FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2070793437> ?p ?o ?g. }

• W2070793437 endingPage "1323" @default.
• W2070793437 startingPage "1316" @default.
• W2070793437 abstract "CCAAT/enhancer-binding proteins (C/EBP) are critical determinants for cellular differentiation and cell type-specific gene expression. Their functional roles in osteoblast development have not been determined. We addressed a key component of the mechanisms by which C/EBP factors regulate transcription of a tissue-specific gene during osteoblast differentiation. Expression of both C/EBPβ and C/EBPδ increases from the growth to maturation developmental stages and, like the bone-specific osteocalcin (OC) gene, is also stimulated 3–6-fold by vitamin D3, a regulator of osteoblast differentiation. We characterized a C/EBP enhancer element in the proximal promoter of the rat osteocalcin gene, which resides in close proximity to a Runx2 (Cbfa1) element, essential for tissue-specific activation. We find that C/EBP and Runx2 factors interact together in a synergistic manner to enhance OC transcription (35–40-fold) in cell culture systems. We show by mutational analysis that this synergism is mediated through the C/EBP-responsive element in the OC promoter and by a direct interaction between Runx2 and C/EBPβ. Furthermore, we have mapped a domain in Runx2 necessary for this interaction by immunoprecipitation. A Runx2 mutant lacking this interaction domain does not exhibit functional synergism. We conclude that, in addition to Runx2 DNA binding functions, Runx2 can also form a protein complex at C/EBP sites to regulate transcription. Taken together, our findings indicate that C/EBP is a principal transactivator of the OC gene and the synergism with Runx2 suggests that a combinatorial interaction of these factors is a principal mechanism for regulating tissue-specific expression during osteoblast differentiation. CCAAT/enhancer-binding proteins (C/EBP) are critical determinants for cellular differentiation and cell type-specific gene expression. Their functional roles in osteoblast development have not been determined. We addressed a key component of the mechanisms by which C/EBP factors regulate transcription of a tissue-specific gene during osteoblast differentiation. Expression of both C/EBPβ and C/EBPδ increases from the growth to maturation developmental stages and, like the bone-specific osteocalcin (OC) gene, is also stimulated 3–6-fold by vitamin D3, a regulator of osteoblast differentiation. We characterized a C/EBP enhancer element in the proximal promoter of the rat osteocalcin gene, which resides in close proximity to a Runx2 (Cbfa1) element, essential for tissue-specific activation. We find that C/EBP and Runx2 factors interact together in a synergistic manner to enhance OC transcription (35–40-fold) in cell culture systems. We show by mutational analysis that this synergism is mediated through the C/EBP-responsive element in the OC promoter and by a direct interaction between Runx2 and C/EBPβ. Furthermore, we have mapped a domain in Runx2 necessary for this interaction by immunoprecipitation. A Runx2 mutant lacking this interaction domain does not exhibit functional synergism. We conclude that, in addition to Runx2 DNA binding functions, Runx2 can also form a protein complex at C/EBP sites to regulate transcription. Taken together, our findings indicate that C/EBP is a principal transactivator of the OC gene and the synergism with Runx2 suggests that a combinatorial interaction of these factors is a principal mechanism for regulating tissue-specific expression during osteoblast differentiation. CCAAT/enhancer-binding protein osteocalcin chloramphenicol acetyltransferase rat osteosarcoma Rous sarcoma virus runt homology domain The CCAAT/enhancer-binding proteins (C/EBPs)1 comprise a family of transcription factors that are critical for normal cellular differentiation and metabolic functions in a variety of tissues. There are currently six members of the C/EBP family designated as C/EBPα, -β, -δ, -γ, -ε, and -ζ (1Lekstrom-Himes J. Xanthopoulos K.G. J. Biol. Chem. 1998; 273: 28545-28548Google Scholar), most of which are expressed in liver, spleen, and adipocytic tissues. However, more selective expression in other tissues has been observed among the family members (2Alam T. An M.R. Papaconstantinou J. J. Biol. Chem. 1992; 267: 5021-5024Google Scholar, 3Antonson P. Xanthopoulos K.G. Biochem. Biophys. Res. Commun. 