FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2070623806> ?p ?o ?g. }

• W2070623806 endingPage "2218" @default.
• W2070623806 startingPage "2212" @default.
• W2070623806 abstract "Cα-formylglycine is the catalytic residue of sulfatases. Formylglycine is generated by posttranslational modification of a cysteine (pro- and eukaryotes) or serine (prokaryotes) located in a conserved (C/S)XPXR motif. The modifying enzymes are unknown. AtsB, an iron-sulfur protein, is strictly required for modification of Ser72 in the periplasmic sulfatase AtsA ofKlebsiella pneumoniae. Here we show (i) that AtsB is a cytosolic protein acting on newly synthesized serine-type sulfatases, (ii) that AtsB-mediated FGly formation is dependent on AtsA's signal peptide, and (iii) that the cytosolic cysteine-type sulfatase ofPseudomonas aeruginosa can be converted into a substrate of AtsB if the cysteine is substituted by serine and a signal peptide is added. Thus, formylglycine formation in serine-type sulfatases depends both on AtsB and on the presence of a signal peptide, and AtsB can act on sulfatases of other species. AtsB physically interacts with AtsA in a Ser72-dependent manner, as shown in yeast two-hybrid and GST pull-down experiments. This strongly suggests that AtsB is the serine-modifying enzyme and that AtsB relies on a cytosolic function of the sulfatase's signal peptide. Cα-formylglycine is the catalytic residue of sulfatases. Formylglycine is generated by posttranslational modification of a cysteine (pro- and eukaryotes) or serine (prokaryotes) located in a conserved (C/S)XPXR motif. The modifying enzymes are unknown. AtsB, an iron-sulfur protein, is strictly required for modification of Ser72 in the periplasmic sulfatase AtsA ofKlebsiella pneumoniae. Here we show (i) that AtsB is a cytosolic protein acting on newly synthesized serine-type sulfatases, (ii) that AtsB-mediated FGly formation is dependent on AtsA's signal peptide, and (iii) that the cytosolic cysteine-type sulfatase ofPseudomonas aeruginosa can be converted into a substrate of AtsB if the cysteine is substituted by serine and a signal peptide is added. Thus, formylglycine formation in serine-type sulfatases depends both on AtsB and on the presence of a signal peptide, and AtsB can act on sulfatases of other species. AtsB physically interacts with AtsA in a Ser72-dependent manner, as shown in yeast two-hybrid and GST pull-down experiments. This strongly suggests that AtsB is the serine-modifying enzyme and that AtsB relies on a cytosolic function of the sulfatase's signal peptide. Cα-formylglycine glutathione S-transferase P. aeruginosa sulfatase tryptic peptide 2 of AtsA containing Ser72/FGly72 untranslated region nitrilotriacetic acid hemagglutinin high pressure liquid chromatography phosphate-buffered saline 5-bromo-4- chloro-3-indolyl-β-d-galactopyranoside Almost all sulfatases that have been described are members of an evolutionary conserved protein family showing extensive homology among enzymes of prokaryotic, lower eukaryotic, and mammalian origin (1von Figura K. Schmidt B. Selmer T. Dierks T. Bioessays. 1998; 20: 505-510Crossref PubMed Scopus (80) Google Scholar, 2Dierks T. Lecca M.R. Schlotterhose P. Schmidt B. von Figura K. EMBO J. 1999; 18: 2084-2091Crossref PubMed Scopus (116) Google Scholar, 3Selmer T. Hallmann A. Schmidt B. Sumper M. von Figura K. Eur. J. Biochem. 1996; 238: 341-345Crossref PubMed Scopus (56) Google Scholar). The three-dimensional fold and, in particular, active site region of human and bacterial sulfatases are strikingly similar (4Bond C.S. Clements P.R. Ashby S.J. Collyer C.A. Harrop S.J. Hopwood J.J. Guss J.M. Structure. 1997; 5: 277-289Abstract Full Text Full Text PDF PubMed Scopus (250) Google Scholar, 5Lukatela G. Krauss N. Theis K. Selmer T. Gieselmann V. von Figura K. Saenger W. Biochemistry. 1998; 37: 3654-3664Crossref PubMed Scopus (270) Google Scholar, 6Boltes I. Czapinski H. Kahnert A. von Bülow R. Dierks T. Schmidt B. von Figura K. Kertesz M.A. Usón I. Structure. 2001; 9: 483-491Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). The catalytic residue is a Cα-formylglycine (FGly).1 Its formyl group is hydrated, leading to two geminal hydroxyls at the α-carbon that both are required for catalysis (6Boltes I. Czapinski H. Kahnert A. von Bülow R. Dierks T. Schmidt B. von Figura K. Kertesz M.A. Usón I. Structure. 