FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2072034951> ?p ?o ?g. }

• W2072034951 endingPage "42574" @default.
• W2072034951 startingPage "42565" @default.
• W2072034951 abstract "The Pax-5 gene plays a central role in B cell development, activation, and differentiation. At least four different isoforms have been identified, of which isoform Pax-5a has been extensively studied, while functions for alternative isoforms were previously unknown. Here, using a transient transfection system, we provide evidence that alternative isoform Pax-5d acts as a dominant-negative regulator by suppressing activity of Pax-5a in a dose-dependent manner. In contrast, co-expression in the presence of alternative isoform Pax-5e causes an increase in Pax-5a activity. Protein studies on Pax-5e using Western blot analysis revealed that this 19-kDa isoform migrates as a 27-kDa species on SDS-polyacrylamide electrophoresis gels, while a mutant Pax-5e form in which a C-terminal cysteine residue has been mutated, runs at the expected 19 kDa. Using both Western blot and immunoprecipitation assays, we further provide evidence that this size discrepancy may be caused by a tight association between Pax-5e and a thioredoxin-like factor. Comparison of various B cell lines as well as resting and lipopolysaccharide-activated mature B lymphocytes shows that increased B cell proliferation correlates with increased levels of Pax-5e/thioredoxin, whereas increased Pax-5d amounts correlate with inhibition of cell growth. Together, our results suggest that during activation and differentiation of B lymphocytes, Pax-5a function is modulated by two alternative spliced isoforms: the dominant negative Pax-5d isoform may mediate inhibition of Pax-5a activity in resting B cells, while alternative isoform Pax-5e associated with thioredoxin may increase Pax-5a activity through an unknown (redox) mechanism. The Pax-5 gene plays a central role in B cell development, activation, and differentiation. At least four different isoforms have been identified, of which isoform Pax-5a has been extensively studied, while functions for alternative isoforms were previously unknown. Here, using a transient transfection system, we provide evidence that alternative isoform Pax-5d acts as a dominant-negative regulator by suppressing activity of Pax-5a in a dose-dependent manner. In contrast, co-expression in the presence of alternative isoform Pax-5e causes an increase in Pax-5a activity. Protein studies on Pax-5e using Western blot analysis revealed that this 19-kDa isoform migrates as a 27-kDa species on SDS-polyacrylamide electrophoresis gels, while a mutant Pax-5e form in which a C-terminal cysteine residue has been mutated, runs at the expected 19 kDa. Using both Western blot and immunoprecipitation assays, we further provide evidence that this size discrepancy may be caused by a tight association between Pax-5e and a thioredoxin-like factor. Comparison of various B cell lines as well as resting and lipopolysaccharide-activated mature B lymphocytes shows that increased B cell proliferation correlates with increased levels of Pax-5e/thioredoxin, whereas increased Pax-5d amounts correlate with inhibition of cell growth. Together, our results suggest that during activation and differentiation of B lymphocytes, Pax-5a function is modulated by two alternative spliced isoforms: the dominant negative Pax-5d isoform may mediate inhibition of Pax-5a activity in resting B cells, while alternative isoform Pax-5e associated with thioredoxin may increase Pax-5a activity through an unknown (redox) mechanism. nucleotide(s) chloramphenicol acetyltransferase reverse transcriptase-polymerase chain reaction small resting B cells lipopolysaccharide monoclonal antibody thioredoxin bovine serum albumin B-cell specific activator protein electrophoretic mobility shift assay amino acid(s) polyacrylamide gel electrophoresis B lymphocytes are the major players of the humoral immune system and are essential to the detection and elimination of pathogens. Spatial and temporal gene expression of B cell-specific transcription factors largely determines the maturation and activation pathways in a B cell, and is a tightly regulated process. A number of transcription factors have now been identified as essential for B cell development and activation (reviewed in Refs. 1Reya T. Grosschedl R. Curr. Opin. Immunol. 