FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2071189076> ?p ?o ?g. }

• W2071189076 endingPage "10513" @default.
• W2071189076 startingPage "10505" @default.
• W2071189076 abstract "To examine the amino-terminal sequence requirements for cotranslational protein N-myristoylation, a series of site-directed mutagenesis of N-terminal region were performed using tumor necrosis factor as a nonmyristoylated model protein. Subsequently, the susceptibility of these mutants to protein N-myristoylation was evaluated by metabolic labeling in an in vitro translation system or in transfected cells. It was found that the amino acid residue at position 3 in an N-myristoylation consensus motif, Met-Gly-X-X-X-Ser-X-X-X, strongly affected the susceptibility of the protein to two different cotranslational protein modifications, N-myristoylation andN-acetylation; 10 amino acids (Ala, Ser, Cys, Thr, Val, Asn, Leu, Ile, Gln, and His) with a radius of gyration smaller than 1.80 Å directed N-myristoylation, two negatively charged residues (Asp and Glu) directed N-acetylation, and two amino acids (Gly and Met) directed heterogeneous modification with bothN-myristoylation and N-acetylation. The amino acid requirements at this position for the two modifications were dramatically changed when Ser at position 6 in the consensus motif was replaced with Ala. Thus, the amino acid residue penultimate to the N-terminal Gly residue strongly affected two cotranslational protein modifications, N-myristoylation andN-acetylation, and the amino acid requirements at this position for these two modifications were significantly affected by downstream residues. To examine the amino-terminal sequence requirements for cotranslational protein N-myristoylation, a series of site-directed mutagenesis of N-terminal region were performed using tumor necrosis factor as a nonmyristoylated model protein. Subsequently, the susceptibility of these mutants to protein N-myristoylation was evaluated by metabolic labeling in an in vitro translation system or in transfected cells. It was found that the amino acid residue at position 3 in an N-myristoylation consensus motif, Met-Gly-X-X-X-Ser-X-X-X, strongly affected the susceptibility of the protein to two different cotranslational protein modifications, N-myristoylation andN-acetylation; 10 amino acids (Ala, Ser, Cys, Thr, Val, Asn, Leu, Ile, Gln, and His) with a radius of gyration smaller than 1.80 Å directed N-myristoylation, two negatively charged residues (Asp and Glu) directed N-acetylation, and two amino acids (Gly and Met) directed heterogeneous modification with bothN-myristoylation and N-acetylation. The amino acid requirements at this position for the two modifications were dramatically changed when Ser at position 6 in the consensus motif was replaced with Ala. Thus, the amino acid residue penultimate to the N-terminal Gly residue strongly affected two cotranslational protein modifications, N-myristoylation andN-acetylation, and the amino acid requirements at this position for these two modifications were significantly affected by downstream residues. N-myristoyltransferase tumor necrosis factor polymerase chain reaction polyacrylamide gel electrophoresis A number of eukaryotic cellular proteins are found to be covalently modified with the 14-carbon saturated fatty acid, myristic acid (1Sefton B.M. Buss J.E. J. Cell Biol. 1987; 104: 1449-1453Crossref PubMed Scopus (190) Google Scholar, 2Towler D.A. Gordon J.I. Adams S.P. Glaser L. Annu. Rev. Biochem. 1988; 57: 69-99Crossref PubMed Google Scholar, 3Spiegel A.M. Backlund P.S. Butrynski J.E. Jones T.L.Z. Simonds W.F. Trends Biochem. Sci. 1991; 16: 338-341Abstract Full Text PDF PubMed Scopus (91) Google Scholar, 4Wedegaertner P.B. Wilson P.T. Bourne H.R. J. Biol. Chem. 1995; 270: 503-506Abstract Full Text Full Text PDF PubMed Scopus (394) Google Scholar, 5Boutin J.A. Cell Signal. 1997; 9: 15-35Crossref PubMed Scopus (352) Google Scholar, 6Resh M.D. Biochim. Biophys. Acta. 1999; 1451: 1-16Crossref PubMed Scopus (1079) Google Scholar). Many of the myristoylated proteins play key roles in regulating cellular structure and function. ProteinN-myristoylation is the result of the cotranslational addition of myristic acid to a Gly residue at the extreme N terminus after removal of the initiating Met. The requirement for Gly at the N terminus is absolute, and no other amino acid can take its place. A stable amide bond links myristic acid irreversibly to proteins. TheN-myristoyltransferase (NMT),1 which catalyzes the transfer of myristic acid from myristoyl-CoA to the N-terminal Gly has been purified and cloned from several organisms (7Towler D.A. Adams S.P. Eubanks S.R. Towery D.S. Jackson-Machelski E. Glaser L. Gordon J.I. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 2708-2712Crossref PubMed Scopus (170) Google Scholar, 8Duronio R.J. Reed S.I. Gordon J.I. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 4129-4133Crossref PubMed Scopus (110) Google Scholar, 9Lodge J.K. Johnson R.L. Weinberg R.A. Gordon J.I. J. Biol. Chem. 1994; 269: 2996-3009Abstract Full Text PDF PubMed Google Scholar, 10Giang D.K. Cravatt B.F. J. Biol. Chem. 1998; 273: 6595-6598Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar). The precise substrate specificity of this enzyme has been characterized using purified enzyme and synthetic peptide substrates (2Towler D.A. Gordon J.I. Adams S.P. Glaser L. Annu. Rev. Biochem. 1988; 57: 69-99Crossref PubMed Google Scholar, 11Towler D.A. Adams S.P. Eubanks S.R. Towery D.S. Jackson-Machelski E. Glaser L. Gordon J.I. J. Biol. Chem. 1988; 263: 1784-1790Abstract Full Text PDF PubMed Google Scholar, 12Rocque W.J. McWherter C.A. Wood D.C. Gordon J.I. J. Biol. Chem. 1993; 268: 9964-9971Abstract Full Text PDF PubMed Google Scholar). In general, Ser or Thr is preferred at position 6, and the N-terminal consensus motifs such as Met-Gly-X-X-X-Ser/Thr-X-X(13Johnson D.R. Bhatnagar R.S. Knoll L.J. Gordon J.I. Annu. Rev. Biochem. 1994; 63: 869-914Crossref PubMed Scopus (371) Google Scholar) or Met-Gly-X-X-X-Ser/Thr-X-X-X(5Boutin J.A. Cell Signal. 1997; 9: 15-35Crossref PubMed Scopus (352) Google Scholar) that direct protein N-myristoylation have been defined. However, Ser or Thr at position 6 is neither sufficient nor critical for the recognition of the protein substrate by the NMT. For instance, the peptide Gly-Gln-Ala-Ala-Ala-Ala-Lys-Lys derived from the N terminus of the cAMP-dependent protein kinase catalytic subunit was found to be a good substrate for the yeast NMT, and the peptide Gly-Gln-Ala-Ala-Ala-Ala-Arg-Arg was used as a reference substrate for the yeast NMT in earlier reports on the substrate specificity of this enzyme (7Towler D.A. Adams S.P. Eubanks S.R. Towery D.S. Jackson-Machelski E. Glaser L. Gordon J.I. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 2708-2712Crossref PubMed Scopus (170) Google Scholar, 14Heuckelroth R.O. Towler D.A. Adams S.P. Glaser L. Gordon J.I. J. Biol. Chem. 1988; 263: 2127-2133Abstract Full Text PDF PubMed Google Scholar). Some amino acid preferences were also reported at other positions such as 3, 7, and 8 (2Towler D.A. Gordon J.I. Adams S.P. Glaser L. Annu. Rev. Biochem. 1988; 57: 69-99Crossref PubMed Google Scholar, 15McWherter C.A. Rocque W.J. Zupec M.E. Freeman S.K. Brown D.L. Devadas B. Getman D.P. Sikorski J.A. Gordon J.I. J. Biol. Chem. 1997; 272: 11874-11880Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar); however, the precise amino acid requirements at these positions were not fully characterized. Protein N-myristoylation in intact cells is not a single enzymatic reaction catalyzed by NMT. This modification appears to be a highly regulated reaction involving the coordinated participation of the protein synthesis machinery (ribosomes) and several different enzymes/proteins such as N-methionylaminopeptidase, fatty acid synthase, long chain acyl-CoA synthetase, acyl-CoA-binding proteins, etc. Therefore, the substrate specificity of NMT analyzed by using purified NMT and synthetic peptide substrates may not fully reflect the substrate specificity of NMT in intact cells. In addition, other cotranslational protein modification such as proteinN-acetylation might also affect the reaction. It has been estimated that as many as 70% of soluble proteins (cytoplasmic or nucleoplasmic) in eukaryotes bear this modification (16Brown J.L. Biochim. Biophys. Acta. 1970; 221: 480-488Crossref PubMed Scopus (30) Google Scholar). In fact, several proteins having an N-terminal Gly residue, such as ovalbumin (17Palmiter R.D. Gagnon J. Walsh K.A. Proc. Natl. Acad. Sci. U. S. A. 1978; 75: 94-98Crossref PubMed Scopus (199) Google Scholar), cytochrome c (18Dailey T.A. Dailey H.A. Protein Sci. 1996; 5: 98-105Crossref PubMed Scopus (89) Google Scholar), and actin (19Mayer A. Siegel N.R. Schwartz A.L. Ciechanover A. Science. 