2001; 9: 483-491Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar, 7Recksiek M. Selmer T. Dierks T. Schmidt B. von Figura K. J. Biol. Chem. 1998; 273: 6096-6103Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar). During sulfate ester cleavage, one of the hydroxyls undergoes covalent sulfation with consecutive desulfation induced by the second hydroxyl (6Boltes I. Czapinski H. Kahnert A. von Bülow R. Dierks T. Schmidt B. von Figura K. Kertesz M.A. Usón I. Structure. 2001; 9: 483-491Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar, 7Recksiek M. Selmer T. Dierks T. Schmidt B. von Figura K. J. Biol. Chem. 1998; 273: 6096-6103Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar, 8von Bülow R. Schmidt B. Dierks T. von Figura K. Usón I. J. Mol. Biol. 2001; 305: 269-277Crossref PubMed Scopus (82) Google Scholar). The importance of this novel catalytic mechanism is reflected by the fact that failure to generate the FGly residue leads to synthesis of catalytically inactive sulfatase polypeptides, as is observed in multiple sulfatase deficiency, a rare but fatal human lysosomal storage disorder (9Schmidt B. Selmer T. Ingendoh A. von Figura K. Cell. 1995; 82: 271-278Abstract Full Text PDF PubMed Scopus (288) Google Scholar, 10Hopwood J.J. Ballabio A. Scriver C.R. Beaudet A.L. Valle D. Sly W.S. The Metabolic and Molecular Bases of Inherited Disease. McGraw-Hill, Inc., New York2001: 3725-3732Google Scholar, 11Dierks T. Creighton T.E. Encyclopedia of Molecular Medicine. John Wiley & Sons, Inc., New York2001: 974-976Google Scholar). In eukaryotes, FGly is generated in the endoplasmic reticulum by oxidation of a conserved cysteine residue (12Dierks T. Schmidt B. von Figura K. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 11963-11968Crossref PubMed Scopus (109) Google Scholar, 13Dierks T. Lecca M.R. Schmidt B. von Figura K. FEBS Lett. 1998; 423: 61-65Crossref PubMed Scopus (35) Google Scholar). This late cotranslational or early posttranslational protein modification is directed by a short linear sequence motif comprising a proline and an arginine as the key residues in +2- and +4-positions (CXPXR) and, in addition, an adjacent auxiliary element (LTG; +8 to +10) (2Dierks T. Lecca M.R. Schlotterhose P. Schmidt B. von Figura K. EMBO J. 1999; 18: 2084-2091Crossref PubMed Scopus (116) Google Scholar). Replacing the key cysteine by serine or any other amino acid abolishes FGly formation completely (2Dierks T. Lecca M.R. Schlotterhose P. Schmidt B. von Figura K. EMBO J. 1999; 18: 2084-2091Crossref PubMed Scopus (116) Google Scholar, 7Recksiek M. Selmer T. Dierks T. Schmidt B. von Figura K. J. Biol. Chem. 1998; 273: 6096-6103Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar, 14Knaust A. Schmidt B. Dierks T. von Bülow R. von Figura K. Biochemistry. 1998; 37: 13941-13946Crossref PubMed Scopus (48) Google Scholar). The motif has to be accessible to the modifying machinery prior to folding of the nascent polypeptide into its native structure (2Dierks T. Lecca M.R. Schlotterhose P. Schmidt B. von Figura K. EMBO J. 1999; 18: 2084-2091Crossref PubMed Scopus (116) Google Scholar, 12Dierks T. Schmidt B. von Figura K. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 11963-11968Crossref PubMed Scopus (109) Google Scholar). To date, none of the components or cofactors of this machinery have been identified in eukaryotes. These components are comprised among the luminal contents of the endoplasmic reticulum, which in vitro mediate FGly modification independent of protein translocation and independent of a signal peptide in the sulfatase substrate (15Fey J. Balleininger M. Borissenko L.V. Schmidt B. von Figura K. Dierks T. J. Biol. Chem. 2001; 276: 47021-47028Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar). Due to the clear conservation of the FGly modification motif, most of the sulfatases encoded in various eubacterial genomes are predicted also to undergo FGly modification by oxidation of a cysteine. This was shown experimentally for the arylsulfatase of Pseudomonas aeruginosa (PAS), a member of the cysteine-type sulfatases. Even after strong overexpression in Escherichia coli, this cytosolic sulfatase was quantitatively converted to the active FGly-bearing enzyme (16Dierks T. Miech C. Hummerjohann J. Schmidt B. Kertesz M.A. von Figura K. J. Biol. Chem. 1998; 273: 25560-25564Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar). Hence, the E. coli cytosol contains the modifying machinery. This machinery is expressed even under excessive supply with inorganic sulfate. Thus, expression ofE. coli's cysteine-modifying system is independent of the sulfur status of the cells, in contrast to expression of the sulfatase structural genes, as studied in P. aeruginosa and inKlebsiella pneumoniae (17Beil S. Kehrli H. James P. Staudenmann W. Cook A.M. Leisinger T. Kertesz M.A. Eur. J. Biochem. 