1995; 215: 106-113Google Scholar, 4Birkenmeier E.H. Gwynn B. Howard S. Jerry J. Gordon J.I. Landschulz W.H. McKnight S.L. Genes Dev. 1989; 3: 1146-1156Google Scholar, 5Morosetti R. Park D.J. Chumakov A.M. Grillier I. Shiohara M. Gombart A.F. Nakamaki T. Weinberg K. Koeffler H.P. Blood. 1997; 90: 2591-2600Google Scholar, 6Wang N.D. Finegold M.J. Bradley A. Ou C.N. Abdelsayed S.V. Wilde M.D. Taylor L.R. Wilson D.R. Darlington G.J. Science. 1995; 269: 1108-1112Google Scholar, 7Yamanaka R. Kim G.D. Radomska H.S. Lekstrom-Himes J. Smith L.T. Antonson P. Tenen D.G. Xanthopoulos K.G. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 6462-6467Google Scholar). Isoforms of the C/EBP proteins are known, and all function by homo- or heterodimerization with one another and interaction with other transcriptional activators or co-activators such as NF-κB, Stat3, c-Myb, PU.1, SP-1, ATF-2, PPARγ, and Runx-1 (8Lopez-Rodriguez C. Botella L. Corbi A.L. J. Biol. Chem. 1997; 272: 29120-29126Google Scholar, 9Oelgeschlager M. Nuchprayoon I. Luscher B. Friedman A.D. Mol. Cell. Biol. 1996; 16: 4717-4725Google Scholar, 10Shuman J.D. Cheong J. Coligan J.E. J. Biol. Chem. 1997; 272: 12793-12800Google Scholar, 11Spiegelman B.M. Puigserver P. Wu Z. Int. J Obes. Relat. Metab. Disord. 2000; 24: S8-S10Google Scholar, 12Stein G.S. Lian J.B. Endocr. Rev. 1993; 14: 424-442Google Scholar, 13Zhang D.E. Hetherington C.J. Meyers S. Rhoades K.L. Larson C.J. Chen H.M. Hiebert S.W. Tenen D.G. Mol. Cell. Biol. 1996; 16: 1231-1240Google Scholar, 14Zhang D.E. Hohaus S. Voso M.T. Chen H.M. Smith L.T. Hetherington C.J. Tenen D.G. Curr. Top. Microbiol. Immunol. 1996; 211: 137-147Google Scholar). Very little is known about the role of C/EBP factors in osteogenesis. Targeted disruptions of C/EBP genes have been performed, but in none of the studies were gross abnormalities of the skeleton observed (6Wang N.D. Finegold M.J. Bradley A. Ou C.N. Abdelsayed S.V. Wilde M.D. Taylor L.R. Wilson D.R. Darlington G.J. Science. 1995; 269: 1108-1112Google Scholar,15Tanaka T. Akira S. Yoshida K. Umemoto M. Yoneda Y. Shirafuji N. Fujiwara H. Suematsu S. Yoshida N. Kishimoto T. Cell. 1995; 80: 353-361Google Scholar, 16Sterneck E. Tessarollo L. Johnson P.F. Genes Dev. 1997; 11: 2153-2162Google Scholar, 17Tanaka T. Yoshida N. Kishimoto T. Akira S. EMBO J. 1997; 16: 7432-7443Google Scholar). However, recent studies have identified C/EBP regulation of genes expressed in osteoblasts. The insulin-like growth factor 1 is a key regulator of osteoblast growth and differentiation (18Gabbitas B. Canalis E. Am. J. Physiol. 1998; 275: E222-E228Google Scholar). C/EBPδ enhances either basal or prostaglandin E2-activated transcription of the insulin-like growth factor 1 promoter in osteoblasts (19Umayahara Y. Ji C. Centrella M. Rotwein P. McCarthy T.L. J. Biol. Chem. 1997; 272: 31793-31800Google Scholar, 20Harrison J.R. Kelly P.L. Pilbeam C.C. J. Bone Miner. Res. 2000; 15: 1138-1146Google Scholar). Expression of COX-2 and the α1 subunit of type I collagen is also regulated in osteoblasts by C/EBP factors (21Attard F.A. Wang L. Potter J.J. Rennie-Tankersley L. Mezey E. Arch. Biochem. Biophys. 2000; 378: 57-64Google Scholar, 22Ogasawara A. Arakawa T. Kaneda T. Takuma T. Sato T. Kaneko H. Kumegawa M. Hakeda Y. J. Biol. Chem. 2001; 276: 7048-7054Google Scholar). The interaction of C/EBPα with a Runx1 factor (23Petrovick M.S. Hiebert S.W. Friedman A.D. Hetherington C.J. Tenen D.G. Zhang D.E. Mol. Cell. Biol. 1998; 18: 3915-3925Google Scholar) is also particularly relevant for postulating a role for C/EBP factors in osteoblast differentiation. The Runt-related transcription factors (Runx/AML/CBFα/PEBP2α) represent essential gene regulatory proteins that control lineage commitment for hematopoiesis (24Okuda T. van Deursen J. Hiebert S.W. Grosveld G. Downing J.R. Cell. 1996; 84: 321-330Google Scholar, 25Speck N.A. Stacy T. Wang Q. North T. Gu T.L. Miller J. Binder M. Marin-Padilla M. Cancer Res. 1999; 59: 1789s-1793sGoogle Scholar, 26Wang Q. Stacy T. Miller J.D. Lewis A.F. Gu T.L. Huang X. Bushweller J.H. Bories J.C. Alt F.W. Ryan G. Liu P.P. Wynshaw-Boris A. Binder M. Marin-Padilla M. Sharpe A.H. Speck N.A. Cell. 1996; 87: 697-708Google Scholar) and osteogenesis (27Komori T. Yagi H. Nomura S. Yamaguchi A. Sasaki K. Deguchi K. Shimizu Y. Bronson R.T. Gao Y.