1989; 244: 1480-1483Crossref PubMed Scopus (77) Google Scholar), were found to beN-acetylated. However, the difference in the N-terminal sequence requirement for protein N-myristoylation and protein N-acetylation has not been characterized so far. Since the in vitro translation system using rabbit reticulocyte lysate contains the components involved in cotranslational protein N-myristoylation and N-acetylation (17Palmiter R.D. Gagnon J. Walsh K.A. Proc. Natl. Acad. Sci. U. S. A. 1978; 75: 94-98Crossref PubMed Scopus (199) Google Scholar,19Mayer A. Siegel N.R. Schwartz A.L. Ciechanover A. Science. 1989; 244: 1480-1483Crossref PubMed Scopus (77) Google Scholar, 20Deichaite I. Casson L.P. Ling H.P. Resh M.D. Mol. Cell. Biol. 1988; 8: 4295-4301Crossref PubMed Scopus (82) Google Scholar), the use of this system to study cotranslational protein modification seems to be appropriate. In fact, we previously demonstrated that tumor necrosis factor (TNF), a nonmyristoylated model protein, could be efficiently myristoylated in the in vitrotranslation system when an N-myristoylation motif of Rasheed leukemia virus-Gag protein or Gi1α protein was linked to the mature domain of TNF (21Utsumi T. Kuranami J. Tou E. Ide A. Akimaru K. Hung M.C. Klostergaard J. Arch. Biochem. Biophys. 1996; 326: 179-184Crossref PubMed Scopus (15) Google Scholar, 22Utsumi T. Tou E. Takemura D. Ishisaka R. Yabuki M. Iwata H. Arch. Biochem. Biophys. 1998; 349: 216-224Crossref PubMed Scopus (8) Google Scholar). In this study, to examine the N-terminal sequence requirements for the cotranslational protein N-myristoylation and to reveal the difference in the N-terminal sequence requirements for proteinN-myristoylation and N-acetylation, several series of site-directed mutagenesis of the N-terminal region of protein were performed using TNF as a nonmyristoylated model protein. Subsequently, the susceptibility of these mutants to the cotranslational N-myristoylation andN-acetylation reactions was evaluated by an in vitro transcription/translation system using the rabbit reticulocyte lysate. Restriction endonucleases, DNA-modifying enzymes, RNase inhibitor, and Taq DNA polymerase were purchased from Takara Shuzo (Kyoto, Japan). The mCAP RNA capping kit and proteinase K were from Stratagene. RNase was purchased from Roche Molecular Biochemicals. Rabbit reticulocyte lysate was from Promega. [3H]leucine, [3H]myristic acid, [3H]acetyl-CoA, [35S]methionine, and Amplify were from Amersham Pharmacia Biotech. The Dye Terminator Cycle Sequencing kit was from Applied Biosystems. Anti-human TNF polyclonal antibody was purchased from R & D Systems. Protein G-Sepharose was from Amersham Pharmacia Biotech. Plasmid pET-22b-OVA, which contains the full-length chicken ovalbumin cDNA, was provided by Dr. Akio Kato (Yamaguchi University, Japan). Other reagents purchased from Wako Pure Chemical, Daiichi Pure Chemicals, and Seikagaku Kogyo (Japan) were of analytical or DNA grade. Plasmid pBluescript II SK(+) lackingApaI and HindIII sites was constructed as previously described (23Utsumi T. Akimaru K. Kawabata Z. Levitan A. Tokunaga T. Tang P. Ide A. Hung M.C. Klostergaard J. Mol. Cell. Biol. 1995; 15: 6389-6405Crossref Scopus (29) Google Scholar) and designated pB. Plasmid pBpro-TNF, which contains the full-length human pro-TNF cDNA, and plasmid pBΔpro-TNF, containing a cDNA coding for the mature domain of TNF, were constructed as described (21Utsumi T. Kuranami J. Tou E. Ide A. Akimaru K. Hung M.C. Klostergaard J. Arch. Biochem. Biophys. 1996; 326: 179-184Crossref PubMed Scopus (15) Google Scholar, 23Utsumi T. Akimaru K. Kawabata Z. Levitan A. Tokunaga T. Tang P. Ide A. Hung M.C. Klostergaard J. Mol. Cell. Biol. 1995; 15: 6389-6405Crossref Scopus (29) Google Scholar). Plasmid pBV2G-TNF was constructed by utilizing PCR. For this procedure, pBΔpro-TNF served as a template, and two oligonucleotides (V2G and B1) served as primers (Table I).Table INucleotide sequences of oligonucleotides used for the construction of mutant TNF