1995; 229: 385-394Crossref PubMed Scopus (102) Google Scholar, 18Murooka Y. Ishibashi K. Yasumoto M. Sasaki M. Sugino H. Azakami H. Yamashita M. J. Bacteriol. 1990; 172: 2131-2140Crossref PubMed Google Scholar, 19Dodgson K.S. White G.F. Fitzgerald J.W. Sulfatases of Microbial Origin. CRC Press, Inc., Boca Raton, FL1982: 133-154Google Scholar). The other well characterized bacterial sulfatase, the arylsulfatase AtsA of K. pneumoniae, is a serine-type sulfatase that carries an FGly residue generated by oxidation of a serine rather than a cysteine (20Miech C. Dierks T. Selmer T. von Figura K. Schmidt B. J. Biol. Chem. 1998; 273: 4835-4837Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar). Generation of FGly (i.e. serine semialdehyde) from serine most likely is a one-step oxidation process. In contrast to the cytosolic cysteine-type sulfatases, serine-type sulfatases are located in the periplasm (18Murooka Y. Ishibashi K. Yasumoto M. Sasaki M. Sugino H. Azakami H. Yamashita M. J. Bacteriol. 1990; 172: 2131-2140Crossref PubMed Google Scholar, 21Szameit C. Miech C. Balleininger M. Schmidt B. von Figura K. Dierks T. J. Biol. Chem. 1999; 274: 15375-15381Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar, 22Schirmer A. Kolter R. Chem. Biol. 1998; 5: R181-R186Abstract Full Text PDF PubMed Scopus (27) Google Scholar). The key FGly motif (SXPXR) and also the auxiliary downstream element (LTG) are also conserved in serine-type sulfatases (2Dierks T. Lecca M.R. Schlotterhose P. Schmidt B. von Figura K. EMBO J. 1999; 18: 2084-2091Crossref PubMed Scopus (116) Google Scholar). Despite these similarities, bacteria have two different pathways for FGly generation from cysteine and serine, respectively. This is indicated by two observations. First, substitution of the cysteine to be modified in PAS by serine totally blocks FGly formation (16Dierks T. Miech C. Hummerjohann J. Schmidt B. Kertesz M.A. von Figura K. J. Biol. Chem. 1998; 273: 25560-25564Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar). Second, expression of active, FGly-containing AtsA in E. coli essentially requires coexpression of the K. pneumoniae atsB gene (21Szameit C. Miech C. Balleininger M. Schmidt B. von Figura K. Dierks T. J. Biol. Chem. 1999; 274: 15375-15381Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar), whereas the genomic background of E. coli is sufficient for expression of active and modified PAS (16Dierks T. Miech C. Hummerjohann J. Schmidt B. Kertesz M.A. von Figura K. J. Biol. Chem. 1998; 273: 25560-25564Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar). The atsB gene is located on the same operon as the structural atsA gene. AtsB acts in trans on AtsA, since it was fully functional when both genes were co-expressed from two different plasmids (21Szameit C. Miech C. Balleininger M. Schmidt B. von Figura K. Dierks T. J. Biol. Chem. 1999; 274: 15375-15381Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). Despite the presence of two serine-type sulfatase operons in E. coli, each consisting of a sulfatase gene and an atsB homolog, this species has not been found to express endogenous sulfatases. The inability of the chromosomalatsB homologs of E. coli to substitute for theKlebsiella atsB most likely is explained by repression of its sulfatase operons. AtsB is predicted to be a 44-kDa iron-sulfur protein with three cysteine clusters that are conserved in all AtsB homologs (22Schirmer A. Kolter R. Chem. Biol. 1998; 5: R181-R186Abstract Full Text PDF PubMed Scopus (27) Google Scholar). Iron-sulfur proteins are involved in redox reactions, but only recently a direct enzymatic oxidoreductase function has been assigned to this class of proteins (23Sofia H.J. Chen G. Hetzler B.G. Reyes-Spindola J.F. Miller N.E. Nucleic Acids Res. 2001; 29: 1097-1106Crossref PubMed Scopus (764) Google Scholar, 24Ollagnier S. Mulliez E. Schmidt P.P. Eliasson R. Gaillard J. Deronzier C. Bergman T. Graslund A. Reichard P. Fontecave M. J. Biol. Chem. 1997; 272: 24216-24223Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar, 25Layer G. Verfurth K. Mahlitz E. Jahn D. J. Biol. Chem. 2002; 277: 34136-34142Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). In this study, we addressed the following questions. Where in the cell does AtsB fulfill its function? Can it act on both cytosolic and secretory sulfatases? Does AtsB act specifically on the Klebsiella sulfatase or on serine-type sulfatases in general? And finally, does AtsB physically interact with the modification motif on the sulfatase polypeptide? atsA-S72C was generated by PCR mutagenesis of atsA (21Szameit C. Miech C. Balleininger M. Schmidt B. von Figura K. Dierks T. J. Biol. Chem. 1999; 274: 15375-15381Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar) using a coding mutagenic primer (CGAGCAGGGAATGCGCATGAGCCAGTATTACACCTCGCCGATGTGCGCCCCGGC) that allowed subcloning of the PCR product via its BsmI site. The generation of pas-C51S was described earlier (16Dierks T. Miech C. Hummerjohann J. Schmidt B. Kertesz M.A. von Figura K. J. Biol. Chem. 1998; 273: 25560-25564Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar). The 5′-UTR of the pas gene in pME4055 (16Dierks T. Miech C. Hummerjohann J. Schmidt B. Kertesz M.A. von Figura K. J. Biol. Chem. 1998; 273: 25560-25564Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar) was substituted by the short 5′-UTR of atsA (21Szameit C. Miech C. Balleininger M. Schmidt B. von Figura K. Dierks T. J. Biol. Chem. 1999; 274: 15375-15381Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar) by adding an oligonucleotide (CCCAAGCTTGAACAGGAGAGTCAGTCGTG), with aHindIII site and an initiator GTG, 5′ of pas. The modified gene was cloned into pBluescriptII SK as a HindIII fragment downstream of the lac promotor. The addition of an oligonucleotide coding for a C-terminal Arg-Gly-Ser-His6 tag to atsA was described earlier (21Szameit C. Miech C. Balleininger M. Schmidt B. von Figura K. Dierks T. J. Biol. Chem. 1999; 274: 15375-15381Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). The same tag was fused to AtsB by adding the oligonucleotide GGGGGATATCATGCGCTAGTGATGGTGATGGTGATGCGATCCTCT 5′ of theatsB stop codon and subcloning of the obtained PCR product as a BsmI/EcoRV fragment back into theatsB template vector. Deletion of AtsA's signal peptide was achieved by adding an oligonucleotide (CCCAAGCTTGAACAGGAGAGTCAGTCGTG) with a HindIII site and the indicated initiator GTG, 5′ of codon 21 ofatsA, which encodes the first amino acid of mature AtsA. The PCR product was subcloned as a HindIII/XhoI fragment back into the atsBA template vector. For construction of PAS-C51S+SP, the AtsA signal peptide was added to its N terminus. Using overlapping extension PCR (26Horton R.M. Hunt H.D., Ho, S.N. Pullen J.K. Pease L.R. Gene (Amst.). 1989; 77: 61-68Crossref PubMed Scopus (2614) Google Scholar), we amplified the 5′-UTR and signal peptide codons of atsA (internal noncoding primer: GGGCGTTTGCTCGCGGCGTGCGCGCCACC) and, in a second PCR, the coding region of pas excluding the initiator ATG (internal coding primer: CACGCCGCGAGCAAACGCCCCAACTTCCTG). The two PCR products were fused by using them as templates in a third PCR reaction, due to hybridization of the overlapping complementary sequences introduced by the two internal primers. From the final PCR product, a 144-bp EcoRV fragment was subcloned into pBluescriptII SK-PAS-C51S, thereby replacing the corresponding part in the 5′ region of pas. E. coli DH5α was transformed with the following plasmids: pBluescriptII containing eitheratsA, atsB, atsBA (atsA andatsB with or without His tag codons, atsA with or without signal peptide codons), pas, or pas-C51S (with or without signal peptide codons). Coexpression of AtsB with PAS constructs was achieved in double transformants containing also the pBBR1MCS-atsB plasmid (atsB subcloned fromatsBA as a KpnI/HindIII fragment). The presence of the two plasmids was maintained in selective medium, containing ampicillin and chloramphenicol, and was routinely checked by PCR analysis. Growth conditions, preparation of periplasm, and purification of hexahistidine-tagged proteins were described earlier (21Szameit