1998; 10: 158-165Crossref PubMed Scopus (60) Google Scholar and 2Liberg D. Sigvardsson M. Curr. Rev. Immunol. 1999; 19: 127-153PubMed Google Scholar), including one of the products encoded by the Pax-5 gene, the B-cell specific activator protein (BSAP). Pax-5 expression is first detected in the developing central nervous system (3Adams B. Dorfler P. Agguzi A. Kozmik P. Urbanek P. Maurer-Fogy I. Busslinger M. Genes Dev. 1992; 6: 1589-1607Crossref PubMed Scopus (468) Google Scholar, 4Asano M. Gruss P. Mech. Dev. 1991; 39: 29-39Crossref Scopus (93) Google Scholar). After birth and throughout life, Pax-5 transcripts are found in cells of the B-lymphoid lineage and in testis of the adult mouse (3Adams B. Dorfler P. Agguzi A. Kozmik P. Urbanek P. Maurer-Fogy I. Busslinger M. Genes Dev. 1992; 6: 1589-1607Crossref PubMed Scopus (468) Google Scholar). Within the B cell lineage, Pax-5 is expressed during early stages of B cell development up to the mature B-cell, but is greatly down-regulated or absent in plasma cells (5Barberis A. Widenhorn K. Vitelli L. Busslinger M. Genes Dev. 1990; 22: 37-43Google Scholar). Inactivation of the Pax-5gene in mouse results in a complete block of B cell development at the pro-B cell stage, revealing the essential role of this gene in early B cell lymphopoiesis (6Urbanek P. Wang Z.Q. Fetka I. Wagner E.F. Busslinger M. Cell. 1994; 79: 901-912Abstract Full Text PDF PubMed Scopus (680) Google Scholar). Pax-5-binding sites have been identified on the promoters of a number of B cell-specific genes (reviewed in Ref. 7Hagman J. Wheat W. Fitszimmons D. Hodson W. Negri J. Dizon F. Curr. Top. Microbiol. Immunol. 2000; 245: 169-194PubMed Google Scholar). Among the positively regulated Pax-5 targets are genes encoding the CD19 co-stimulatory receptor (8Kozmik Z. Wang S. Dörfler P. Adams B. Busslinger M. Mol. Cell. Biol. 1992; 12: 2662-2672Crossref PubMed Scopus (293) Google Scholar) and the protein-tyrosine kinase Blk (9Zwollo P. Desiderio S.V. J. Biol. Chem. 1994; 269: 15310-15317Abstract Full Text PDF PubMed Google Scholar). Pax-5 functions as a repressor for the immunoglobulin J chain and the Ig 3′α enhancer (10Rinkenberger J.L. Wallin J.J. Johnson K.W. Koshland M.E. Immunity. 1996; 5: 377-386Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar, 11Singh M. Birshtein B.K. Mol. Cell. Biol. 1993; 13: 3611-3622Crossref PubMed Google Scholar, 12Neurath M.F. Strober W. Wakatsuki Y. J. Immunol. 1994; 153: 730-742PubMed Google Scholar). In addition to its role in B-lymphopoiesis, Pax-5 has been implicated in activation and proliferation of B lymphocytes since its decreased expression resulted in reduced numbers of cells post-activation (13Wakatsuki Y. Neurath M. Max E.E. Strober W. J. Exp. Med. 1994; 179: 1099-1108Crossref PubMed Scopus (133) Google Scholar). Recent reports by Tell et al. (14Tell G. Scaloni A. Pellizari L. Formisano S Pucillo C. Damante G. J. Biol. Chem. 1998; 273: 25062-25072Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar, 15Tell G. Zecca A. Pellizzari L. Spessotto P. Colombatti A. Kelley M.R. Damanter G. Pucillo C. Nucleic Acids Res. 2000; 28: 1099-1105Crossref PubMed Scopus (99) Google Scholar) provide evidence that Pax-5a activity is regulated through a redox mechanism that involves Ref-1. The authors show that an oxidized form of Pax-5a is unable to interact with DNA, whereas the reduced form binds strongly, and that an intramolecular disulfide bond within the paired domain of Pax-5a causes interference with specific DNA binding (14Tell G. Scaloni A. Pellizari L. Formisano S Pucillo C. Damante G. J. Biol. Chem. 1998; 273: 25062-25072Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar). Furthermore, exposure of B cells to H2O2 results in rapid transfer of the cytoplasmic redox factor Ref-1 into the nucleus and this correlates with an increase in Pax-5 binding activity (15Tell G. Zecca A. Pellizzari L. Spessotto P. Colombatti A. Kelley M.R. Damanter G. Pucillo C. Nucleic Acids Res. 2000; 28: 1099-1105Crossref PubMed Scopus (99) Google Scholar). The Pax-5 gene produces four isoforms as a result of alternative splicing: Pax-5a (full-length Pax-5 or BSAP),Pax-5b, Pax-5d, and Pax-5e (16Zwollo P. Arrieta H. Ede K. Molinder K. Desiderio S. Pollock R. J. Biol. Chem. 1997; 272: 10160-10168Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar).Pax-5a and Pax-5d isoforms, but not Pax-5b, are expressed at detectable levels in normal B cells, although the levels of Pax-5d transcripts are significantly lower than those of Pax-5a (16Zwollo P. Arrieta H. Ede K. Molinder K. Desiderio S. Pollock R. J. Biol. Chem. 1997; 272: 10160-10168Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar, 17Anspach J. Poulsen G. Kaattari I. Pollock R. Zwollo P. J. Immunol. 