cDNAsPrimerSequenceV2G5′-GCCGGGATCCATGGGCAGATCATCTTCTCG-3′R3GGCCGGGATCCATGGGCGGATCATCTTCTCGAACCR3AGCCGGGATCCATGGGCGCATCATCTTCTCGAACCCCGAGTR3SGCCGGGATCCATGGGCAGCTCATCTTCTCGAACCR3CGCCGGGATCCATGGGCTGCTCATCTTCTCGAACCCCGAGTR3TGCCGGGATCCATGGGCACATCATCTTCTCGAACCR3PGCCGGGATCCATGGGCCCATCATCTTCTCGAACCR3VGCCGGGATCCATGGGCGTATCATCTTCTCGAACCR3DGCCGGGATCCATGGGCGACTCATCTTCTCGAACCR3NGCCGGGATCCATGGGCAACTCATCTTCTCGAACCR3LGCCGGGATCCATGGGCCTATCATCTTCTCGAACCR3IGCCGGGATCCATGGGCATCTCATCTTCTCGAACCR3QGCCGGGATCCATGGGCCAATCATCTTCTCGAACCR3EGCCGGGATCCATGGGCGAATCATCTTCTCGAACCR3HGCCGGGATCCATGGGCCACTCATCTTCTCGAACCR3MGCCGGGATCCATGGGCATGTCATCTTCTCGAACCR3FGCCGGGATCCATGGGCTTTTCATCTTCTCGAACCR3KGCCGGGATCCATGGGCAAATCATCTTCTCGAACCR3YGCCGGGATCCATGGGCTACTCATCTTCTCGAACCR3WGCCGGGATCCATGGGCTGGTCATCTTCTCGAACCS6AATGCCTCGGGGTTCGAGCAGATGAT3AATTAACCCTCACTAAAGGGB1GCCGGGATCCTAGGGCGAATTGGGTACCOVA-NATATGGATCCATGGGCTCCATCGGCOVA-CGCGCGAATTCTTAAGGGGAAACACAOVA-60GCGCCTCGAGAAAGCGAACAACCTTGag-Q3KGCGCGGATCCATGGGAAAATCGCTAACAACCCCCGil-C3KATATGGATCCATGGGCAAAACGCTGAGCGCCGAGARF6GCGCGGATCCATGGGGAAGGTGCTATCCAAGATCTTCGGGGACAAGCCTGTAGCCHCGCGCGGATCCATGGGCAAGCAGAATAGCAAGCTGCGGCCAGACAAGCCTGTAGCC Open table in a new tab After digestion with BamHI and PstI, the amplified product was subcloned into pB at BamHI andPstI sites. The cDNAs coding for other TNF mutants (designated R3X-TNF), in which Arg at position 3 in V2G-TNF was replaced with each of the 19 other amino acids, were constructed by a method similar to that of V2G-TNF. The mutagenic primers used in these procedures are listed in Table I. Plasmids pBGag-TNF and pBGi1α-TNF were constructed as described previously (22Utsumi T. Tou E. Takemura D. Ishisaka R. Yabuki M. Iwata H. Arch. Biochem. Biophys. 1998; 349: 216-224Crossref PubMed Scopus (8) Google Scholar). Plasmid pBOVA, which contains the full-length chicken ovalbumin cDNA was constructed by using PCR. In this case, pET-22b-OVA served as a template, and two oligonucleotides (OVA-N and OVA-C) served as primers (Table I). After digestion with BamHI andEcoRI, the amplified product was subcloned into pB atBamHI and EcoRI sites. The cDNA coding for OVA60-TNF in which the N-terminal 60 residues of ovalbumin were linked to the N terminus of the mature domain of TNF was constructed by using PCR. For this procedure, pBOVA served as a template, and two oligonucleotides (OVA-N and OVA-60) served as primers (Table I). After digestion with BamHI and XhoI, the amplified product was subcloned into pBGag-TNF at BamHI andXhoI sites. The cDNAs coding for R3X,S6A-TNF in which Ser at position 6 in R3X-TNF mutants was replaced with Ala, were constructed by using PCR. In this case, each of the pBR3X-TNF constructs served as a template, and two oligonucleotides (T3 and S6A) served as primers (Table I). After digestion with SacI andAvaI, the amplified product was subcloned into pBΔpro-TNF at SacI and AvaI sites. The cDNAs coding for Gag-Q3K-TNF and Gi1α-C3K-TNF in which the amino acid at position 3 in Gag-TNF or Gi1α-TNF was replaced with Lys were constructed by using PCR. In this case, pBGag-TNF or pBGi1α-TNF served as a template, and two oligonucleotides (Gag-Q3K plus B1 and Gi1-C3K plus B1, respectively) as primers (Table I). After digestion with BamHI and PstI, the amplified products were subcloned into pB at BamHI andPstI sites. The cDNAs coding for Arf6-TNF and hippocalcin-TNF, in which the N-terminal 10 residues of Δpro-TNF were replaced with those of Arf6 or hippocalcin, were constructed by using PCR. For this procedure, pBΔpro-TNF served as a template, and two oligonucleotides (Arf6 plus B1 and HC plus B1, respectively) served as primers (Table I). After digestion with BamHI andPstI, the amplified products were subcloned into pB atBamHI and PstI sites. The DNA sequences of these recombinant cDNAs were confirmed by the dideoxynucleotide chain termination method (24Sanger F. Nickelen S. Coulson A.R. Proc. Natl. Acad. Sci. U. S. A. 1977; 74: 5463-5467Crossref PubMed Scopus (52668) Google Scholar). Methods essentially identical to those described previously were employed (23Utsumi T. Akimaru K. Kawabata Z. Levitan A. Tokunaga T. Tang P. Ide A. Hung M.C. Klostergaard J. Mol. Cell. Biol. 1995; 15: 6389-6405Crossref Scopus (29) Google Scholar). T3 polymerase was used to obtain transcripts of these cDNAs subcloned into pB vector. These were purified by phenol/chloroform extraction and ethanol precipitation prior to use. Subsequently, the translation reaction was carried out using the rabbit reticulocyte lysate (Promega) in the presence of [3H]leucine, [35S]methionine, [3H]myristic acid, or [3H]acetyl-CoA under conditions recommended by the