FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2072697616> ?p ?o ?g. }

• W2072697616 endingPage "36472" @default.
• W2072697616 startingPage "36462" @default.
• W2072697616 abstract "The bidirectional [NiFe] hydrogenase of the cyanobacterium Synechocystis sp. PCC 6803 was purified to apparent homogeneity by a single affinity chromatography step using a Synechocystis mutant with a Strep-tag II fused to the C terminus of HoxF. To increase the yield of purified enzyme and to test its overexpression capacity in Synechocystis the psbAII promoter was inserted upstream of the hoxE gene. In addition, the accessory genes (hypF, C, D, E, A, and B) from Nostoc sp. PCC 7120 were expressed under control of the psbAII promoter. The respective strains show higher hydrogenase activities compared with the wild type. For the first time a Fourier transform infrared (FTIR) spectroscopic characterization of a [NiFe] hydrogenase from an oxygenic phototroph is presented, revealing that two cyanides and one carbon monoxide coordinate the iron of the active site. At least four different redox states of the active site were detected during the reversible activation/inactivation. Although these states appear similar to those observed in standard [NiFe] hydrogenases, no paramagnetic nickel state could be detected in the fully oxidized and reduced forms. Electron paramagnetic resonance spectroscopy confirms the presence of several iron-sulfur clusters after reductive activation. One [4Fe4S]+ and at least one [2Fe2S]+ cluster could be identified. Catalytic amounts of NADH or NADPH are sufficient to activate the reaction of this enzyme with hydrogen. The bidirectional [NiFe] hydrogenase of the cyanobacterium Synechocystis sp. PCC 6803 was purified to apparent homogeneity by a single affinity chromatography step using a Synechocystis mutant with a Strep-tag II fused to the C terminus of HoxF. To increase the yield of purified enzyme and to test its overexpression capacity in Synechocystis the psbAII promoter was inserted upstream of the hoxE gene. In addition, the accessory genes (hypF, C, D, E, A, and B) from Nostoc sp. PCC 7120 were expressed under control of the psbAII promoter. The respective strains show higher hydrogenase activities compared with the wild type. For the first time a Fourier transform infrared (FTIR) spectroscopic characterization of a [NiFe] hydrogenase from an oxygenic phototroph is presented, revealing that two cyanides and one carbon monoxide coordinate the iron of the active site. At least four different redox states of the active site were detected during the reversible activation/inactivation. Although these states appear similar to those observed in standard [NiFe] hydrogenases, no paramagnetic nickel state could be detected in the fully oxidized and reduced forms. Electron paramagnetic resonance spectroscopy confirms the presence of several iron-sulfur clusters after reductive activation. One [4Fe4S]+ and at least one [2Fe2S]+ cluster could be identified. Catalytic amounts of NADH or NADPH are sufficient to activate the reaction of this enzyme with hydrogen. Hydrogenases are metalloenzymes that catalyze the reversible cleavage of H2 into two protons and two electrons. Three types of hydrogenases are recognized, two contain a binuclear metal center (FeFe or NiFe) and the third type harbors a mononuclear iron center. Despite being unrelated in an evolutionary context (1.Vignais P.M. Billoud B. Meyer J. FEMS Microbiol. Rev. 2001; 25: 455-501Crossref PubMed Google Scholar, 2.Vignais P.M. Billoud B. Chem. Rev. 2007; 107: 4206-4272Crossref PubMed Scopus (1190) Google Scholar) all three classes share a Fe(CO)x(RS−) motif in their active sites (3.Armstrong F.A. Fontecilla-Camps J.C. Science. 