C. Miech C. Balleininger M. Schmidt B. von Figura K. Dierks T. J. Biol. Chem. 1999; 274: 15375-15381Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). Using purified native PAS protein, provided by Dr. M. Kertesz (School of Biological Sciences, University of Manchester, UK) as antigen and specol as adjuvant, polyclonal antibodies were raised in rabbits injected with 400 μg (first injection) or 200 μg (two booster injections) of antigen. Anti-AtsB antibodies were generated similarly, using AtsB-His6protein as antigen. This was purified from inclusion bodies on Ni2+-NTA-agarose (Qiagen) in the presence of 8m urea according to the protocol of the manufacturer. Prior to rabbit injection, urea was removed by stepwise dialysis (4m/2 m/1 m urea in PBS). The purity of AtsB was at least 95% (Fig. 1 B). Antibodies were purified by preadsorption of antisera to immobilized E. coliprotein. Anti-AtsB antibodies furthermore were affinity-purified by adsorption to SDS-PAGE-purified antigen that was blotted to and excised from a nitrocellulose membrane. Bound antibodies were eluted with 200 mm glycine (pH 2.8). Expressed AtsB, sulfatase, or fusion proteins were detected by Western blotting using anti-AtsA (21Szameit C. Miech C. Balleininger M. Schmidt B. von Figura K. Dierks T. J. Biol. Chem. 1999; 274: 15375-15381Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar), anti-AtsB, anti-PAS (see above), anti-GST (Amersham Biosciences), anti-hexahistidine (Qiagen), or anti-HA 12C5A (Roche Molecular Biochemicals) as primary antibodies. ECL signals of corresponding secondary antibodies were detected by a LAS1000+ imaging system (Raytest) and quantitated by densitometry of digital images using Aida 3.10 software (Raytest). For SDS-PAGE, see Ref. 27Dierks T. Volkmer J. Schlenstedt G. Jung C. Sandholzer U. Zachmann K. Schlotterhose P. Neifer K. Schmidt B. Zimmermann R. EMBO J. 1996; 15: 6931-6942Crossref PubMed Scopus (113) Google Scholar. The activity of expressed sulfatases was determined in duplicate assays at saturating substrate concentration, as described earlier for AtsA (20Miech C. Dierks T. Selmer T. von Figura K. Schmidt B. J. Biol. Chem. 1998; 273: 4835-4837Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar) and PAS (16Dierks T. Miech C. Hummerjohann J. Schmidt B. Kertesz M.A. von Figura K. J. Biol. Chem. 1998; 273: 25560-25564Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar, 17Beil S. Kehrli H. James P. Staudenmann W. Cook A.M. Leisinger T. Kertesz M.A. Eur. J. Biochem. 1995; 229: 385-394Crossref PubMed Scopus (102) Google Scholar). The presence of FGly in AtsA was analyzed at the level of its tryptic peptides (see Refs. 20Miech C. Dierks T. Selmer T. von Figura K. Schmidt B. J. Biol. Chem. 1998; 273: 4835-4837Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar and 21Szameit C. Miech C. Balleininger M. Schmidt B. von Figura K. Dierks T. J. Biol. Chem. 1999; 274: 15375-15381Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). During reversed-phase HPLC, P2 and P2* (see “Results”), as detected by mass spectrometry, were recovered in adjacent fractions. The amounts of these peptides were quantitated by sequencing on a Procise cLC protein sequencer (Applied Biosystems). The presence of FGly was verified by mass spectrometry on a matrix-assisted laser desorption ionization-time of flight Reflex III instrument (Bruker Daltonics), using a 337-nm nitrogen laser, with a 200-ns extraction delay. Spectra were obtained as averages of 100 laser shots. 10 mg/ml α-cyano-4-hydroxy-cinnamic acid (Bruker Daltonics) in 50% acetonitrile, 0.1% trifluoroacetic acid served as matrix. Samples were prepared by the drying droplet method, drying 0.5 μl each of sample and matrix solution on a stainless steel target. For FGly identification, 0.5 μl of 2,4-dinitrophenyl hydrazine (Fluka), saturated in 50% acetonitrile, 0.1% trifluoroacetic acid, was added to the dried sample/matrix mixture on the target. Fragments of theKlebsiella atsA gene were cloned as PCR products into the pAS2 (“bait”) vector in frame with the DNA sequence encoding the HA-tagged Gal4-binding domain (28Tsukada M. Will E. Gallwitz D. Mol. Biol. Cell. 1999; 10: 63-75Crossref PubMed Scopus (77) Google Scholar). For PCR amplification ofatsA fragments, plasmids encoding full-lengthatsA or its signal peptide-deleted version (see above) were