Med. 1991; 174: 1517-1526Crossref PubMed Scopus (331) Google Scholar) was used. Briefly, 3 × 107 THP-1 cells were resuspended in 1 ml of Tris-buffered saline and incubated for 10 to 20 min at 37 °C with 5 μg of plasmid DNA and 80 μg of DEAE-dextran (Pharmacia, Uppsala, Sweden). During incubation, cells were monitored closely for permeability to trypan blue. Transfection was stopped by adding large volumes of Tris-buffered saline, usually after 10 min, when 20–30% of cells are permeable to trypan blue. After washing with Tris-buffered saline, cells were cultivated in media for 48 h. Cells were stimulated with 5 μg/ml LPS (Escherichia coli O111:B4 purchased from Calbiochem, La Jolla, CA) in a 96-well plate at 1 × 106 cells/well. After 7 h of incubation at 37 °C, cells were harvested and luciferase activity was determined using an assay kit (Promega) and the Monolight 2010 luminometer (Analytical Luminescence Laboratory, San Diego, CA). Nuclear extracts were prepared from 5 × 106THP-1 cells or peripheral blood monocytes stimulated under various conditions as described (18Fan S.-T. Mackman N. Cui M.-J. Edgington T.S. J. Immunol. 1995; 154: 3266-3274PubMed Google Scholar, 20Mackman N. Brand K. Edgington T.S. J. Exp. Med. 1991; 174: 1517-1526Crossref PubMed Scopus (331) Google Scholar). Protein concentrations in nuclear extracts were determined by BCA protein assay (Pierce). Oligonucleotide probes were radiolabeled using [α-32P]dCTP (Amersham). Nuclear extracts (1–5 μg) were incubated with radiolabeled oligonucleotide probes (0.2–1 × 106 cpm) in 2 × binding buffer (100 mm KCl, 1 mm EDTA, 10% glycerol, 2 mm dithiothreitol, 2 mg/ml bovine serum albumin, 0.2% Nonidet P-40, and 40 mm Hepes) for 20 min at room temperature. Samples were subjected to electrophoresis through 6% non-denaturing acrylamide gels (Novex, San Diego, CA) in 0.5 × Tris borate-EDTA buffer. For antibody supershift experiments, nuclear extracts were preincubated 20 min with 2 μg of antibody before the addition of the labeled probe. To define the 5′ boundary of LPS responsive elements, THP-1 cells were transiently transfected with a series of plasmids containing progressive truncations of the 5′ promoter sequence between −1311 bp and −36 bp. Deletion of sequences upstream of −182 had no significant effect on LPS-induction of the TNF-α promoter activity (Fig. 1). Removal of a region from −182 to −162, which contains an Sp1/Egr-1 overlapping site, reduced LPS inducibility by 50% (from 13.3-fold to 7.8-fold). Removal of a region between −161 and −121 had no significant effect on the LPS inducibility. In contrast, deletion to −95, which removes Ets, CRE, and κB (κB3) sites, further reduced LPS inducibility (Fig. 1). Finally, deletion to −36 removed a region containing a Sp1 site and abolished basal promoter activity. These results provide new and substantial evidence that LPS induction of the TNF-α gene in monocytes involves at least two regulatory elements; region I (−182 to −162) and region II (−120 to −96). To determine the functional role of nuclear binding motifs in the region identified by 5′-truncation analysis, plasmids with specific site-directed mutations were examined. Mutation in the Egr-1 site (−169 bp), the CRE site (−106 bp), as well as the κB3 site (−97 bp), markedly reduced LPS induction. In contrast, mutation of the AP-1 (−57 bp) or AP-2 (−36 bp) had no effect on LPS induction of the TNF-α promoter (Fig. 2). These results are consistent with our findings using the 5′-deletion series of plasmids shown in Fig. 1. To further explore the potential of these nuclear factor binding motifs to function as enhancer elements, we examined their ability to confer inducibility to heterologous promoter. Neither four tandem copies of the κB3 nor two copies of the CRE sites alone conferred LPS inducibility to