2008; 321: 498-499Crossref PubMed Scopus (54) Google Scholar, 4.De Lacey A.L. Fernandez V.M. Rousset M. Cammack R. Chem. Rev. 2007; 107: 4304-4330Crossref PubMed Scopus (398) Google Scholar). In the cyanobacterial phylum two functionally different [NiFe] hydrogenases are present, an uptake and a bidirectional enzyme (5.Appel J. Schulz R. J. Photochem. Photobiol. 1998; 47: 1-11Crossref Scopus (111) Google Scholar, 6.Tamagnini P. Leitão E. Oliveira P. Ferreira D. Pinto F. Harris D.J. Heidorn T. Lindblad P. FEMS Microbiol. Rev. 2007; 31: 692-720Crossref PubMed Scopus (274) Google Scholar). Synechocystis PCC 6803, as a non-nitrogen fixing cyanobacterium, possesses only a bidirectional [NiFe] hydrogenase, which is investigated in this study. It is a pentameric enzyme utilizing NAD(P)+ as a substrate (Fig. 1). HoxY and HoxH form the hydrogenase moiety and HoxE, HoxF, and HoxU comprise the diaphorase unit (5.Appel J. Schulz R. J. Photochem. Photobiol. 1998; 47: 1-11Crossref Scopus (111) Google Scholar, 7.Schmitz O. Boison G. Hilscher R. Hundeshagen B. Zimmer W. Lottspeich F. Bothe H. Eur. J. Biochem. 1995; 233: 266-276Crossref PubMed Scopus (129) Google Scholar, 8.Appel J. Schulz R. Biochim. Biophys. Acta. 1996; 1298: 141-147Crossref PubMed Scopus (99) Google Scholar, 9.Schmitz O. Boison G. Salzmann H. Bothe H. Schütz K. Wang S.H. Happe T. Biochim. Biophys. Acta. 2002; 1554: 66-74Crossref PubMed Scopus (88) Google Scholar). Physiologically it was shown that the hydrogenase functions as a valve for an excess of electrons (10.Appel J. Phunpruch S. Steinmüller K. Schulz R. Arch. Microbiol. 2000; 173: 333-338Crossref PubMed Scopus (161) Google Scholar, 11.Cournac L. Mus F. Bernard L. Guedeney G. Vignais P.M. Peltier G. Int. J. Hydrogen Energy. 2002; 27: 1229-1237Crossref Scopus (87) Google Scholar, 12.Cournac L. Guedeney G. Peltier G. Vignais P.M. J. Bacteriol. 2004; 186: 1737-1746Crossref PubMed Scopus (204) Google Scholar, 13.Gutthann F. Egert M. Marques A. Appel J. Biochim. Biophys. Acta. 2007; 1767: 161-169Crossref PubMed Scopus (92) Google Scholar). It is suggested that cyclic electron transport, respiration via the NDH-1 complex, and the bidirectional hydrogenase are competing for reducing equivalents (13.Gutthann F. Egert M. Marques A. Appel J. Biochim. Biophys. Acta. 2007; 1767: 161-169Crossref PubMed Scopus (92) Google Scholar). Furthermore, it has been proposed that the enzyme could be part of respiratory complex I (8.Appel J. Schulz R. Biochim. Biophys. Acta. 1996; 1298: 141-147Crossref PubMed Scopus (99) Google Scholar). For a schematic representation of the suggested metabolic pathways see Fig. 1. The bidirectional hydrogenase shows its highest activity in cells with high photosynthetic activity and low respiration rates (10.Appel J. Phunpruch S. Steinmüller K. Schulz R. Arch. Microbiol. 2000; 173: 333-338Crossref PubMed Scopus (161) Google Scholar), although it should be stressed that it is only active under anaerobic conditions. The hox genes are constitutively expressed in the presence of O2 (10.Appel J. Phunpruch S. Steinmüller K. Schulz R. Arch. Microbiol. 