-H. Inada M. Sato M. Okamoto R. Kitamura Y. Yoshiki S. Kishimoto T. Cell. 1997; 89: 755-764Google Scholar, 28Mundlos S. Otto F. Mundlos C. Mulliken J.B. Aylsworth A.S. Albright S. Lindhout D. Cole W.G. Henn W. Knoll J.H.M. Owen M.J. Mertelsmann R. Zabel B.U. Olsen B.R. Cell. 1997; 89: 773-779Google Scholar). Runx2 (AML3/Cbfa1/PEBP2αA) is the most abundant Runt-related protein in osteogenic and chondrogenic cell lineages (29Banerjee C. McCabe L.R. Choi J.-Y. Hiebert S.W. Stein J.L. Stein G.S. Lian J.B. J. Cell. Biochem. 1997; 66: 1-8Google Scholar, 30Ducy P. Zhang R. Geoffroy V. Ridall A.L. Karsenty G. Cell. 1997; 89: 747-754Google Scholar, 31Javed A. Barnes G.L. Jassanya B.O. Stein J.L. Gerstenfeld L. Lian J.B. Stein G.S. Mol. Cell. Biol. 2001; 21: 2891-2905Google Scholar). Genetic ablation of the Runx2 gene causes developmental defects in osteogenesis (27Komori T. Yagi H. Nomura S. Yamaguchi A. Sasaki K. Deguchi K. Shimizu Y. Bronson R.T. Gao Y.-H. Inada M. Sato M. Okamoto R. Kitamura Y. Yoshiki S. Kishimoto T. Cell. 1997; 89: 755-764Google Scholar), and hereditary mutations in the Runx2 gene are linked to specific ossification defects as observed in cleidocranial dysplasia (32Otto F. Thornell A.P. Crompton T. Denzel A. Gilmour K.C. Rosewell I.R. Stamp G.W.H. Beddington R.S.P. Mundlos S. Olsen B.R. Selby P.B. Owen M.J. Cell. 1997; 89: 765-771Google Scholar). Runx2 is essential for osteoblast differentiation (27Komori T. Yagi H. Nomura S. Yamaguchi A. Sasaki K. Deguchi K. Shimizu Y. Bronson R.T. Gao Y.-H. Inada M. Sato M. Okamoto R. Kitamura Y. Yoshiki S. Kishimoto T. Cell. 1997; 89: 755-764Google Scholar, 29Banerjee C. McCabe L.R. Choi J.-Y. Hiebert S.W. Stein J.L. Stein G.S. Lian J.B. J. Cell. Biochem. 1997; 66: 1-8Google Scholar, 30Ducy P. Zhang R. Geoffroy V. Ridall A.L. Karsenty G. Cell. 1997; 89: 747-754Google Scholar) and regulates expression of numerous bone-related genes (29Banerjee C. McCabe L.R. Choi J.-Y. Hiebert S.W. Stein J.L. Stein G.S. Lian J.B. J. Cell. Biochem. 1997; 66: 1-8Google Scholar, 31Javed A. Barnes G.L. Jassanya B.O. Stein J.L. Gerstenfeld L. Lian J.B. Stein G.S. Mol. Cell. Biol. 2001; 21: 2891-2905Google Scholar, 33Jimenez M.J. Balbin M. Lopez J.M. Alvarez J. Komori T. Lopez-Otin C. Mol. Cell. Biol. 1999; 19: 4431-4442Google Scholar, 34Ji C. Casinghino S. Chang D.J. Chen Y. Javed A. Ito Y. Hiebert S.W. Lian J.B. Stein G.S. McCarthy T.L. Centrella M. J. Cell. Biochem. 1998; 69: 353-363Google Scholar, 35Sato M. Morii E. Komori T. Kawahata H. Sugimoto M. Terai K. Shimizu H. Yasui T. Ogihara H. Yasui N. Ochi T. Kitamura Y. Ito Y. Nomura S. Oncogene. 1998; 17: 1517-1525Google Scholar). The importance of Runx2 in expression of the bone-specific osteocalcin (OC) gene is well documented (36Javed A. Gutierrez S. Montecino M. van Wijnen A.J. Stein J.L. Stein G.S. Lian J.B. Mol. Cell. Biol. 1999; 19: 7491-7500Google Scholar, 37Frendo J.L. Xiao G. Fuchs S. Franceschi R.T. Karsenty G. Ducy P. J. Biol. Chem. 1998; 273: 30509-30516Google Scholar). Thus, Runx2 performs specialized functions during bone-tissue development and differentiation in vivo. However, it is noteworthy that osteoblast-specific transcription of osteocalcin occurs even in the absence of Runx sites in the rat OC promoter (38Hoffmann H.M. Beumer T.L. Rahman S. McCabe L.R. Banerjee C. Aslam F. Tiro J.A. van Wijnen A.J. Stein J.L. Stein G.S. Lian J.B. J. Cell. Biochem. 1996; 61: 310-324Google Scholar), suggesting a tissue-specific role for other regulatory factors in osteoblasts. Activation of tissue-specific genes is controlled by combinatorial mechanisms that rely on local features of the promoters, including organization of control elements in the target genes and/or the interplay between DNA-binding proteins and various transcriptional co-regulators (39Graves B.J. Science. 