used as templates. The forward primer (CCTGAAGGCCATGGAGGCCACAGGAGAGTCAGTCGTG) introduced the underlined SfiI site 5′ of the atsA fragment, and the reverse primers (CGGGATCCGGAAGAACGATAGCCGTGGTGG or CGGGATCCTAGCGGTCGGTCAGCCGCAG) introduced the underlinedBamHI site 3′ of the wild type stop codon or of a stop codon inserted 3′ of codon 112 by the primer, respectively. The PCR products were cloned as SfiI/BamHI fragments into the pAS2 vector, yielding pAS2-AtsA-(1–112), pAS2-AtsA-(21–112), and pAS2-AtsA-(21–577) (see “Results”). The full-lengthatsB gene was cloned into the pACTII (“prey”) vector in frame with the HA-tagged Gal4 activation domain (28Tsukada M. Will E. Gallwitz D. Mol. Biol. Cell. 1999; 10: 63-75Crossref PubMed Scopus (77) Google Scholar) using a 3′BamHI site present in the multicloning sites of both originating (pBluescriptII KS) and receiving vector. At the 5′-end, a pBluescriptII KS KpnI site, blunted with T4 polymerase, was ligated with a pACTII NcoI site, blunted with Klenow polymerase. The yeast reporter strain Y190 was transformed with both one bait and one prey plasmid. As negative controls, transformations with empty pAS2 or pACTII vectors in combination with a hybrid construct were performed. Cotransformants were selected due to their tryptophan and leucine prototrophy conveyed by the two plasmids (see Ref. 28Tsukada M. Will E. Gallwitz D. Mol. Biol. Cell. 1999; 10: 63-75Crossref PubMed Scopus (77) Google Scholar). Expression of the correct fusion proteins by these cotransformants was routinely controlled by Western blot analysis of cell lysates using anti-HA or anti-AtsB antibodies (not shown). The β-galactosidase activity induced in the case of reconstitution of the Gal4p transcription factor was detected by applying a filter assay with 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-gal) as a substrate (29Dalton S. Treisman R. Cell. 1992; 68: 597-612Abstract Full Text PDF PubMed Scopus (532) Google Scholar); the permeabilized cells were incubated with X-gal for 6–8 h at 30 °C. The β-galactosidase activity was quantified in a fluid phase assay of cell lysates usingo-nitrophenyl galactoside as a substrate (30Guarente L. Methods Enzymol. 1983; 101: 181-191Crossref PubMed Scopus (871) Google Scholar) and calculated according to Ref. 31Miller J.H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1972: 352-355Google Scholar. Codons 21–112 of atsAor atsA-S72C (see above) were amplified by PCR using primers that add a 5′ EcoRI site (GGAATTCTAACAGGAGAGTCAGTCGTG) and a 3′ SacI site (AAGCTTGAGCTCTAGCGGTCGGTCAGCCGCAG). The PCR products were cloned as EcoRI/SacI fragments into the pGEX-KG vector (32Guan K.L. Dixon J.E. Anal. Biochem. 1991; 192: 262-267Crossref PubMed Scopus (1635) Google Scholar) in frame with its glutathione S-transferase encoding sequence. The fusion proteins, or GST only, were overexpressed in induced (0.2 mm isopropyl thiogalactoside), logarithmically growing E. coli DH5α. Bacteria were disrupted in a French press cell and treated with 5 m urea in PBS (pH 7.4) for 30 min at room temperature. The soluble material (75,000 × g supernatant) was subjected to dialysis against PBS to remove the urea. After dialysis and another centrifugation (75,000 × g), the supernatants or, as a control, PBS buffer were loaded on glutathione-agarose (incubation for 30 min at room temperature), which then was washed with 3 × 4 column volumes of PBS. The columns were then loaded at room temperature with the soluble fraction of an E. coli French press lysate (in PBS) containing expressed AtsB protein, and the flow-through was immediately collected without further incubation. After another three washing steps (as above), the columns were eluted twice with 1.5 column volumes of 20 mm glutathione in PBS (pH 8.0). The wash and eluate fractions as well as a final eluate, obtained by boiling the glutathione-agarose beads in SDS-PAGE sample buffer, were analyzed by Western blotting. The Klebsiellaarylsulfatase AtsA, when purified from a total K. pneumoniaecell lysate, was found to be processed by signal peptidase and to carry FGly72 in 60% of sulfatase polypeptides (20Miech C. Dierks T. Selmer T. von Figura K. Schmidt B. J. Biol. Chem. 1998; 273: 4835-4837Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar). When hexahistidine-tagged AtsA, expressed in E. coli together with AtsB, was purified from the periplasm of the cells, FGly modification was observed for 48 ± 2% of polypeptides, whereas in the absence of AtsB no FGly was detected (21Szameit C. Miech C. Balleininger M. Schmidt B. von Figura K. Dierks T. J. Biol. Chem. 1999; 274: 15375-15381Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). To find out whether AtsB, like AtsA, has a periplasmic localization, as suggested earlier (18Murooka Y. Ishibashi K. Yasumoto M. Sasaki M. Sugino H. Azakami H. Yamashita M. J. Bacteriol. 