2001; 166: 2617-2626Crossref PubMed Scopus (17) Google Scholar). As shown in Fig. 1, both Pax-5a and Pax-5d, but not Pax-5e, possess an intact DNA-binding domain, enabling them to interact with and compete for Pax-5-binding sites on DNA in vitro (Fig. 1; Ref. 16Zwollo P. Arrieta H. Ede K. Molinder K. Desiderio S. Pollock R. J. Biol. Chem. 1997; 272: 10160-10168Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). In contrast, neither Pax-5d nor Pax-5e possesses transactivation, repression, or partial homeodomain homology regions at the C terminus. Instead, in Pax-5d and -5e, the region encoded by exons 6–10 is replaced with a 128 nt1 novel sequence (16Zwollo P. Arrieta H. Ede K. Molinder K. Desiderio S. Pollock R. J. Biol. Chem. 1997; 272: 10160-10168Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar) with unknown function. Based on the DNA binding abilities and expression pattern of Pax-5a and -5d, we hypothesize that the two isoforms compete for DNA-binding sites and have opposite effects on transcription of target genes in vivo. Although a number of studies have shown clear functional significance for isoform Pax-5a (8Kozmik Z. Wang S. Dörfler P. Adams B. Busslinger M. Mol. Cell. Biol. 1992; 12: 2662-2672Crossref PubMed Scopus (293) Google Scholar, 18Zwollo P. Rao S. Wallin J.J. Gackstetter E.R. Koshland M.E. J. Biol. Chem. 1998; 273: 18647-18655Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar, 19Fitzsimmons D. Hodson W. Wheat W. Maira S.M. Wasylyk B. Hagman J. Genes Dev. 1996; 7: 2198-2211Crossref Scopus (204) Google Scholar), no prior work had yet characterized the functions of isoforms Pax-5d and -5e. Thus, the first goal of our studies was to determine the transactivation properties of both isoforms. Here we show, using a transient transfection system, that Pax-5d has a transactivating function opposite to that of Pax-5a, whereas, unexpectedly, isoform Pax-5e increases the activity of Pax-5a. Upon further characterization we found evidence that isoform Pax-5e forms a strong complex in the nucleus with a thioredoxin-like molecule. Furthermore, using B cell lines as well as resting and LPS-activated B cells, we show that the ratio of Pax-5d to Pax-5e correlates with the proliferation state of the B cell. The observed changes in Pax-5d/5e ratio are regulated at the protein level, as we found no evidence for changes in ratios of Pax-5d to Pax-5e transcript levels. In summary, data presented here suggest that during B cell activation/proliferation, the activity of transcription factor Pax-5a may be regulated through changes in relative amounts of alternative isoforms Pax-5d and Pax-5e, and such changes likely affect expression of Pax-5 target genes. Murine B-lymphoid cell lines KEFTL-1 (pro-B), HAFTL-1 (pro-B), FE1NC3 (pro-B), HRC3 (pro-B), 18.8 (pre-B), PD31 (pre-B), 70Z/3 (pre-B), WEHI-231 (immature B), A20/2J (mature B), A20 (mature B), B17.10 (mature B), 2PK3 (mature B), and CH12 (pre-secretor B), and Sp2/0 (plasma cell), were either gifts from Dr. Steve Desiderio (The Johns Hopkins University School of Medicine, Baltimore, MD) or purchased through ATCC. Cells were grown in RPMI 1640 medium supplemented with 10% fetal bovine serum (BioWhitaker, Inc.), 2 mm glutamine, 50 units/ml penicillin, 50 μg/ml streptomycin, and 50 mm β-mercaptoethanol. The COS-1 cell line (ATCC), a transformed African green monkey kidney cell line, was maintained in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum, 2 mm glutamine, 50 units/ml penicillin, and 50 μg/ml streptomycin. NIH 3T3 (ATCC), an embryonic mouse fibroblast cell line, was grown in Dulbecco’s modified Eagle’s medium supplemented with 10% calf serum (Life Technologies, Inc. Life Technology), 2 mm glutamine, 50 units/ml penicillin, and 50 μg/ml streptomycin. The γ42(3i)AS-CAT reporter construct was created using the pγ42CassI CAT reporter (20Wallin J.J. Gackstetter E.R. Koshland M.E. Science. 