manufacturer. The mixture (composed of 20.0 μl of rabbit reticulocyte lysate; 1.0 μl of 1 mm leucine- or methionine-free amino acid mixture or 1 mm complete amino acid mixture; 4.0 μl of [3H]leucine (5 μCi), [35S]methionine (1 μCi), [3H]myristic acid (25 μCi), or [3H]acetyl-CoA (2 μCi); and 4.0 μl of mRNA) was incubated at 30 °C for 90 min. The simian virus 40-transformed African Green monkey kidney cell line, COS-1, was maintained in Dulbecco's modified Eagle's medium (Life Technologies, Inc.) supplemented with 10% fetal calf serum (Life Technologies, Inc.). Cells (2 × 105) were plated onto 35-mm diameter dishes 1 day before transfection. pcDNA3 construct (2 μg; Invitrogen, San Diego, CA) containing mutant TNF cDNA was used to transfect each plate of COS-1 cells along with 4 μl of LipofectAMINE (2 mg/ml; Life Technologies, Inc.) in 1 ml of serum-free medium. After incubation for 5 h at 37 °C, the cells were refed with serum-containing medium and incubated again at 37 °C for 24 h. The cells were then washed twice with 1 ml of serum-free Dulbecco's modified Eagle's medium and incubated for 5 h in 1 ml of Dulbecco's modified Eagle's medium with 2% fetal calf serum containing [3H]myristic acid (100 μCi/ml). Subsequently, the cells were washed three times with Dulbecco's phosphate-buffered saline and collected with cell scrapers, followed by lysis with 200 μl of radioimmune precipitation buffer (50 mm Tris-HCl (pH 7.5), 150 mm NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, proteinase inhibitors) on ice for 20 min. The cell lysates were centrifuged at 15,000 rpm at 4 °C for 15 min in a microcentrifuge (Hitachi; model CF15D2), and supernatants were collected. After immunoprecipitation with anti-TNF antibody, the samples were analyzed by SDS-PAGE and fluorography. TNF samples immunoprecipitated fromin vitro translation products or total cell lysates of each group of transfected cells were resolved by 12.5% SDS-PAGE and then transferred to an Immobilon-P transfer membrane (Millipore, Corp.). After blocking with nonfat milk, the membrane was probed with a specific goat anti-human TNF antibody as described previously (25Utsumi T. Levitan A. Hung M.C. Klostergaard J. J. Biol. Chem. 1993; 268: 9511-9516Abstract Full Text PDF PubMed Google Scholar). Immunoreactive proteins were specifically detected by incubation with horseradish peroxidase-conjugated anti-goat IgG antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). The membrane was developed with ECL Western blotting reagent (Amersham Pharmacia Biotech) and exposed to an x-ray film (Eastman Kodak Co.). Quantitative analysis of immunoreactive proteins on the membrane was carried out using the storage phosphor imaging screen and GS-250 Molecular Imager (Bio-Rad). Samples containing TNF mutants were immunoprecipitated with a specific goat anti-human TNF polyclonal antibody (R & D systems) as described (23Utsumi T. Akimaru K. Kawabata Z. Levitan A. Tokunaga T. Tang P. Ide A. Hung M.C. Klostergaard J. Mol. Cell. Biol. 1995; 15: 6389-6405Crossref Scopus (29) Google Scholar). Samples were denatured by boiling for 3 min in SDS-sample buffer followed by analysis by SDS-PAGE on a 12.5% gel. Thereafter, the gel was fixed and soaked in AmplifyTM (Amersham Pharmacia Biotech) for 30 min. The gel was dried under vacuum and exposed to an x-ray film (Kodak) for an appropriate period. Quantitative analysis of the labeled proteins was carried out by scanning the fluorogram using an imaging densitometer (Bio-Rad; model GS-700). Fatty acid-labeled TNF mutants immunoprecipitated from in vitro translation products were resolved by 12.5% SDS-PAGE and then transferred to an Immobilon-P transfer membrane. The region of membrane containing the labeled TNF mutant, identified by Western blotting with anti-human TNF antibody, was excised and hydrolyzed in 6 n HCl at 110 °C for 16 h. The released fatty acids were extracted in hexane and run on a thin-layer chromatography plate (RP18; Merck) with acetonitrile/acetic acid (9:1) as the solvent system. Radioactivity on the thin layer plate was made visible by spraying with En3Hance (PerkinElmer Life Sciences). To examine the amino-terminal sequence requirements for cotranslational protein N-myristoylation, and to reveal the difference in the N-terminal sequence requirement for proteinN-myristoylation and N-acetylation, the N-terminal 9 residues of