1990; 172: 2131-2140Crossref PubMed Google Scholar), we performed a subcellular fractionation of E. colicells expressing both AtsA and AtsB. After osmotic shock of the cells AtsB was found exclusively in the spheroplast pellet and not in the supernatant containing the periplasmic proteins, among them AtsA (Fig. 1 A). The appearance of AtsA also in the spheroplasts is attributed to incomplete disruption of the outer membrane. After two-step purification of AtsB, expressed in hexahistidine-tagged form, by Ni2+-NTA-agarose chromatography and reversed-phase HPLC (Fig. 1 B), the AtsB-His6 protein was subjected to amino acid sequencing and found to have an intact N terminus (MLNIAALR). This excludes processing by the signal peptidase. In conclusion, AtsB is a cytosolic protein. The arylsulfatase PAS of Pseudomonas aeruginosa is a cysteine-type sulfatase that is quantitatively modified upon expression of its structural gene in E. coli (16Dierks T. Miech C. Hummerjohann J. Schmidt B. Kertesz M.A. von Figura K. J. Biol. Chem. 1998; 273: 25560-25564Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar). When the critical cysteine residue 51 was substituted by a serine (PAS-C51S), no FGly formation was observed (16Dierks T. Miech C. Hummerjohann J. Schmidt B. Kertesz M.A. von Figura K. J. Biol. Chem. 1998; 273: 25560-25564Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar). Since the sequence motifs (SXPXR and LTG; see Introduction) determining AtsB-dependent FGly formation in AtsA are contained also in PAS-C51S, the C51S form of PAS was expressed with or without AtsB. As shown in Fig. 2 A, PAS-C51S was expressed as an inactive polypeptide in the absence and presence of AtsB. Control experiments demonstrated that expression of AtsB does not affect the expression of active wild type PAS (Fig. 2 A). Therefore, we conclude that PAS, when converted to a serine-type sulfatase, is not a substrate for the AtsB-dependent FGly-generating machinery. One of the major differences between AtsA and PAS-C51S is the presence or absence of a signal peptide, respectively. Therefore, we deleted the signal peptide of AtsA and investigated whether a cytosolic version of AtsA (AtsAΔSP) is synthesized in active form when coexpressed with AtsB. It turned out that AtsAΔSP showed a very low, albeit significant, catalytic activity of 0.84 ± 0.14 units/mg (n = 5) (i.e. about 1% of wild type AtsA activity) (Fig. 3 A). In the absence of AtsB, AtsAΔSP was expressed as a completely inactive protein. To examine for the presence of FGly, hexahistidine-tagged versions of wild type AtsA and AtsAΔSP were coexpressed with AtsB. The sulfatases were purified on Ni2+-NTA-agarose and analyzed for FGly modification. For this purpose, tryptic peptides were generated and subjected to HPLC on a reversed-phase column, which allowed us to separate unmodified and modified peptide 2 (P2 and P2*) comprising serine or FGly at position 72, respectively. P2 and P2* eluted in adjacent fractions (20Miech C. Dierks T. Selmer T. von Figura K." @default.
• W2070623806 created "2016-06-24" @default.
• W2070623806 creator A5012975261 @default.
• W2070623806 creator A5041712105 @default.
• W2070623806 creator A5045990599 @default.
• W2070623806 creator A5068192515 @default.
• W2070623806 creator A5083993731 @default.
• W2070623806 creator A5088130592 @default.
• W2070623806 date "2003-01-01" @default.
• W2070623806 modified "2023-10-14" @default.
• W2070623806 title "Posttranslational Modification of Serine to Formylglycine in Bacterial Sulfatases" @default.
• W2070623806 cites W1566478858 @default.
• W2070623806 cites W1807523145 @default.
• W2070623806 cites W1984296057 @default.
• W2070623806 cites W1985770761 @default.
• W2070623806 cites W1987068920 @default.
• W2070623806 cites W1988370868 @default.
• W2070623806 cites W1996223704 @default.