1998; 279: 1000-1002Google Scholar). Both C/EBPβ and Runx factors have been shown to cooperate with chromatin remodeling factors (p300, SWI/SNF) and other enhancer-binding proteins (40Kitabayashi I. Yokoyama A. Shimizu K. Ohki M. EMBO J. 1998; 17: 2994-3004Google Scholar, 41Kowenz-Leutz E. Leutz A. Mol. Cell. 1999; 4: 735-743Google Scholar). For example, Ets-1, c-Myb, Sp1, and C/EBP, together with Runx factors, stimulate the transcription of hematopoietic and osteogenic genes (13Zhang D.E. Hetherington C.J. Meyers S. Rhoades K.L. Larson C.J. Chen H.M. Hiebert S.W. Tenen D.G. Mol. Cell. Biol. 1996; 16: 1231-1240Google Scholar, 14Zhang D.E. Hohaus S. Voso M.T. Chen H.M. Smith L.T. Hetherington C.J. Tenen D.G. Curr. Top. Microbiol. Immunol. 1996; 211: 137-147Google Scholar, 23Petrovick M.S. Hiebert S.W. Friedman A.D. Hetherington C.J. Tenen D.G. Zhang D.E. Mol. Cell. Biol. 1998; 18: 3915-3925Google Scholar, 42Sun W. Graves B.J. Speck N.A. J. Virol. 1995; 69: 4941-4949Google Scholar, 43Zaiman A.L. Lenz J. J. Virol. 1996; 70: 5618-5629Google Scholar, 44Gu T.L. Goetz T.L. Graves B.J. Speck N.A. Mol. Cell. Biol. 2000; 20: 91-103Google Scholar), whereas PPARγ and Stat3 interactions with C/EBPα are driving forces for adipocyte differentiation (45Rosen E.D. Walkey C.J. Puigserver P. Spiegelman B.M. Genes Dev. 2000; 14: 1293-1307Crossref Google Scholar). Given these observations,i.e. the presence of both C/EBPβ and -δ and Runx2 in osteoblasts (29Banerjee C. McCabe L.R. Choi J.-Y. Hiebert S.W. Stein J.L. Stein G.S. Lian J.B. J. Cell. Biochem. 1997; 66: 1-8Google Scholar, 30Ducy P. Zhang R. Geoffroy V. Ridall A.L. Karsenty G. Cell. 1997; 89: 747-754Google Scholar, 46McCarthy T.L. Ji C. Chen Y. Kim K.K. Imagawa M. Ito Y. Centrella M. J. Biol. Chem. 2000; 275: 21746-21753Google Scholar) and C/EBPα-Runx1 protein-protein interactions in regulation of a hematopoietic specific gene (13Zhang D.E. Hetherington C.J. Meyers S. Rhoades K.L. Larson C.J. Chen H.M. Hiebert S.W. Tenen D.G. Mol. Cell. Biol. 1996; 16: 1231-1240Google Scholar), we addressed the possible role of C/EBP factors in osteoblasts and in the regulation of a bone-specific gene, osteocalcin. Here we report that C/EBPβ and -δ, but not -α, are developmentally expressed during osteoblast differentiation and are up-regulated in response to 1,25(OH)2 D3, a hormone that promotes osteoblast differentiation. We have identified a C/EBP-responsive regulatory element in the proximal promoter of the bone-specific osteocalcin gene. Deletion or mutation of this motif abrogates transcriptional enhancement by C/EBP factors. Furthermore, we provide the first demonstration that Runx2 and C/EBPβ physically interact and that C/EBP and Runx proteins act synergistically to activate the OC promoter. Importantly, this functional synergism is mediated through the C/EBP element. These findings establish for the first time a role of C/EBP in the regulation of an osteoblast-specific gene and define a novel mechanism for C/EBP in the regulation of cell type-specific gene transcription. Constructs containing the rat OC (−1097/+23 or −208/+23) promoter fused to the chloramphenicol acetyltransferase (CAT) gene have been described previously (47Banerjee C. Stein J.L. van Wijnen A.J. Frenkel B. Lian J.B. Stein G.S. Endocrinology. 1996; 137: 1991-2000Google Scholar). The −208 OC-CAT C/EBP mt plasmid, containing mutation of the C/EBP binding site in the −208 OC promoter (shown in lowercase) was generated by a PCR-based approach (48Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. John Wiley & Sons, New York1997: 8.5.1-8.5.9Google Scholar) with the following synthetic oligonucleotides: 5′-GGTTTGACCTAgactagtCATGACCCCCAA-3′, pUC/M13 reverse primer: 5′-TCACACAGGAAACAGCTATGAC-3′ (PCR 1), 5′-TTGGGGGTCATGactagtcTAGGTCAAACC-3′, pUC/M13 forward primer: 5′CGCCAGGGTTTTCCCAGTCACGAC 3′ (PCR 2), and −208 OC-CAT as template; this mutation introduced a unique site for theSpeI restriction enzyme. The PCR products were digested withBamHI-SpeI (PCR1) andApaI-SpeI (PCR2). A three-way ligation reaction was set using ApaI-BamHI-digested −208 OC-CAT as backbone. The −208 OC-CAT Runx mt plasmid was generated by digestion of the mC CAT plasmid (36Javed A. Gutierrez S. Montecino M. van Wijnen A.J. Stein J.L. Stein G.S. Lian J.B. Mol. Cell. Biol. 1999; 19: 7491-7500Google Scholar) with SphI-PpMU, followed by blunt ending and self-ligation. To generate the plasmid with mutations in both binding sites, two PCR reactions were set as above, but in this case −208 OC-CAT Runx mt was used as template. All plasmids were sequenced using the pUC/M13 forward primer. The expression constructs encoding the wild type Runx2 and Runx2 Δ361 are as reported previously (29Banerjee C. McCabe L.R. Choi J.