1998; 279: 1961-1964Crossref PubMed Scopus (52) Google Scholar) (Fig. 2 A). Expression of CAT is driven by the truncated rat γ42-fibrinogen promoter (−54 to +36), which includes a TATA box and a single Sp-1-binding site. Three copies of the high-affinity Pax-5-binding site from the CD19promoter (5′-CAGACACCCATGGTTGAGTGCCCTCCAG-3′) were inserted into the polylinker upstream of the γ42-fibrinogen promoter. Recombinant constructs were sequenced to determine copy number and orientation of Pax-5-binding sites. The effector constructs pcDNA.5a and pcDNA.5d were made by cloning the cDNA sequences of Pax-5a, Pax-5d, or Pax-5e into NotI restriction sites of the expression vector pcDNA3 (Invitrogen). The pcDNA3 construct was used as a negative control effector construct, and the HBIICAT construct (9Zwollo P. Desiderio S.V. J. Biol. Chem. 1994; 269: 15310-15317Abstract Full Text PDF PubMed Google Scholar) was used as a control for transfection efficiency. The pcDNA.5e.mC5 construct was made using a PCR-directed site-specific mutagenesis approach. Primers m5b/5eATG2.S (5′-ccgtgcggccgc323CCATGTTTGCCTGGGAG339-3′, containing in small letters a linker and the NotI restriction site) and m5d/5e.mC5,AS, 5′-gcttctaga202CTAGGACCCTGGGAAGCCCGGTCCTCTG CTGCTA735-3′, including in small letters a linker XbaI restriction site) were used to amplify the region encoding the complete Pax-5e isoform, using pcDNA.5e as a template. A single replacement mutation of nt T (from codon TGC (Cys) to AGC (Ser), underlined as T on antisense primer) replaced the most 3′-terminal cysteine (Cys5) codon with the structurally related Serine residue. The amplified sequence was cloned into the NotI and XbaI sites of pcDNA3 (Invitrogen). The cysteine replacement mutation was confirmed by dideoxy sequencing. Transient transfections of B cell lines A20/2J and Sp2/0 were performed by the DEAE-dextran (21Grosschedl R. Baltimore D. Cell. 1985; 41: 885-897Abstract Full Text PDF PubMed Scopus (288) Google Scholar) method as described previously (9Zwollo P. Desiderio S.V. J. Biol. Chem. 1994; 269: 15310-15317Abstract Full Text PDF PubMed Google Scholar). Nonlymphoid cell lines COS-1 and NIH 3T3 were transfected using LipofectAMINE Plus (Life Technologies, Inc.) according to the manufacturer's protocols. Data were quantified using an NIH Image software analysis program (rsb.ihfo.nih.gov/nih-image/). Relative CAT conversion was determined as described previously (9Zwollo P. Desiderio S.V. J. Biol. Chem. 1994; 269: 15310-15317Abstract Full Text PDF PubMed Google Scholar). Splenic B cells were obtained from 3–6-month-old BALB/c mice (bred at The College of William and Mary). Small resting B cells (SRBs) were isolated from a 70% Percoll gradient (Amersham Pharmacia Biotech) as described previously (18Zwollo P. Rao S. Wallin J.J. Gackstetter E.R. Koshland M.E. J. Biol. Chem. 1998; 273: 18647-18655Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). SRB populations were activated by culturing in complete RPMI 1640 medium (supplemented as above) in the presence of 20 μg/ml bacterial lipopolysaccharide (LPS) (Sigma) for the required period of time. Cells were collected at specified times and processed for nuclear extracts as described elsewhere (22Wallin J.J. Rinkenberger J.L. Rao S. Gackstetter E.R. Koshland M.E. Zwollo P. J. Biol. Chem. 1999; 274: 15959-15965Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar). Procedures for nuclear extract preparation were carried out on ice in a cold room at 6 °C. Total cellular RNA was isolated from Percoll-purified SRBs or LPS-activated B cells using an RNeasy mini kit (Qiagen) according to the manufacturer’s instructions. For RT-PCR the cDNA was made using 1 μg of RNA and random hexamers using an RT-PCR kit (PerkinElmer Life Sciences) according to the manufacturer’s instructions. For the PCR reactions, two 5′-sense primers were used: primer Pax-5.164.S (5′-164CCAGGCAGCTTCGGGTCAGCC184) anneals to a sequence in exon two (present on Pax-5d, but absent from Pax-5e), whereas primer Pdcon.1.S (5′-322ACCATGTTTGCCTGGGAG339) which recognizes a sequence on exon 3, can anneal to either Pax-5d or Pax-5e. One antisense primer was used, PP15 (16Zwollo P. Arrieta H. Ede K. Molinder K. Desiderio S. Pollock R. J. Biol. Chem. 1997; 