a SV40 minimal promoter (Fig.3 A). However, when two or three copies of a DNA fragment spanning both the CRE and the κB sites were cloned upstream of the SV40 promoter strong LPS inducibility was observed (Fig. 3, A and B). Mutation of either the CRE site (−110/−86 m1) or the κB3 site (−110/−86 m2) completely abolished LPS inducibility (Fig. 3 B). These results suggest that the LPS induction of human TNF-α transcription requires cooperative interaction between proteins bound to the CRE and κB sites. There is only 1 base pair separating the CRE and κB3 sites. Whether the close proximity of the CRE site and the κB3 site is required for the optimal transactivation of TNF-α was investigated. For these experiments, 5, 10, or 15 additional base pairs were added between CRE and κB3 sites and oligonucleotides were cloned into pGL2-promoter. These insertions created 1/2, 1, or 1 1/2 extra turns of the DNA helix between these two sites. Fig. 3 C shows that insertion of DNA between these two sites abolished LPS inducibility. EMSA were performed to determine which transcription factors bind to sites in regions I and II of the human TNF-α promoter. An oligonucleotide containing only the Egr-1 site bound an LPS and phorbol ester-inducible complex (Fig.4 A). This complex was not observed when an oligonucleotide containing a mutant Egr-1 site was used as the probe (Fig. 4 A, lanes 4–6). In addition, this LPS-inducible complex was supershifted by anti-Egr-1 antibody (Fig.4 A, lane 9), demonstrating that Egr-1 bound to this site. A prominent complex was observed when nuclear extracts from unstimulated cells were incubated with an oligonucleotide spanning the overlapping Sp1/Egr-1 sites (−182 to −157 bp) (Fig. 4 B,lane 1). This complex was not induced by LPS (lane 2) but was supershifted using an anti-Sp1 antibody (lane 3). In addition, this complex was not observed using an oligonucleotide containing a mutated Sp1 site (Fig. 4 B,lanes 5–8). Taken together, these results demonstrated that Sp1 bound to this site. In addition to the constitutively expressed Sp1 complex, LPS stimulation of cells resulted in the formation of an Egr-1 complex that bound to the oligonucleotide containing overlapping Sp1/Egr-1 sites (Fig. 4 B, lane 2). Similarly, this LPS inducible Egr-1 complex was observed using the Sp1mut/Egr-1 oligonucleotide as a probe (Fig.4 B, lane 6). The Egr-1 complex was not affected by the addition of an anti-Sp1 antibody (Fig. 4 B,lanes 3 and 7), but was supershifted with an anti-Egr-1 antibody (Fig. 4 B, lanes 4 and8). EMSA were performed with oligonucleotides spanning three putative κB sites: κB1 (−594 to −577), κB2 (−216 to −199), and κB3 (−104 to −87) (TableI). As depicted in Fig. 5 A, LPS stimulation of cells resulted in the formation of nuclear protein-DNA complexes with κB1 (lane 2) and κB3 (lane 6), but not with κB2 (lane 4). More protein bound to κB1 that κB3. Similar results were found using nuclear extracts from human peripheral blood monocytes (Fig.5 B). Monospecific anti-p50 and anti-p65 antibodies were used in supershift experiments to identify the protein composition of the complexes formed with the κB1 and κB3 sites. As shown in Fig.5 C, the LPS induced complex binding either to the κB1 or to the κB3 oligonucleotides were supershifted by anti-p50 and also by anti-p65 antibodies (Fig. 5 C), indicating that they were composed of p50/p65 heterodimers. Furthermore, mutation of the κB3 site (κB3 m2, Table I) abolished binding of p50/p65 (data not shown). Importantly, the same mutation significantly reduced LPS inducibility of the TNF-α promoter (Fig. 2). Using a prototypic CRE site as a probe, we demonstrated that CREB was constitutively expressed in unstimulated THP-1 cells and that CREB binding was not induced by LPS (Fig. 6 A). In contrast, LPS stimulation increased