-Y. Hiebert S.W. Stein J.L. Stein G.S. Lian J.B. J. Cell. Biochem. 1997; 66: 1-8Google Scholar,31Javed A. Barnes G.L. Jassanya B.O. Stein J.L. Gerstenfeld L. Lian J.B. Stein G.S. Mol. Cell. Biol. 2001; 21: 2891-2905Google Scholar). Runx2 Δ230 was prepared by PCR amplification of the coding sequences using the forward primer 5′-CGGGATCCATGCGTATTCC-3′ and a reverse primer with an engineered stop codon 5′-GGCTCGAGTCATTTAGAGTCATCAGGC-3′. Nonencoded nucleotides are underlined. The PCR fragment was digested with BamHI-XhoI and ligated to similarly digested pcDNA 3.1 His C vector (Invitrogen Inc., San Diego, CA). In-frame ligation of these constructs was confirmed by DNA sequencing. Expression constructs of C/EBPα, -β, and -δ were obtained from Dr. Alan Friedman (Johns Hopkins Hospital, Baltimore, MD). Normal rat diploid osteoblasts obtained from 21-day fetal rat calvariae were isolated and maintained as described (49Owen T.A. Aronow M. Shalhoub V. Barone L.M. Wilming L. Tassinari M.S. Kennedy M.B. Pockwinse S. Lian J.B. Stein G.S. J. Cell. Physiol. 1990; 143: 420-430Google Scholar). HeLa cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. Rat osteosarcoma (ROS 17/2.8) cells were grown in F-12 supplemented with 5% fetal calf serum. HeLa and ROS 17/2.8 cells plated in six-well plates were transiently transfected with 1–2.5 μg of OC promoter-CAT and 0.1–0.75 μg of cytomegalovirus empty vector, C/EBPβ, C/EBPδ, or Runx expression constructs. Cells were transfected using SuperFect transfection reagent as described previously (50Javed A. Guo B. Hiebert S. Choi J.-Y. Green J. Zhao S.-C. Osborne M.A. Stifani S. Stein J.L. Lian J.B. van Wijnen A.J. Stein G.S. J. Cell Sci. 2000; 113: 2221-2231Google Scholar). RSV-luciferase plasmid (100 ng) was included as an internal control for transfection efficiency. Cells were harvested 24–36 h after transfection and assayed for CAT activity. The data were normalized to luciferase values obtained from the same samples. Total cellular RNA was isolated from normal rat fetal calvarial osteoblasts or adult rat tissues as described previously (51Chomczynski P. Sacchi N. Anal. Biochem. 1987; 162: 156-159Google Scholar). Cells at different stages of differentiation were washed and scraped in phosphate-buffered saline. Frozen cell pellets from each time point were thawed and processed together. RNA pellets were briefly air-dried and dissolved in 400 μl of diethyl pyrocarbonate-treated water and stored at −70 °C until further usage. RNA samples from different stages of differentiation were electrophoresed in 1% formaldehyde-agarose gels and transferred to Hybond-N+membrane (Amersham Biosciences, Inc.) in 20× SSC. Blots were hybridized with random primed (Prime-It kit; Stratagene, La Jolla, CA),32P-labeled cDNA probes for C/EBPα (NcoI fragment), C/EBPβ (EcoRI-XhoI fragment), C/EBPδ (BamHI-EcoRI fragment), human glyceraldehyde-3-phosphate dehydrogenase (EcoRI-HindIII fragment), human histone H4 (HindIII-XbaI fragment of FO108), alkaline phosphatase (EcoRI fragment), Runx2 (BamHI-XbaI fragment), and rat OC (EcoRI-BamHI fragment) at 42 °C overnight. The blots were washed and subjected to autoradiography. Oligonucleotides spanning the C/EBP motif from the rat osteocalcin promoter (−117/-88) were synthesized: wild type, 5′-GGTTTGACCTATTGCGCACATGACCCCCAA-3′; and mutant, 5′-GGTTTGACCTAgactagtCATGACCCCCAA-3′. The C/EBP motif is shown in bold, and the mutated sequences in lowercase. Nuclear extracts from ROS 17/2.8, HeLa, and primary rat osteoblast cells at different stages of culture (days 7, 14, and 20) were prepared by a modified Dignam method (52Dignam J.D. Lebovitz R.M. Roeder R.G. Nucleic Acids Res. 1983; 11: 1475-1489Google Scholar) with 0.42 m KCl for extraction. ROS 17/2.8 and HeLa cells were plated in 100-mm plates at a density of 0.5 × 106. Cells were collected at 95% confluence by washing twice with ice-cold phosphate-buffered saline. The whole isolation procedure was carried out on ice. Cells from five plates were pooled into a 50-ml polypropylene tube and pelleted by centrifugation at 165 × g for 5 min at 4 °C. Cells were gently resuspended in 5–10 volumes of Nonidet P-40 lysis buffer (10 mm Tris, pH 