272: 10160-10168Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar), complementary to the novel sequence present in both Pax-5d and Pax-5e. PCR amplification of cDNAs were performed in 100-μl reactions, with 1 min denaturing at 94 °C, 1.5 min, annealing at 55 °C, and 1.5 min extension at 72 °C for 26 cycles, in the presence of all three primers in each sample. Two PCR-amplified DNA bands were expected, a 571-nt band that is Pax-5d specific, and a 413-nt band representing both Pax-5d and Pax-5e. Nuclear extracts and cytoplasmic fractions from SRBs, LPS-activated B cells, or cell lines were separated on 12–15% denaturing SDS-polyacrylamide gels and electrophoretically transferred onto nitrocellulose filters (Schleicher and Schuell) as described previously (18Zwollo P. Rao S. Wallin J.J. Gackstetter E.R. Koshland M.E. J. Biol. Chem. 1998; 273: 18647-18655Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). Antibody probing was performed as described previously (18Zwollo P. Rao S. Wallin J.J. Gackstetter E.R. Koshland M.E. J. Biol. Chem. 1998; 273: 18647-18655Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). The data were quantified using an NIH Image software analysis program (rsb.ihfo.nih.gov/nih-image/). Information about isotype-specific Pax-5 antibodies used in this study is summarized in Table I. Pax-5d/Pax-5e-specific mouse monoclonal antibody 6G11, recognizing the C-terminal “novel” sequence, was generated in our lab (17Anspach J. Poulsen G. Kaattari I. Pollock R. Zwollo P. J. Immunol. 2001; 166: 2617-2626Crossref PubMed Scopus (17) Google Scholar). 6G11 supernatants were used at a 1:60 to 1:100 dilution and detected with a horseradish peroxidase-conjugated goat anti-mouse IgG secondary antibody (Zymed Laboratories Inc.). ED-1 antiserum (18Zwollo P. Rao S. Wallin J.J. Gackstetter E.R. Koshland M.E. J. Biol. Chem. 1998; 273: 18647-18655Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar) was used at a 1:2000 dilution. Pax-5/N-19 and Pax-5/C-20 were used at a 1:400 dilution and detected with a horseradish peroxidase-conjugated rabbit anti-goat IgG (Zymed Laboratories Inc.). OC-1 was used at 1:1000. Rabbit polyclonal antiserum to the transcription factor TFIID (Santa Cruz Biotechnology) was used at a dilution 1:200. The ED-1, OC-1, and anti-TFIID antibodies were detected with a horseradish peroxidase-conjugated donkey anti-rabbit IgG secondary antibody (Amersham Pharmacia Biotech). Hybridoma supernatant containing anti-TRX/IgA mAbs developed against catfish TRX was a gift from Drs. Khayat and Clem (University of Mississippi Medical Center) (23Khayat M. Stuge T.B. Wilson M. Bengten E. Miller N.W. Clem L.W. J. Immunol. 2001; 166: 2937-2943Crossref PubMed Scopus (22) Google Scholar) and was used at a 1:30 dilution, and detected using a horseradish peroxidase-conjugated goat anti-mouse IgA secondary antibody (Zymed Laboratories Inc.).Table IList of Pax-5 antibodies usedAntibodyTypeSource or Ref.SpecificityIsoforms recognizedED-1Rabbit polycl.18Zwollo P. Rao S. Wallin J.J. Gackstetter E.R. Koshland M.E. J. Biol. Chem. 1998; 273: 18647-18655Abstract Full Text Full Text PDF PubMed Scopus (28) Google ScholarPaired domain aa 13–159All four isoforms6G11Mouse mAb17Anspach J. Poulsen G. Kaattari I. Pollock R. Zwollo P. J. Immunol. 2001; 166: 2617-2626Crossref PubMed Scopus (17) Google ScholarNovel sequence aa 218–235Pax-5d, Pax-5eN-19Goat polycl.Santa Cruz BiotechN terminus, aa 2–20Pax-5a, Pax-5dC-20Goat polycl.Santa Cruz BiotechC terminus, aa 370–391Pax-5a, Pax-5bOC-1Rabbit polycl.16Zwollo P. Arrieta H. Ede K. Molinder K. Desiderio S. Pollock R. J. Biol. Chem. 1997; 272: 10160-10168Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholaraa 234–255Pax-5a, Pax-5b Open table in a new tab Standard binding assays were carried out for 20 min at 30 °C in 10–15-μl reactions containing 60 mm KCl, 12 mm HEPES, pH 7.9, 4 mm Tris-HCl, pH 7.9, 1 mm EDTA, 1 mm dithiothreitol, 30 ng of BSA, 12% glycerol, 1 μg of nuclear extract, 2–4 fmol of 32P-labeled DNA probe, and 2 μg of poly(dI·dC) (9Zwollo P. Desiderio S.V. J. Biol. Chem. 1994; 269: 15310-15317Abstract Full Text PDF PubMed Google Scholar). The double-stranded oligonucleotide CD19/BSAP probe (5′-CAGACACCCATGGTTGAGTGCCCTCCAG-3′) was labeled with [α-32P]dCTP as described previously (9Zwollo P. Desiderio S.V. J. Biol. Chem. 