the mature domain of TNF including the initiating Met were changed to the N-myristoylation consensus motif, and the susceptibility to cotranslational proteinN-myristoylation and N-acetylation was evaluated by an in vitro translation system. Since Δpro-TNF, a mature domain of TNF in which the initiating Met was introduced at the N terminus, has Met and Ser residues at positions 1 and 6, respectively, Val at position 2 was replaced with Gly to obtain V2G-TNF, in which the N-terminal 9 residues were adapted to theN-myristoylation consensus motif, Met-Gly-X-X-X-Ser-X-X-X(Fig. 1). As shown in Fig. 2 (lanes 1 and 2), translation of mRNAs coding for Δpro-TNF and V2G-TNF in the presence of [3H]leucine gave rise to two translation products; one is the major product with an expected molecular mass (17 kDa), and the other is a fainter band with an ∼2-kDa larger molecular mass. However, no incorporation of [3H]myristic acid and [3H]acetyl-CoA was detected in these translation products as shown in Fig. 2(lanes 5, 6, 9, and10). From early experiments performed by Towler et al. (2Towler D.A. Gordon J.I. Adams S.P. Glaser L. Annu. Rev. Biochem. 1988; 57: 69-99Crossref PubMed Google Scholar) using purified yeast NMT and the synthetic peptide substrates, it has been reported that an amino acid residue at position 3 affects the susceptibility to protein N-myristoylation. We therefore prepared two additional constructs, R3A- and R3D-TNF, in which Arg at position 3 in V2G-TNF was replaced with Ala and Asp, respectively. [3H]Leucine labeling revealed an efficient expression of R3A- and R3D-TNF as observed with V2G-TNF (Fig. 2, lanes 3 and 4). In R3A-TNF, significant incorporation of [3H]myristic acid, but not [3H]acetyl-CoA, was observed (lanes 7 and 11). Conversely, significant incorporation of [3H]acetyl-CoA, but not [3H]myristic acid, was observed with R3D-TNF (lanes 8 and12). To determine whether the incorporation of [3H]myristic acid into R3A-TNF was comparable with that into proteins having a natural N-myristoylation motif, incorporation of [3H]leucine and [3H]myristic acid into R3A-TNF was compared with those into Gag-TNF and Gi1α-TNF (22Utsumi T. Tou E. Takemura D. Ishisaka R. Yabuki M. Iwata H. Arch. Biochem. Biophys. 1998; 349: 216-224Crossref PubMed Scopus (8) Google Scholar) in which the N-terminal 10 residues of the Gag protein or Gi1α were linked to the N terminus of the mature domain of TNF. As shown in Fig. 3 A(lanes 1–3 and 7–9), incorporations of [3H]leucine and [3H]myristic acid into these three TNF mutants were found to be comparable, indicating that R3A-TNF is efficiently myristoylated, similar to proteins having a natural N-myristoylation motif. Next, we compared the incorporation of [3H]acetyl-CoA into R3D-TNF with that into ovalbumin, a naturally acetylated protein (17Palmiter R.D. Gagnon J. Walsh K.A. Proc. Natl. Acad. Sci. U. S. A. 1978; 75: 94-98Crossref PubMed Scopus (199) Google Scholar). In this case, since specific antibody against ovalbumin was not available for the immunoprecipitation of the in vitro translated products, OVA60-TNF, in which the N-terminal 60 residues of ovalbumin were linked to the N terminus of TNF, was used. As expected, only a low level of [3H]leucine- and [3H]acetyl-CoA incorporation was observed with ovalbumin, as shown in Fig.3 A (lanes 6 and 18). In contrast, efficient [3H]leucine- and [3H]acetyl-CoA incorporation was detected with OVA60-TNF (lanes 5 and 17). As shown in Fig.3 A (lanes 4, 5,16, and 17), incorporation of [3H]leucine and [3H]acetyl-CoA into R3D-TNF was comparable with those of OVA60-TNF, indicating that R3D-TNF is as efficiently acetylated as the naturally acetylated protein. Analysis of the 3H-labeled fatty acid attached to the R3A-TNF by TLC confirmed the presence of [3H]myristic acid (Fig.3 B, lane 3). In contrast,3H-labeled fatty acid attached to the R3D-TNF was not detected on the TLC plate (lane 4). However, acetic acid liberated from the acetylated protein is volatile and will be evaporated by the extraction and concentration procedure. Therefore, this result is consistent with the fatty acid attached to the R3D-TNF being acetic acid. Taken together, it is suggested that the amino acid residue at position 3 in the Met-Gly-X-X-X-Ser-X-X-Xmotif strongly affects the susceptibility of the protein to two different cotranslational protein modifications,N-myristoylation