2000; 173: 333-338Crossref PubMed Scopus (161) Google Scholar, 14.Gutekunst K. Phunpruch S. Schwarz C. Schuchardt S. Schulz-Friedrich R. Appel J. Mol. Microbiol. 2005; 58: 810-823Crossref PubMed Scopus (85) Google Scholar), but the enzyme is inactive under aerobic conditions. In the absence of O2 the hydrogenase regains its activity in less than a minute (10.Appel J. Phunpruch S. Steinmüller K. Schulz R. Arch. Microbiol. 2000; 173: 333-338Crossref PubMed Scopus (161) Google Scholar, 11.Cournac L. Mus F. Bernard L. Guedeney G. Vignais P.M. Peltier G. Int. J. Hydrogen Energy. 2002; 27: 1229-1237Crossref Scopus (87) Google Scholar). Crude extracts or the partially purified enzyme can be activated under anaerobic conditions within minutes by excess NADH or NADPH in the absence of H2 (12.Cournac L. Guedeney G. Peltier G. Vignais P.M. J. Bacteriol. 2004; 186: 1737-1746Crossref PubMed Scopus (204) Google Scholar). Most other known [NiFe] hydrogenases, except e.g. the three oxygen-tolerant hydrogenases in Ralstonia eutropha H16 (Re H16), (namely) the soluble NAD+-reducing (15.Happe R.P. Roseboom W. Egert G. Friedrich C.G. Massanz C. Friedrich B. Albracht S.P. FEBS Lett. 2000; 466: 259-263Crossref PubMed Scopus (71) Google Scholar, 16.Van der Linden E. Burgdorf T. Bernhard M. Bleijlevens B. Friedrich B. Albracht S.P. J. Biol. Inorg. Chem. 2004; 9: 616-626Crossref PubMed Scopus (61) Google Scholar), the regulatory (17.Buhrke T. Lenz O. Krauss N. Friedrich B. J. Biol. Chem. 2005; 280: 23791-23796Abstract Full Text Full Text PDF PubMed Scopus (165) Google Scholar), and the membrane bound hydrogenase (18.Saggu M. Zebger I. Ludwig M. Lenz O. Friedrich B. Hildebrandt P. Lendzian F. J. Biol. Chem. 2009; 284: 16264-16276Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar), are inactivated by oxygen under electron poor conditions, presumably by the formation of a hydroperoxo-bridge. Their reactivation in the presence of hydrogen takes hours (19.Fernandez V.M. Hatchikian E.C. Cammack R. Biochim. Biophys. Acta. 1985; 832: 69-79Crossref Scopus (180) Google Scholar, 20.Kurkin S. George S.J. Thorneley R.N. Albracht S.P. Biochemistry. 2004; 43: 6820-6831Crossref PubMed Scopus (85) Google Scholar, 21.Fichtner C. Laurich C. Bothe E. Lubitz W. Biochemistry. 2006; 45: 9706-9716Crossref PubMed Scopus (100) Google Scholar). [NiFe] hydrogenases consist minimally of a large subunit in which the active site is deeply buried and a small subunit with at least one FeS cluster. All enzymes with a bimetallic active site harbor a [4Fe4S] cluster near the active site, the so-called proximal cluster. A medial [3Fe4S] cluster and a distal [4Fe4S] cluster are common features in some [NiFe] hydrogenases, as exemplified by the enzymes of Desulfovibrio gigas (22.Volbeda A. Charon M.H. Piras C. Hatchikian E.C. Frey M. Fontecilla-Camps J.C. Nature. 1995; 373: 580-587Crossref PubMed Scopus (1380) Google Scholar, 23.Volbeda A. Garcin E. Piras C. De Lacey A.L. Fernandez V.M. Hatchikian E.C. Frey M. Fontecilla-Camps J.C. J. Am. Chem. Soc. 1996; 118: 12989-12996Crossref Scopus (587) Google Scholar), Allochromatium vinosum (20.Kurkin S. George S.J. Thorneley R.N. Albracht S.P. Biochemistry. 2004; 43: 6820-6831Crossref PubMed Scopus (85) Google Scholar, 24.Coremans J.M. van der Zwaan J.W. Albracht S.P. Biochim. Biophys. Acta. 1992; 1119: 157-168Crossref PubMed Scopus (85) Google Scholar, 25.Surerus K.K. Chen M. van der Zwaan J.W. Rusnak F.M. Kolk M. Duin E.C. Albracht S.P. Münck E. Biochemistry. 