7.4, 3 mm MgCl2, 10 mm NaCl, 0.5% Nonidet P-40) supplemented with 1× Complete™ protease inhibitor mixture (Roche Molecular Biochemicals) and incubated on ice for 20 min. Aliquots (25 μl) of the nuclear extracts were snap-frozen in liquid nitrogen and stored at −80 °C until further use. Protein concentration of nuclear extracts was determined by Bradford assay. A polyclonal Runx2-specific antibody (Oncogene Research Products, Boston, MA) was used in supershift assays. HeLa cells were transfected with Runx2 and C/EBPβ; ∼107 cells/immunoprecipitation were lysed in 800 μl of Nonidet P-40 buffer (150 mm NaCl, 50 mm Tris, pH 8.0, 1% Nonidet P-40, 1× Complete™ (Roche Molecular Biochemicals), 25 μm MG132 (Sigma-Aldrich)) and extracted at 4 °C for 15 min, followed by centrifugation at 16,000 × g for 15 min. The supernatant was transferred to a clean microcentrifuge tube and precleared with 20 μl of protein A/G Plus-agarose beads (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), at 4 °C for 30 min. The beads were collected by centrifugation at 1000 × g for 5 min at 4 °C. Xpress antibody (3 μg, Invitrogen Corp., Carlsbad, CA) was added to the precleared cell lysate followed by incubation at 4 °C for 1 h. To precipitate the immunocomplexes, 50 μl of protein A/G Plus-agarose beads were added and further incubated at 4 °C with agitation for 1 h. The beads were washed twice with 1 ml of washing buffer (20 mmTris, pH 8.3, 0.5% sodium deoxycholate, 0.5% Nonidet P-40, 50 mm NaCl, 2 mm EDTA, 1× Complete™ , 25 μm MG 132), suspended in 1× SDS sample buffer, and analyzed by Western blotting. Transfected or untransfected HeLa and ROS 17/2.8 cells cultured on 100-mm dishes were lysed on the plate by adding 300 μl of SDS lysis buffer (2% SDS, 10 mmdithiothreitol, 10% glycerol, 2 m urea, 1.0 mmphenylmethylsulfonyl fluoride, 10 mm Tris-HCl, pH 6.8, 0.002% bromphenol blue, 1× protease inhibitor mixture). Proteins (30–40 μg) were resolved in 10% SDS-PAGE and transferred to Trans-Blot membrane (Bio-Rad). Antibodies against C/EBPβ, C/EBPδ, and lamin B were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Epitope-tagged Runx proteins were detected by mouse monoclonal horseradish peroxidase-conjugated Xpress antibody (Invitrogen Corp., Carlsbad, CA). Monoclonal antisera for tubulin was purchased from Sigma-Aldrich. We initially assessed the expression of C/EBP factors in various bone tissues and during development of the osteoblast phenotype. Fig.1A shows that C/EBPβ and -δ mRNAs are present in calvarial tissue (lane 2) and in cortical and trabecular bone (data not shown) at levels similar to those in a representative soft tissue, muscle (lane 1). C/EBPα is not detected in bone tissue, consistent with its pivotal role for adipogenesis. Osteoblast markers (OC, Runx), which are not present in soft tissues, are shown for comparison. The abundance of C/EBPβ and -δ in bone prompted examination of expression of the C/EBP family members from growth to differentiation stages of osteoblasts in vitro, representing proliferation (days 3–5), matrix maturation (days 7–12), and the mineralization stage (days 19–22), reflected by peak levels of histone H4, alkaline phosphatase (ALP), and OC, respectively (Fig.1B). Both C/EBPβ and -δ mRNAs are detected from the growth to maturation stages and are expressed in a biphasic pattern. In contrast, C/EBPα expression is not detected at any stage of osteoblast differentiation, consistent with its absence in bone tissue. Two sizes of C/EBPβ mRNA are present with the larger species appearing more constitutive, whereas the smaller transcript is expressed during the growth period (days 3–5). The latter transcript is decreased markedly during the matrix maturation stage (days 7–12, when alkaline phosphatase-positive cells are forming nodules), followed by a 4–5-fold increase in expression concomitant with mineral deposition and peak levels of osteocalcin and Runx2 expression (Fig.1B). C/EBPδ mRNA is expressed in a manner similar to that for C/EBPβ, but the larger transcript is detected at very low levels. A significant (5-fold) temporal increase in C/EBPδ mRNA expression is observed during osteoblast differentiation from confluence (day 7) to the mature osteoblasts (day 22). Several Runx2 isoforms that result from utilization of alternative promoters and differential splicing are expressed (Fig. 1B). The increase in expression of the major Runx2 transcript during later stages of differentiation is consistent with increased Runx2 DNA binding activity in mature osteoblasts (29Banerjee C. McCabe L.R. Choi J.