the amount of protein binding to the non-consensus CRE site from the TNF-α promoter (Fig.6 B, compare lanes 1 and 4). Antibody supershift experiments were performed to determine the proteins that bound to the CRE site (Fig. 6 B). In unstimulated cells, the majority of the complex was supershifted using an anti-CREB antibody, whereas only a minor supershift was observed using an anti-c-Jun antibody. In LPS-stimulated cells, the anti-c-Jun antibody supershift the majority of the complex, whereas the anti-CREB antibody formed a minor supershift band. These results suggest that LPS does not increase the binding of CREB, consistent with our results using a prototype CRE site (Fig. 6 A), and that LPS increases binding of c-Jun-containing complexes to the CRE site from the TNF-α promoter. Using an oligonucleotide containing a mutated CRE site (CREm2, TableI), we observed a reduction in the total amount of protein binding (Fig. 6 C, lane 2). In addition, LPS stimulation did not increase complex formation (lane 3). This complex was supershifted by an anti-CREB antibody (lane 4) but was not recognized by an anti-c-Jun antibody (lane 5), suggesting that small amounts of CREB still bound to the mutated CRE site. Since these same base substitutions completely abolished the functional activity of the CRE site in transfected cells (Fig.3 B), these results provide additional evidence that c-Jun-containing complexes, rather than CREB, play a crucial role in LPS induction of the TNF-α promoter. In this report, we have defined two cis-acting regulatory elements in the human TNF-α promoter that mediated maximal LPS induction of TNF-α gene expression in cells of monocytic lineage. Region I contained an overlapping Sp1/Egr-1 site (−182 to −162), whereas region II (−120 to −96) contained CRE and κB sites. Functional studies demonstrated that Egr-1 binding to region I was required for LPS induction of the TNF-α promoter in monocytes. Egr-1 protein expression was induced by LPS stimulation (21Coleman D.L. Bartiss A.H. Sukhatme V.P. Liu J. Rupprecht H.D. J. Immunol. 1992; 149: 3045-3051PubMed Google Scholar). The Egr-1 site at −169 bp is part of the Sp1/Egr-1 overlapping sequence motif. In unstimulated monocytes, Sp1 binds to this site, whereas upon LPS stimulation it is likely that Egr-1 displaces Sp1 to mediate induction of TNF-α promoter activity. Previously, we have shown that Egr-1 can displace Sp1 from a similar overlapping Sp1/Egr-1 site (22Cui M.-Z. Parry G.C.N. Oeth P. Larson H. Smith M. Huang R.-P. Adamson E.D. Mackman N. J. Biol. Chem. 1996; 271: 2731-2739Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar). The role of Sp1 bound to this upstream Sp1 site at −172 is unknown, although our results using a plasmid containing a mutation in the Sp1 site suggest that it does not mediate basal expression. In contrast, mutation of the Sp1 site at −56 bp dramatically reduces basal expression by 65%. 2J. Yao and S.-T. Fan, submitted for publication. Further functional studies showed that the CRE and κB3 sites in region II were required for LPS induction of the TNF-α promoter. We demonstrated that κB3 (−97) bound p50/p65 heterodimers. In contrast, we found no role for κB1 (−588) despite its ability to bind p50/p65. A recent study by Trede et al. (11Trede N.S. Tsytsykova A.V. Chatila T. Goldfeld A.E. Geha R.S. J. Immunol. 1995; 155: 902-908PubMed Google Scholar) also showed a role for κB3 in LPS induction of the TNF-α promoter in THP-1 cells. However, these investigators did not identify other regulatory regions, possibly due to the low level of induction (about 4-fold) of the TNF-α promoter (11Trede N.S. Tsytsykova A.V. Chatila T. Goldfeld A.E. Geha R.S. J. Immunol. 1995; 155: 902-908PubMed Google Scholar). In addition, our studies are in agreement with an earlier report (16Ziegler-Heitbrock L.H.W. Sternsdorf T. Liese J. Belohradsky B. Weber C. Wedel A. Schreck R. Bauerle P. Strobel M. J. Immunol. 