1994; 269: 15310-15317Abstract Full Text PDF PubMed Google Scholar). The ratio of nuclear extract to poly(dI·dC) (in μg) was kept constant at 1:2 in all experiments. In antibody supershift/competition EMSAs, nuclear extracts were preincubated in the presence of 1 μl of (1:5 diluted) antibody without probe for 10 min at 30°C. Products were separated by electrophoresis on 5% nondenaturing polyacrylamide gel in buffer containing 33 mm Tris-HCl, 33 mm boric acid, and 0.74 mm EDTA. Gels were dried and exposed to Eastman Kodak X-Omat-AR film. The plasmids (pBluescript) containing the isoform Pax-5a (pcDNA.5a), Pax-5d, (pcDNA.5d), or Pax-5e (pcDNA.5e) were transcribed in sense direction with T3 or T7 RNA polymerase, respectively, as described previously (16Zwollo P. Arrieta H. Ede K. Molinder K. Desiderio S. Pollock R. J. Biol. Chem. 1997; 272: 10160-10168Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). Translation was carried out using rabbit reticulocyte lysate (TnT; Promega) according to the manufacturer's directions. SRBs were partially purified by Percoll gradients and grown in culture in the presence of 20 μg/ml LPS for 2 or 6 days. Cells from both time points were always processed at the same time: first, cells were cultured in long term labeling mixture (1% fetal bovine serum, 90% RPMI minus methionine, and 10% complete RPMI) in the presence of 0.1 mCi/ml [35S]methionine (>800 Ci/mmol; Amersham Pharmacia Biotech) for 8 h (24Coligan J.E. Kruisbeek A.M. Margulies D.H. Shevach E.M. Strober W. Current. Protocols in Immunology, Unit 8.3. Vol. 2. John Wiley and Sons, Inc., New York1998: 8.3.1-8.3.6Google Scholar), and nuclear extracts prepared. Nuclear extracts for both time points were then incubated overnight at 4 °C in the presence of ED-1 (1:250 dilution), α-TRX supernatant (1:30 dilution), or 6G11 supernatant (1:30 dilution), and mouse anti-Thy-1.2 mAb HO-13–4 (ATTC) hybridoma supernatant (1:30) as negative control. For ED-1 and 6G11, Protein G-Sepharose was then added for 2 h at 4 °C, followed by immunoprecipitation, denaturing of the complexes, and finally, SDS-PAGE analysis. For α-TRX/IgA containing nuclear extracts, Protein G-Sepharose was preincubated with goat anti-IgA antiserum (1:50; Zymed Laboratories Inc.) for 2 h, followed by repeated washes of the beads before their addition to the nuclear extracts. Gels were dried, fixed, and incubated in fluorographic reagent using an Amplify kit (NAMP100; Amersham Pharmacia Biotech), followed by exposure to x-ray film for 2–6 days. Pax-5a plays essential roles during B cell development and activation, and this isoform has been studied extensively. In contrast, no prior studies had yet investigated the regulatory properties of two alternative Pax-5 isoforms, Pax-5d and -5e. The transactivation function of isoform Pax-5a on the tyrosine kinase gene blkwas previously determined in our laboratory using the chloramphenicol transferase (CAT) reporter gene: Pax-5a acts as an activator of blk expression (18Zwollo P. Rao S. Wallin J.J. Gackstetter E.R. Koshland M.E. J. Biol. Chem. 1998; 273: 18647-18655Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). In the present studies, we initially used the same target promoter sequence as was used for Pax-5a to investigate Pax-5d and -5e function, but due to low transfection efficiency in B cell lines combined with low activity of the blk promoter (9Zwollo P. Desiderio S.V. J. Biol. Chem. 1994; 269: 15310-15317Abstract Full Text PDF PubMed Google Scholar), we were unable to determine reliable quantitative differences. As an alternative approach, we created an artificial promoter containing multiple Pax-5 DNA-binding sites, similar to an approach previously used by others (25Dörfler P. Busslinger M. EMBO J. 1996; 15: 1971-1982Crossref PubMed Scopus (136) Google Scholar). Three copies of a double-stranded oligonucleotide containing the high affinity Pax-5 DNA-binding site from the murine CD19 promoter were cloned in sense or antisense orientation upstream of the TATA element of the truncated rat γ42-fibrinogen promoter driving expression of the CAT gene, as shown in Fig. 2 A. Both sense and antisense reporters gave similar promoter activities and the antisense construct, named γ42(3i)AS-CAT, was used in all subsequent experiments. To verify the specificity of