• W2070623806 cites W1998591058 @default.
• W2070623806 cites W2001521415 @default.
• W2070623806 cites W2009235439 @default.
• W2070623806 cites W2011655913 @default.
• W2070623806 cites W2012660345 @default.
• W2070623806 cites W2013248441 @default.
• W2070623806 cites W2017241270 @default.
• W2070623806 cites W2022110979 @default.
• W2070623806 cites W2035472302 @default.
• W2070623806 cites W2039727644 @default.
• W2070623806 cites W2046958726 @default.
• W2070623806 cites W2051628416 @default.
• W2070623806 cites W2052932569 @default.
• W2070623806 cites W2069648309 @default.
• W2070623806 cites W2072289725 @default.
• W2070623806 cites W2086003789 @default.
• W2070623806 cites W2097589722 @default.
• W2070623806 cites W2102410852 @default.
• W2070623806 cites W2110615865 @default.
• W2070623806 cites W2149669489 @default.
• W2070623806 cites W2150710339 @default.
• W2070623806 cites W2152707194 @default.
• W2070623806 cites W2159777821 @default.
• W2070623806 doi "https://doi.org/10.1074/jbc.m209435200" @default.
• W2070623806 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12419807" @default.
• W2070623806 hasPublicationYear "2003" @default.
• W2070623806 type Work @default.
• W2070623806 sameAs 2070623806 @default.
• W2070623806 citedByCount "48" @default.
• W2070623806 countsByYear W20706238062012 @default.
• W2070623806 countsByYear W20706238062013 @default.
• W2070623806 countsByYear W20706238062014 @default.
• W2070623806 countsByYear W20706238062015 @default.
• W2070623806 countsByYear W20706238062016 @default.
• W2070623806 countsByYear W20706238062017 @default.
• W2070623806 countsByYear W20706238062018 @default.
• W2070623806 countsByYear W20706238062019 @default.
• W2070623806 countsByYear W20706238062020 @default.
• W2070623806 countsByYear W20706238062021 @default.
• W2070623806 countsByYear W20706238062022 @default.
• W2070623806 countsByYear W20706238062023 @default.
• W2070623806 crossrefType "journal-article" @default.
• W2070623806 hasAuthorship W2070623806A5012975261 @default.
• W2070623806 hasAuthorship W2070623806A5041712105 @default.
• W2070623806 hasAuthorship W2070623806A5045990599 @default.
• W2070623806 hasAuthorship W2070623806A5068192515 @default.
• W2070623806 hasAuthorship W2070623806A5083993731 @default.
• W2070623806 hasAuthorship W2070623806A5088130592 @default.
• W2070623806 hasBestOaLocation W20706238061 @default.
• W2070623806 hasConcept C100631289 @default.
• W2070623806 hasConcept C11960822 @default.
• W2070623806 hasConcept C181199279 @default.
• W2070623806 hasConcept C185592680 @default.
• W2070623806 hasConcept C2776414213 @default.
• W2070623806 hasConcept C55493867 @default.
• W2070623806 hasConcept C86803240 @default.
• W2070623806 hasConcept C95444343 @default.
• W2070623806 hasConceptScore W2070623806C100631289 @default.
• W2070623806 hasConceptScore W2070623806C11960822 @default.
• W2070623806 hasConceptScore W2070623806C181199279 @default.
• W2070623806 hasConceptScore W2070623806C185592680 @default.
• W2070623806 hasConceptScore W2070623806C2776414213 @default.
• W2070623806 hasConceptScore W2070623806C55493867 @default.
• W2070623806 hasConceptScore W2070623806C86803240 @default.
• W2070623806 hasConceptScore W2070623806C95444343 @default.
• W2070623806 hasIssue "4" @default.
• W2070623806 hasLocation W20706238061 @default.
• W2070623806 hasOpenAccess W2070623806 @default.
• W2070623806 hasPrimaryLocation W20706238061 @default.
• W2070623806 hasRelatedWork W1953044259 @default.
• W2070623806 hasRelatedWork W2049037526 @default.
• W2070623806 hasRelatedWork W2109572947 @default.
• W2070623806 hasRelatedWork W2119133512 @default.
• W2070623806 hasRelatedWork W2771849436 @default.
• W2070623806 hasRelatedWork W2888018387 @default.
• W2070623806 hasRelatedWork W2915211422 @default.
• W2070623806 hasRelatedWork W50511791 @default.
• W2070623806 hasRelatedWork W2136545008 @default.
• W2070623806 hasRelatedWork W2739676309 @default.
• W2070623806 hasVolume "278" @default.

• next