and N-acetylation. As shown in Fig. 2 (lanes 3, 4,7, and 12), protein N-myristoylation and N-acetylation were specifically observed in the lower [3H]leucine-labeled band, with no modification of the upper band observed. To clarify the basis for this, differential labeling of these two protein bands with [3H]leucine, [35S]methionine, [3H]myristic acid, and [3H]acetyl-CoA was performed using Δpro-, R3A-, and R3D-TNF mRNA. In these three TNF variants, the initiating Met is the only Met residue in the entire molecule; in contrast, these TNFs contain several residues of Leu in their amino acid sequences. As shown in Fig. 4, [35S]methionine was specifically incorporated into the upper band, whereas [3H]leucine was incorporated into both bands. Incorporation of [3H]myristic acid into R3A-TNF and [3H]acetyl-CoA into R3D-TNF was observed exclusively in the lower band. Since protein N-myristoylation and proteinN-acetylation occurs on Gly-2 after removal of the initiating Met and there is no Met residue in the mature domain of TNF, these results clearly indicated that the upper band corresponds to the protein species retaining the initiating Met residue and the lower band to the one lacking this residue. To investigate the amino acid requirement at position 3 in the Met-Gly-X-X-X-Ser-X-X-Xmotif for protein N-myristoylation andN-acetylation, 20 mutants, each with a different amino acid at position 3, were generated, and their susceptibility to the two cotranslational modifications was evaluated by the same method as above. The results of 20 amino acids are arranged according to their radius of gyration. All of these mutants were efficiently expressed as determined by the incorporation of [3H]leucine as shown in the upper panels of Fig.5 A. The ratio of the amount of the two [3H]leucine-labeled protein bands was almost the same in these 20 mutants, indicating that there is no significant difference in the efficiency of the removal of the initiating Met residue in these mutants. The labeling with [3H]myristic acid revealed a strong correlation between the radius of gyration of the amino acid at position 3 and the efficiency of protein N-myristoylation as shown in the lower panels of Fig. 5 A. The relationship between the relative N-myristoylation efficiency and the radius of gyration of amino acid at position 3 is summarized in Fig. 5 B. The presence of Gly, Ala, Ser, Cys, Thr, Val, Asn, Leu, Ile, Gln, and His residues, each having a radius of gyration smaller than 1.80 Å, at position 3 led to efficient [3H]myristic acid labeling. In contrast, the presence of amino acids with a radius of gyration larger than 1.80 Å (Phe, Lys, Tyr, Trp, and Arg) at this position completely inhibited the [3H]myristic acid incorporation. The presence of the Met residue, which has an intermediate radius of gyration (1.80 Å) led to a diminished efficiency of N-myristoylation. In addition to the restriction by the radius of gyration of the amino acid, it was also revealed that the presence of negatively charged residues (Asp and Glu) and Pro residue at this position completely inhibited the myristoylation reaction. Labeling of these TNF mutants with [3H]acetyl-CoA revealed that nonmyristoylated mutants with Asp or Glu at position 3 and a weakly myristoylated mutant having Met at this position were efficiently acetylated as shown in thelower panels of Fig.6 A. In addition, a low level of [3H]acetyl-CoA incorporation was observed with an effectively myristoylated mutant having Gly at position 3. These results indicate that the amino acid at position 3 in the Met-Gly-X-X-X-Ser-X-X-Xmotif affected differently the two cotranslational protein modifications, N-myristoylation andN-acetylation. It is generally accepted that Ser or Thr is preferred at position" @default.
• W2071189076 created "2016-06-24" @default.
• W2071189076 creator A5046088871 @default.
• W2071189076 creator A5049763192 @default.
• W2071189076 creator A5055981066 @default.
• W2071189076 creator A5072932089 @default.
• W2071189076 creator A5089190393 @default.
• W2071189076 creator A5091037671 @default.
• W2071189076 date "2001-03-01" @default.
• W2071189076 modified "2023-09-30" @default.
• W2071189076 title "Amino Acid Residue Penultimate to the Amino-terminal Gly Residue Strongly Affects Two Cotranslational Protein Modifications, N-Myristoylation andN-Acetylation" @default.