γ42(3i)AS-CAT, namely, that reporter expression was expressed in the presence, but not absence, of endogenous Pax-5a protein, transient transfections using DEAE-dextran were performed in the mature B cell line A20/2J and the plasma cell line SP2/0. As expected, CAT expression was detected in the Pax-5 positive A20/2J line (Fig. 2 B), but no activity was detectable in the Pax-5 negative SP2/0 line (Fig. 2 C). As a control for transfection efficiency, the HBIICAT construct was used. This construct contains a portion of the RNA polymerase II promoter and drives high expression of CAT (9Zwollo P. Desiderio S.V. J. Biol. Chem. 1994; 269: 15310-15317Abstract Full Text PDF PubMed Google Scholar). Based on earlier in vitro data (16Zwollo P. Arrieta H. Ede K. Molinder K. Desiderio S. Pollock R. J. Biol. Chem. 1997; 272: 10160-10168Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar) showing that Pax-5a and -5d have similar affinity for Pax-5 DNA-binding sites on the blkpromoter, we first sought to investigate whether the potentially dominant negative isoform Pax-5d can inhibit Pax-5a activity in vivo. For this set of experiments, the NIH3T3 fibroblast cell line was used because this cell type does not express endogenous Pax proteins, allowing for transfection of highly controlled amounts of various Pax-5 isoforms. To determine the activity of Pax-5a alone on the γ42(3i)AS-CAT reporter in this cell line, co-transfections were performed with the expression vector pcDNA.5a. The pcDNA3 vector without insert was used in all subsequent transfections as a negative control, and added where necessary to maintain equal amounts of total transfected DNA. Results from repeated CAT assays showed that the reporter gene was expressed at high levels in the presence, but not absence, of Pax-5a (Fig. 3 A) confirming a positive transactivating function for this isoform using the γ42(3i)AS-CAT reporter. In contrast, isoform Pax-5d alone was unable to activate the reporter gene, yielding only basal levels of transcription that were similar to those produced in the presence of the control plasmid pcDNA3 (Fig. 3 A). Next, it was tested whether alternative isoform Pax-5d could affect the activity of Pax-5a. Reporter construct γ42(3i)AS-CAT was transiently co-transfected into NIH3T3 cells using fixed amounts of pcDNA.5a and increasing amounts of pcDNA.5d (Fig. 3 A). The data showed that Pax-5d was able to suppress Pax-5a dependent activity of the CAT reporter in a dose-dependent manner, although relatively high amounts of Pax-5d were needed for efficient suppression (discussed in later section). To verify that amounts of transfected DNA corresponded with the correct amounts of Pax-5a and Pax-5d protein, nuclear extracts from transfected cells were analyzed by Western blot analysis. Results using the ED-1 antibody (which detects Pax-5a and -5d protein with the same intensity, as both have a complete paired domain), showed the expected expression patterns of both proteins (Fig. 3 B, upper panel), and Pax-5d expression was independently verified using the Pax-5d/5e specific monoclonal 6G11 (Fig. 3 B, lower panel). Kidney cells contain endogenous Pax proteins which have been shown to interact with Pax-5 DNA-binding sites (27Kozmik Z. Kurzbauer R. Dorfler P. Busslinger M. Mol. Cell. Biol. 1993; 13: 6024-6035Crossref PubMed Scopus (143) Google Scholar, 28Walther C. Guinet J.-L. Simon D. Deutsch U. Jostes B. Goulding M.D. Plachov D. Balling R. Gruss P. Genomics. 1991; 11: 424-434Crossref PubMed Scopus (356) Google Scholar). The kidney cell line COS-1 does not express Pax-5 but expresses the closely related Pax-8 protein (26Plachov D. Chowdhury K. Walther C. Simon D. Guenet J.L. Gruss P. Development. 1990; 110: 643-651Crossref PubMed Google Scholar, 27Kozmik Z. Kurzbauer R. Dorfler P. Busslinger M. Mol. Cell." @default.
• W2072034951 created "2016-06-24" @default.
• W2072034951 creator A5015375366 @default.
• W2072034951 creator A5030839937 @default.
• W2072034951 creator A5046208385 @default.
• W2072034951 date "2001-11-01" @default.
• W2072034951 modified "2023-09-29" @default.
• W2072034951 title "Functional Analyses of Two Alternative Isoforms of the Transcription Factor Pax-5" @default.
• W2072034951 cites W1547313148 @default.
• W2072034951 cites W1547616171 @default.
• W2072034951 cites W155631952 @default.