1994; 33: 4980-4993Crossref PubMed Scopus (88) Google Scholar, 26.Bleijlevens B. van Broekhuizen F.A. De Lacey A.L. Roseboom W. Fernandez V.M. Albracht S.P. J. Biol. Inorg. Chem. 2004; 9: 743-752Crossref PubMed Scopus (102) Google Scholar), or the Desulfovibrio vulgaris Miyazaki F (21.Fichtner C. Laurich C. Bothe E. Lubitz W. Biochemistry. 2006; 45: 9706-9716Crossref PubMed Scopus (100) Google Scholar, 27.Asso M. Guigliarelli B. Yagi T. Bertrand P. Biochim. Biophys. Acta. 1992; 1122: 50-56Crossref PubMed Scopus (50) Google Scholar, 28.Higuchi Y. Yagi T. Yasuoka N. Structure. 1997; 5: 1671-1680Abstract Full Text Full Text PDF PubMed Scopus (338) Google Scholar, 29.Lubitz W. Reijerse E. van Gastel M. Chem. Rev. 2007; 107: 4331-4365Crossref PubMed Scopus (411) Google Scholar). The active site in [NiFe] hydrogenases has been characterized as a NiFe(CN)2(CO) center by x-ray crystallography (22.Volbeda A. Charon M.H. Piras C. Hatchikian E.C. Frey M. Fontecilla-Camps J.C. Nature. 1995; 373: 580-587Crossref PubMed Scopus (1380) Google Scholar, 23.Volbeda A. Garcin E. Piras C. De Lacey A.L. Fernandez V.M. Hatchikian E.C. Frey M. Fontecilla-Camps J.C. J. Am. Chem. Soc. 1996; 118: 12989-12996Crossref Scopus (587) Google Scholar, 28.Higuchi Y. Yagi T. Yasuoka N. Structure. 1997; 5: 1671-1680Abstract Full Text Full Text PDF PubMed Scopus (338) Google Scholar, 30.Ogata H. Mizoguchi Y. Mizuno N. Miki K. Adachi S. Yasuoka N. Yagi T. Yamauchi O. Hirota S. Higuchi Y. J. Am. Chem. Soc. 2002; 124: 11628-11635Crossref PubMed Scopus (216) Google Scholar) and by Fourier transform infrared spectroscopic (FTIR) 2The abbreviations used are: FTIRFourier transform infraredEPRelectron paramagnetic resonanceSHsoluble hydrogenaseReRalstonia eutrophaTES2-{[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]amino}ethanesulfonic acidTricineN-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycineMALDI-TOFmatrix-assisted laser desorption ionization time-of-flightTtesla. studies (4.De Lacey A.L. Fernandez V.M. Rousset M. Cammack R. Chem. Rev. 2007; 107: 4304-4330Crossref PubMed Scopus (398) Google Scholar, 21.Fichtner C. Laurich C. Bothe E. Lubitz W. Biochemistry. 2006; 45: 9706-9716Crossref PubMed Scopus (100) Google Scholar, 31.Happe R.P. Roseboom W. Pierik A.J. Albracht S.P. Bagley K.A. Nature. 1997; 385: 126Crossref PubMed Scopus (400) Google Scholar, 32.De Lacey A.L. Hatchikian E.C. Volbeda A. Frey M. Fontecilla-Camps J.C. Fernandez V.M. J. Am. Chem. Soc. 1997; 119: 7181-7189Crossref Scopus (256) Google Scholar, 33.De Lacey A.L. Stadler C. Fernandez V.M. Hatchikian E.C. Fan H.J. Li S. Hall M.B. J. Biol. Inorg. Chem. 2002; 7: 318-326Crossref PubMed Scopus (88) Google Scholar), showing that the iron atom carries three inorganic diatomic ligands, two cyanides and one carbon monoxide. Nickel is coordinated by the sulfur atoms of four cysteines. Two of them are linked to the iron. In aerobically isolated enzymes, crystallographic studies indicate a third bridging ligand, which is a mono-oxo (hydroxo) ligand in the Nir-B (ready state), whereas a bridging di-oxo (hydroperoxide) species has been suggested in the Niu-A (unready state) (34.Ogata H. Hirota S. Nakahara A. Komori H. Shibata N. Kato T. Kano K. Higuchi Y. Structure. 