-Y. Hiebert S.W. Stein J.L. Stein G.S. Lian J.B. J. Cell. Biochem. 1997; 66: 1-8Google Scholar). Thus, the increases in C/EBPβ and C/EBPδ in the late stages of osteoblast differentiation appear to parallel peak expression levels for the osteoblast-related osteocalcin gene and the Runx2 transcription factor. We further assessed the relationship of C/EBP factors to osteoblast differentiation. Vitamin D3, a hormone that promotes osteoblast differentiation, is a known enhancer of many osteoblast-related genes (53Lian J.B. Stein G.S. Stein J.L. van Wijnen A.J. Litwack G. Vitamins and Hormones. Academic Press, San Diego1999: 443-509Google Scholar). Expression of C/EBPβ is stimulated by vitamin D3 at each stage of osteoblast maturation, 6-fold during growth (day 7) and nodule development (day 12) and 3-fold during mineralization (day 19). Vitamin D3-dependent enhancement of C/EBPδ is similar to that of C/EBPβ except the -fold stimulation is lower (3-fold at all stages). Treatment of cells with vitamin D3 has no effect on the expression of C/EBPα at any stage of differentiation (data not shown). The differentiation-promoting properties of vitamin D3 are reflected by the decrease in histone H4 and the increase in OC expression (Fig. 1C). Thus, expression of both C/EBPβ and C/EBPδ is strongly enhanced upon treatment with vitamin D3 in relation to osteoblast differentiation. Taken together, these data demonstrate that C/EBP transcription factors are expressed at significant levels in bone tissue, they increase during osteoblast differentiation in vitro, and their expression is up-regulated by 1,25(OH)2 D3. The enhanced expression of C/EBPβ and -δ during mineralization relative to the onset of OC transcription and in response to vitamin D3suggests that these C/EBP transcription factors may contribute to osteoblast-specific expression of the OC gene. Previous studies using promoter deletion constructs of the rat OC gene have shown that the initial 200 bp of the promoter can confer tissue-specific expression (38Hoffmann H.M. Beumer T.L. Rahman S. McCabe L.R. Banerjee C. Aslam F. Tiro J.A. van Wijnen A.J. Stein J.L. Stein G.S. Lian J.B. J. Cell. Biochem. 1996; 61: 310-324Google Scholar). This region contains a Runx-responsive motif and a homeodomain box that also binds an osteoblast-specific complex (54Hoffmann H. Green J. van Wijnen A.J. Stein J.L. Stein G.S. Lian J.B. J. Cell. Biochem. 2000; 80: 156-168Google Scholar). Sequence analysis of this region reveals the presence of a C/EBP motif (Fig.2A). To determine whether the C/EBP protein(s) can interact with this element, gel mobility shift analyses were performed using oligonucleotides (see “Materials and Methods”) containing either wild type or mutated C/EBP binding sequences (Fig. 2A). Using nuclear extracts from day 20 primary rat osteoblasts in which OC is actively expressed, we observed two major protein-DNA complexes (Fig. 2B). Specificity of these protein-DNA interactions was confirmed by oligonucleotide competition assays. Addition of unlabeled wild type oligonucleotide, but not mutant oligonucleotide, inhibited the binding of the protein complexes to the labeled probe (Fig. 2C). Taken together these results indicate that C/EBP proteins interact in a sequence-specific manner with their cognate element in the proximal promoter of the bone-specific rat OC gene. The presence of C/EBP in the protein complex binding to the OC promoter element suggests transcriptional regulation of the OC gene by C/EBP factors. This possibility was experimentally addressed by assessing the effect of forced expression of C/EBPβ and -δ on activity of full-length (−1.1 kb) and proximal (−208 bp) OC promoter-CAT reporter gene constructs in the osteoblastic ROS 17/2.8 cell line (Fig.3). The results indicate that C/EBPβ and -δ significantly enhance OC promoter activity, 4–5-fold o" @default.
• W2070793437 created "2016-06-24" @default.
• W2070793437 creator A5012717530 @default.
• W2070793437 creator A5019428735 @default.
• W2070793437 creator A5022825552 @default.