1993; 151: 6986-6993PubMed Google Scholar), showing that p50/p65 binds with much less avidity to κB3 than κB1 (Fig. 5). Therefore, it is possible that protein-protein interaction of p50/p65 with c-Jun proteins bound to the adjacent CRE site is required to stabilize the formation of a transcriptional complex that mediates induction of the TNF-α promoter. In monocytic cells, the CRE site in the TNF-α promoter constitutively bound CREB (Fig. 6). Upon LPS stimulation, the amount of CREB binding remains unchanged, but there was a marked increase in c-Jun binding. LPS induces c-jun expression (23Dokter W.H.A. Esselink M.T. Halie M.R. Vellenga E. Blood. 1993; 81: 337-343Crossref PubMed Google Scholar), suggesting that the increases in c-Jun-containing complexes observed in this study were due to de novo protein synthesis. Furthermore, the transactivating activity of these c-Jun complexes may be increased due to post-translational phosphorylation (24Karin M. J. Biol. Chem. 1995; 270: 16483-16486Abstract Full Text Full Text PDF PubMed Scopus (2258) Google Scholar). As reported recently, LPS stimulation of THP-1 cells resulted in rapid activation of JNK (25Hambleton J. Weinstein S.L. Lem L. DeFranco A.L. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 2774-2778Crossref PubMed Scopus (415) Google Scholar). The phosphorylation of c-Jun by JNK significantly enhances the transactivation potential of these factors (26Smeal T. Binetruy B. Mercola D. Grover-Bardwick E. Heidecker G. Rapp U.R. Karin M. Mol. Cell. Biol. 1992; 12: 3507-3513Crossref PubMed Scopus (305) Google Scholar). The non-consensus CRE sequence of TNF-α promoter TGAGCTCA was shown to have a lower binding affinity for c-Jun/ATF-2 complex than a consensus CRE sequence (27Newell C.L. Deisseroth A.B. Lopez-Berestein G. J. Leukocyte Biol. 1994; 56: 27-35Crossref PubMed Scopus (117) Google Scholar). These variations of sequences and the resulting variation in binding of these bZIP proteins could play a role in the modulation of TNF-α expression in response to various signals. Importantly, base substitution in the CRE site that reduced CREB binding but abolished c-Jun binding abrogated the functional activity of this site, suggesting that c-Jun-containing complexes bound to region II are required for LPS induction of the TNF-α promoter. The molecular mechanisms by which binding of the nuclear proteins at this CRE site regulate the activation of TNF-α gene expression await further elucidation. Parallel to our findings for monocytic cells, it was demonstrated recently that both the κB3 site and the adjacent upstream CRE site are required for the calcium-stimulated TNF-α transcription in human T cells (4Tsai E.Y. Jain J. Pesavento P.A. Rao A. Goldfeld A . E. Mol. Cell. Biol. 1996; 16: 459-467Crossref PubMed Scopus (228) Google Scholar). However, in contrast to our data for monocytes, these investigators reported that the κB3 site bound NFATp and not p50/p65 (28McCaffrey P.G. Goldfeld A.E. Rao A J. Biol. Chem. 1994; 269: 30445-30450Abstract Full Text PDF PubMed Google Scholar). Moreover, contrary to our findings in monocytes, no constitutive or induced CREB protein binding to the CRE site was observed in T cells (4Tsai E.Y. Jain J. Pesavento P.A. Rao A. Goldfeld A . E. Mol. Cell. Biol. 1996; 16: 459-467Crossref PubMed Scopus (228) Google Scholar). Instead, the CRE-binding complex was shown to consist almost exclusively of c-Jun/ATF-2 heterodimers. Furthermore, both the CRE site and adjacent upstream Ets site were essential for both basal promoter activity in T cells and responsiveness to PMA (5Kramer B. Weigmann K. Kronke M. J. Biol. Chem. 1995; 270: 6577-6583Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar). It