• W2072034951 cites W1565745037 @default.
• W2072034951 cites W1578435986 @default.
• W2072034951 cites W159986488 @default.
• W2072034951 cites W1896595148 @default.
• W2072034951 cites W1899130495 @default.
• W2072034951 cites W1943867795 @default.
• W2072034951 cites W1964478384 @default.
• W2072034951 cites W1978029697 @default.
• W2072034951 cites W1984144365 @default.
• W2072034951 cites W1990255620 @default.
• W2072034951 cites W2003607850 @default.
• W2072034951 cites W2004872916 @default.
• W2072034951 cites W2015812032 @default.
• W2072034951 cites W2019432665 @default.
• W2072034951 cites W2023851430 @default.
• W2072034951 cites W2030203792 @default.
• W2072034951 cites W2035502959 @default.
• W2072034951 cites W2045899523 @default.
• W2072034951 cites W2057982973 @default.
• W2072034951 cites W2061685624 @default.
• W2072034951 cites W2064280448 @default.
• W2072034951 cites W2067101123 @default.
• W2072034951 cites W2074596664 @default.
• W2072034951 cites W2082739985 @default.
• W2072034951 cites W2090054746 @default.
• W2072034951 cites W2097038192 @default.
• W2072034951 cites W2132976350 @default.
• W2072034951 cites W2141874177 @default.
• W2072034951 cites W2154975058 @default.
• W2072034951 cites W2155002865 @default.
• W2072034951 cites W2156561249 @default.
• W2072034951 cites W2161315255 @default.
• W2072034951 cites W2339946069 @default.
• W2072034951 cites W2340021583 @default.
• W2072034951 cites W32008250 @default.
• W2072034951 cites W4248412843 @default.
• W2072034951 doi "https://doi.org/10.1074/jbc.m106536200" @default.
• W2072034951 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11535600" @default.
• W2072034951 hasPublicationYear "2001" @default.
• W2072034951 type Work @default.
• W2072034951 sameAs 2072034951 @default.
• W2072034951 citedByCount "29" @default.
• W2072034951 countsByYear W20720349512012 @default.
• W2072034951 countsByYear W20720349512013 @default.
• W2072034951 countsByYear W20720349512015 @default.
• W2072034951 countsByYear W20720349512017 @default.
• W2072034951 countsByYear W20720349512021 @default.
• W2072034951 countsByYear W20720349512022 @default.
• W2072034951 crossrefType "journal-article" @default.
• W2072034951 hasAuthorship W2072034951A5015375366 @default.
• W2072034951 hasAuthorship W2072034951A5030839937 @default.
• W2072034951 hasAuthorship W2072034951A5046208385 @default.
• W2072034951 hasBestOaLocation W20720349511 @default.
• W2072034951 hasConcept C104317684 @default.
• W2072034951 hasConcept C53345823 @default.
• W2072034951 hasConcept C54355233 @default.
• W2072034951 hasConcept C70721500 @default.
• W2072034951 hasConcept C86339819 @default.
• W2072034951 hasConcept C86803240 @default.
• W2072034951 hasConcept C95444343 @default.
• W2072034951 hasConceptScore W2072034951C104317684 @default.
• W2072034951 hasConceptScore W2072034951C53345823 @default.
• W2072034951 hasConceptScore W2072034951C54355233 @default.
• W2072034951 hasConceptScore W2072034951C70721500 @default.
• W2072034951 hasConceptScore W2072034951C86339819 @default.
• W2072034951 hasConceptScore W2072034951C86803240 @default.
• W2072034951 hasConceptScore W2072034951C95444343 @default.
• W2072034951 hasIssue "45" @default.
• W2072034951 hasLocation W20720349511 @default.
• W2072034951 hasOpenAccess W2072034951 @default.
• W2072034951 hasPrimaryLocation W20720349511 @default.
• W2072034951 hasRelatedWork W1828691184 @default.
• W2072034951 hasRelatedWork W1903732681 @default.
• W2072034951 hasRelatedWork W1991523530 @default.
• W2072034951 hasRelatedWork W2002128513 @default.
• W2072034951 hasRelatedWork W2020824267 @default.
• W2072034951 hasRelatedWork W2031436818 @default.
• W2072034951 hasRelatedWork W2057739827 @default.
• W2072034951 hasRelatedWork W2075354549 @default.
• W2072034951 hasRelatedWork W4232838641 @default.
• W2072034951 hasRelatedWork W2092874662 @default.
• W2072034951 hasVolume "276" @default.
• W2072034951 isParatext "false" @default.
• W2072034951 isRetracted "false" @default.
• W2072034951 magId "2072034951" @default.
• W2072034951 workType "article" @default.