• W2070793437 creator A5026820070 @default.
• W2070793437 creator A5031362021 @default.
• W2070793437 creator A5063850442 @default.
• W2070793437 creator A5081119848 @default.
• W2070793437 date "2002-01-01" @default.
• W2070793437 modified "2023-10-17" @default.
• W2070793437 title "CCAAT/Enhancer-binding Proteins (C/EBP) β and δ Activate Osteocalcin Gene Transcription and Synergize with Runx2 at the C/EBP Element to Regulate Bone-specific Expression" @default.
• W2070793437 cites W1522814938 @default.
• W2070793437 cites W1553767259 @default.
• W2070793437 cites W1566477377 @default.
• W2070793437 cites W1592847642 @default.
• W2070793437 cites W1858277594 @default.
• W2070793437 cites W1917301047 @default.
• W2070793437 cites W1939477527 @default.
• W2070793437 cites W1980964148 @default.
• W2070793437 cites W1982721874 @default.
• W2070793437 cites W1983683479 @default.
• W2070793437 cites W1993243592 @default.
• W2070793437 cites W1994596418 @default.
• W2070793437 cites W1997812904 @default.
• W2070793437 cites W2006291181 @default.
• W2070793437 cites W2010544272 @default.
• W2070793437 cites W2010946184 @default.
• W2070793437 cites W2013714561 @default.
• W2070793437 cites W2020122207 @default.
• W2070793437 cites W2021031249 @default.
• W2070793437 cites W2022139382 @default.
• W2070793437 cites W2023865101 @default.
• W2070793437 cites W2025046506 @default.
• W2070793437 cites W2025545218 @default.
• W2070793437 cites W2038269021 @default.
• W2070793437 cites W2038423526 @default.
• W2070793437 cites W2039289863 @default.
• W2070793437 cites W2039635853 @default.
• W2070793437 cites W2039815077 @default.
• W2070793437 cites W2050259910 @default.
• W2070793437 cites W2051528622 @default.
• W2070793437 cites W2058226743 @default.
• W2070793437 cites W2059851539 @default.
• W2070793437 cites W2065383196 @default.
• W2070793437 cites W2075529268 @default.
• W2070793437 cites W2077150554 @default.
• W2070793437 cites W2078853769 @default.
• W2070793437 cites W2084358297 @default.
• W2070793437 cites W2085033687 @default.
• W2070793437 cites W2085425025 @default.
• W2070793437 cites W2088270188 @default.
• W2070793437 cites W2090941846 @default.
• W2070793437 cites W2102313291 @default.
• W2070793437 cites W2103012849 @default.
• W2070793437 cites W2114345210 @default.
• W2070793437 cites W2114948431 @default.
• W2070793437 cites W2122775430 @default.
• W2070793437 cites W2124515729 @default.
• W2070793437 cites W2125668148 @default.
• W2070793437 cites W2132309525 @default.
• W2070793437 cites W2134678935 @default.
• W2070793437 cites W2136002296 @default.
• W2070793437 cites W2136066768 @default.
• W2070793437 cites W2138483214 @default.
• W2070793437 cites W2159868431 @default.
• W2070793437 cites W2161848417 @default.
• W2070793437 cites W2164389880 @default.
• W2070793437 cites W2165787335 @default.
• W2070793437 cites W2169522866 @default.
• W2070793437 cites W4294216491 @default.
• W2070793437 doi "https://doi.org/10.1074/jbc.m106611200" @default.
• W2070793437 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11668178" @default.
• W2070793437 hasPublicationYear "2002" @default.
• W2070793437 type Work @default.
• W2070793437 sameAs 2070793437 @default.
• W2070793437 citedByCount "237" @default.
• W2070793437 countsByYear W20707934372012 @default.
• W2070793437 countsByYear W20707934372013 @default.
• W2070793437 countsByYear W20707934372014 @default.
• W2070793437 countsByYear W20707934372015 @default.
• W2070793437 countsByYear W20707934372016 @default.
• W2070793437 countsByYear W20707934372017 @default.
• W2070793437 countsByYear W20707934372018 @default.
• W2070793437 countsByYear W20707934372019 @default.
• W2070793437 countsByYear W20707934372020 @default.
• W2070793437 countsByYear W20707934372021 @default.
• W2070793437 countsByYear W20707934372022 @default.
• W2070793437 countsByYear W20707934372023 @default.
• W2070793437 crossrefType "journal-article" @default.
• W2070793437 hasAuthorship W2070793437A5012717530 @default.
• W2070793437 hasAuthorship W2070793437A5019428735 @default.
• W2070793437 hasAuthorship W2070793437A5022825552 @default.
• W2070793437 hasAuthorship W2070793437A5026820070 @default.
• W2070793437 hasAuthorship W2070793437A5031362021 @default.
• W2070793437 hasAuthorship W2070793437A5063850442 @default.
• W2070793437 hasAuthorship W2070793437A5081119848 @default.
• W2070793437 hasBestOaLocation W20707934371 @default.

• next