appears that the Ets site did not play a significant role in basal TNF-α promoter activity in monocytes, since it was not affected by mutation of the Ets site.2 Together, these results demonstrate the marked difference in the regulation of the TNF-α promoter in human T cells and monocytes. In this study, we showed that LPS induction of a heterologous promoter by region II required both the CRE and κB3 sites, suggesting a functional cooperation between the transcription factors bound to these sites. Similar cooperation has also been demonstrated in the induction of another cytokine gene, IFN-β (29Du W. Thanos D. Maniatis T. Cell. 1993; 74: 887-898Abstract Full Text PDF PubMed Scopus (395) Google Scholar), as well as in the expression of E-selectin (30Whitley M.J. Thanos D. Read M.A. Maniatis T. Collins T. Mol. Cell. Biol. 1994; 14: 6464-6475Crossref PubMed Scopus (177) Google Scholar). In both cases, ATF-2/Jun proteins were shown to interact with p50/p65 proteins. In addition, p50/p65 has been shown to physically interact with ATF-2 (29Du W. Thanos D. Maniatis T. Cell. 1993; 74: 887-898Abstract Full Text PDF PubMed Scopus (395) Google Scholar), and c-Jun (31Kaszubska W. Hoof van Huijsduijnen R. Ghersa P. DeRaemy-Schenk A.M. Chen B.P.C. Hei T. DeLamarter J.F. Whelan J. Mol. Cell. Biol. 1993; 13: 7180-7190Crossref PubMed Google Scholar). These direct associations are considered an important mechanism by which transcriptional factors cooperate to induce gene expression. The novel findings presented here support the notion that concerted participation of proteins bound to the Egr-1, CRE, and κB3 sites mediates the induction of the TNF-α promoter in human monocytic THP-1 cells in response to LPS. Future studies will determine if similar regulatory pathways control TNF-α gene expression in monocytes and macrophages. Further elucidation of the cooperative interactions of transcription factors bound to these cis-acting regulatory elements are essential to our understanding of the transcriptional regulation of the TNF-α gene in human monocytes. Understanding of the molecular mechanisms by which these nuclear factors regulate TNF-α gene expression should lead to design of specific inhibitors that will counteract the pathological effects of TNF-α in various diseases. We thank Dr. James S. Economou for the generous gift of plasmids, and Dr. Craig Dickinson and Paul Oeth for advice." @default.
• W2070073216 created "2016-06-24" @default.
• W2070073216 creator A5002810096 @default.
• W2070073216 creator A5023617884 @default.
• W2070073216 creator A5044488383 @default.
• W2070073216 creator A5075629445 @default.
• W2070073216 date "1997-07-01" @default.
• W2070073216 modified "2023-09-30" @default.
• W2070073216 title "Lipopolysaccharide Induction of the Tumor Necrosis Factor-α Promoter in Human Monocytic Cells" @default.
• W2070073216 cites W1496485913 @default.
• W2070073216 cites W1517209893 @default.
• W2070073216 cites W1569365736 @default.
• W2070073216 cites W1584114579 @default.
• W2070073216 cites W1584234581 @default.
• W2070073216 cites W1591157507 @default.
• W2070073216 cites W1608093623 @default.
• W2070073216 cites W1756494038 @default.
• W2070073216 cites W1893715971 @default.
• W2070073216 cites W1964304127 @default.
• W2070073216 cites W1964689096 @default.
• W2070073216 cites W1969108518 @default.
• W2070073216 cites W2002427738 @default.
• W2070073216 cites W2004681520 @default.
• W2070073216 cites W2016686699 @default.
• W2070073216 cites W2039081691 @default.
• W2070073216 cites W2039167252 @default.
• W2070073216 cites W2075165827 @default.
• W2070073216 cites W2082166614 @default.
• W2070073216 cites W2096678608 @default.
• W2070073216 cites W2105415988 @default.
• W2070073216 cites W2118477707 @default.
• W2070073216 cites W2118897660 @default.