• W2071189076 cites W1483915131 @default.
• W2071189076 cites W1493816947 @default.
• W2071189076 cites W1525267478 @default.
• W2071189076 cites W1550302286 @default.
• W2071189076 cites W1561271179 @default.
• W2071189076 cites W1566158288 @default.
• W2071189076 cites W158285355 @default.
• W2071189076 cites W1595079401 @default.
• W2071189076 cites W1596416606 @default.
• W2071189076 cites W1604402321 @default.
• W2071189076 cites W1966998035 @default.
• W2071189076 cites W1987779068 @default.
• W2071189076 cites W1989095706 @default.
• W2071189076 cites W1999503975 @default.
• W2071189076 cites W1999599493 @default.
• W2071189076 cites W2010439047 @default.
• W2071189076 cites W2023332407 @default.
• W2071189076 cites W2025636361 @default.
• W2071189076 cites W2030202169 @default.
• W2071189076 cites W2036842366 @default.
• W2071189076 cites W2037275527 @default.
• W2071189076 cites W2040380764 @default.
• W2071189076 cites W2040812386 @default.
• W2071189076 cites W2045703352 @default.
• W2071189076 cites W2066014937 @default.
• W2071189076 cites W2066999587 @default.
• W2071189076 cites W2072651877 @default.
• W2071189076 cites W2073869452 @default.
• W2071189076 cites W2077852367 @default.
• W2071189076 cites W2104901736 @default.
• W2071189076 cites W2107781889 @default.
• W2071189076 cites W2130091680 @default.
• W2071189076 cites W2138270253 @default.
• W2071189076 cites W2160809286 @default.
• W2071189076 cites W2162692258 @default.
• W2071189076 cites W4211055277 @default.
• W2071189076 doi "https://doi.org/10.1074/jbc.m006134200" @default.
• W2071189076 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11124252" @default.
• W2071189076 hasPublicationYear "2001" @default.
• W2071189076 type Work @default.
• W2071189076 sameAs 2071189076 @default.
• W2071189076 citedByCount "69" @default.
• W2071189076 countsByYear W20711890762012 @default.
• W2071189076 countsByYear W20711890762013 @default.
• W2071189076 countsByYear W20711890762014 @default.
• W2071189076 countsByYear W20711890762015 @default.
• W2071189076 countsByYear W20711890762016 @default.
• W2071189076 countsByYear W20711890762017 @default.
• W2071189076 countsByYear W20711890762018 @default.
• W2071189076 countsByYear W20711890762019 @default.
• W2071189076 countsByYear W20711890762020 @default.
• W2071189076 countsByYear W20711890762021 @default.
• W2071189076 crossrefType "journal-article" @default.
• W2071189076 hasAuthorship W2071189076A5046088871 @default.
• W2071189076 hasAuthorship W2071189076A5049763192 @default.
• W2071189076 hasAuthorship W2071189076A5055981066 @default.
• W2071189076 hasAuthorship W2071189076A5072932089 @default.
• W2071189076 hasAuthorship W2071189076A5089190393 @default.
• W2071189076 hasAuthorship W2071189076A5091037671 @default.
• W2071189076 hasBestOaLocation W20711890761 @default.
• W2071189076 hasConcept C104317684 @default.
• W2071189076 hasConcept C119157956 @default.
• W2071189076 hasConcept C11960822 @default.
• W2071189076 hasConcept C167625842 @default.
• W2071189076 hasConcept C185592680 @default.
• W2071189076 hasConcept C2781338088 @default.
• W2071189076 hasConcept C2994376932 @default.
• W2071189076 hasConcept C515207424 @default.
• W2071189076 hasConcept C55493867 @default.
• W2071189076 hasConcept C71240020 @default.
• W2071189076 hasConcept C77207865 @default.
• W2071189076 hasConceptScore W2071189076C104317684 @default.
• W2071189076 hasConceptScore W2071189076C119157956 @default.
• W2071189076 hasConceptScore W2071189076C11960822 @default.
• W2071189076 hasConceptScore W2071189076C167625842 @default.
• W2071189076 hasConceptScore W2071189076C185592680 @default.
• W2071189076 hasConceptScore W2071189076C2781338088 @default.
• W2071189076 hasConceptScore W2071189076C2994376932 @default.
• W2071189076 hasConceptScore W2071189076C515207424 @default.
• W2071189076 hasConceptScore W2071189076C55493867 @default.
• W2071189076 hasConceptScore W2071189076C71240020 @default.
• W2071189076 hasConceptScore W2071189076C77207865 @default.
• W2071189076 hasIssue "13" @default.
• W2071189076 hasLocation W20711890761 @default.
• W2071189076 hasOpenAccess W2071189076 @default.
• W2071189076 hasPrimaryLocation W20711890761 @default.
• W2071189076 hasRelatedWork W1989778206 @default.

• next