• W2070073216 cites W2146963242 @default.
• W2070073216 cites W2156275638 @default.
• W2070073216 cites W2407740578 @default.
• W2070073216 doi "https://doi.org/10.1074/jbc.272.28.17795" @default.
• W2070073216 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9211933" @default.
• W2070073216 hasPublicationYear "1997" @default.
• W2070073216 type Work @default.
• W2070073216 sameAs 2070073216 @default.
• W2070073216 citedByCount "446" @default.
• W2070073216 countsByYear W20700732162012 @default.
• W2070073216 countsByYear W20700732162013 @default.
• W2070073216 countsByYear W20700732162014 @default.
• W2070073216 countsByYear W20700732162015 @default.
• W2070073216 countsByYear W20700732162016 @default.
• W2070073216 countsByYear W20700732162017 @default.
• W2070073216 countsByYear W20700732162018 @default.
• W2070073216 countsByYear W20700732162019 @default.
• W2070073216 countsByYear W20700732162020 @default.
• W2070073216 countsByYear W20700732162021 @default.
• W2070073216 countsByYear W20700732162022 @default.
• W2070073216 countsByYear W20700732162023 @default.
• W2070073216 crossrefType "journal-article" @default.
• W2070073216 hasAuthorship W2070073216A5002810096 @default.
• W2070073216 hasAuthorship W2070073216A5023617884 @default.
• W2070073216 hasAuthorship W2070073216A5044488383 @default.
• W2070073216 hasAuthorship W2070073216A5075629445 @default.
• W2070073216 hasBestOaLocation W20700732161 @default.
• W2070073216 hasConcept C126322002 @default.
• W2070073216 hasConcept C17991360 @default.
• W2070073216 hasConcept C185592680 @default.
• W2070073216 hasConcept C203014093 @default.
• W2070073216 hasConcept C2778754761 @default.
• W2070073216 hasConcept C3020084786 @default.
• W2070073216 hasConcept C502942594 @default.
• W2070073216 hasConcept C503630168 @default.
• W2070073216 hasConcept C71924100 @default.
• W2070073216 hasConcept C86803240 @default.
• W2070073216 hasConcept C95444343 @default.
• W2070073216 hasConceptScore W2070073216C126322002 @default.
• W2070073216 hasConceptScore W2070073216C17991360 @default.
• W2070073216 hasConceptScore W2070073216C185592680 @default.
• W2070073216 hasConceptScore W2070073216C203014093 @default.
• W2070073216 hasConceptScore W2070073216C2778754761 @default.
• W2070073216 hasConceptScore W2070073216C3020084786 @default.
• W2070073216 hasConceptScore W2070073216C502942594 @default.
• W2070073216 hasConceptScore W2070073216C503630168 @default.
• W2070073216 hasConceptScore W2070073216C71924100 @default.
• W2070073216 hasConceptScore W2070073216C86803240 @default.
• W2070073216 hasConceptScore W2070073216C95444343 @default.
• W2070073216 hasIssue "28" @default.
• W2070073216 hasLocation W20700732161 @default.
• W2070073216 hasOpenAccess W2070073216 @default.
• W2070073216 hasPrimaryLocation W20700732161 @default.
• W2070073216 hasRelatedWork W1965275883 @default.
• W2070073216 hasRelatedWork W1972750249 @default.
• W2070073216 hasRelatedWork W2004283601 @default.
• W2070073216 hasRelatedWork W2004851027 @default.
• W2070073216 hasRelatedWork W2045301138 @default.
• W2070073216 hasRelatedWork W2098650898 @default.
• W2070073216 hasRelatedWork W2136955266 @default.
• W2070073216 hasRelatedWork W2146828847 @default.
• W2070073216 hasRelatedWork W2162110762 @default.
• W2070073216 hasRelatedWork W2368990821 @default.
• W2070073216 hasVolume "272" @default.
• W2070073216 isParatext "false" @default.
• W2070073216 isRetracted "false" @default.

• next