2005; 13: 1635-1642Abstract Full Text Full Text PDF PubMed Scopus (223) Google Scholar, 35.Volbeda A. Martin L. Cavazza C. Matho M. Faber B.W. Roseboom W. Albracht S.P. Garcin E. Rousset M. Fontecilla-Camps J.C. J. Biol. Inorg. Chem. 2005; 10: 239-249Crossref PubMed Scopus (285) Google Scholar). The exact nature of the ligand in the Niu-A state is still under discussion (29.Lubitz W. Reijerse E. van Gastel M. Chem. Rev. 2007; 107: 4331-4365Crossref PubMed Scopus (411) Google Scholar). In these oxidized states, the enzyme is inactive but can be activated by reduction with hydrogen. Upon activation the oxygen ligand is removed (36.Garcin E. Vernede X. Hatchikian E.C. Volbeda A. Frey M. Fontecilla-Camps J.C. Structure. 1999; 7: 557-566Abstract Full Text Full Text PDF PubMed Scopus (416) Google Scholar, 37.Higuchi Y. Ogata H. Miki K. Yasuoka N. Yagi T. Structure. 1999; 7: 549-556Abstract Full Text Full Text PDF PubMed Scopus (313) Google Scholar). The two states Nir-B and Niu-A differ in their activation kinetics. Nir-B activation takes place within a time frame spanning from seconds to minutes, whereas the Niu-A state requires hours (4.De Lacey A.L. Fernandez V.M. Rousset M. Cammack R. Chem. Rev. 2007; 107: 4304-4330Crossref PubMed Scopus (398) Google Scholar, 19.Fernandez V.M. Hatchikian E.C. Cammack R. Biochim. Biophys. Acta. 1985; 832: 69-79Crossref Scopus (180) Google Scholar, 20.Kurkin S. George S.J. Thorneley R.N. Albracht S.P. Biochemistry. 2004; 43: 6820-6831Crossref PubMed Scopus (85) Google Scholar, 21.Fichtner C. Laurich C. Bothe E. Lubitz W. Biochemistry. 2006; 45: 9706-9716Crossref PubMed Scopus (100) Google Scholar). Both states can be monitored with electron paramagnetic resonance (EPR) spectroscopy, via the low spin Ni3+ ion. In one-electron reactions these states are converted to their respective reduced states, Niu-S and Nir-S, which are also catalytically inactive, but EPR-silent. All redox states can be distinguished by FTIR spectroscopy via their characteristic band positions of the CO and CN stretching vibrations (4.De Lacey A.L. Fernandez V.M. Rousset M. Cammack R. Chem. Rev. 2007; 107: 4304-4330Crossref PubMed Scopus (398) Google Scholar, 21.Fichtner C. Laurich C. Bothe E. Lubitz W. Biochemistry. 2006; 45: 9706-9716Crossref PubMed Scopus (100) Google Scholar, 26.Bleijlevens B. van Broekhuizen F.A. De Lacey A.L. Roseboom W. Fernandez V.M. Albracht S.P. J. Biol. Inorg. Chem. 2004; 9: 743-752Crossref PubMed Scopus (102) Google Scholar, 32.De Lacey A.L. Hatchikian E.C. Volbeda A. Frey M. Fontecilla-Camps J.C. Fernandez V.M. J. Am. Chem. Soc. 1997; 119: 7181-7189Crossref Scopus (256) Google Scholar). For an overview about the different states of standard [NiFe] hydrogenases, see Refs. 4.De Lacey A.L. Fernandez V.M. Rousset M. Cammack R. Chem. Rev. 2007; 107: 4304-4330Crossref PubMed Scopus (398) Google Scholar and 29.Lubitz W. Reijerse E. van Gastel M. Chem. Rev. 2007; 107: 4331-4365Crossref PubMed Scopus (411) Google Scholar. It is proposed that at least three of the various redox states identified in [NiFe] hydrogenases are directly involved in the catalytic cleavage and formation of H2. Nia-S (EPR-silent) is the most oxidized that is converted by reduction to the intermediate Nia-C (EPR-active), which is then fully reduced to Nia-SR (EPR-silent). Each of the one-electron reduction steps is accompanied by a proton transfer step. Although nickel cycles between diamagnetic +II and paramagnetic +III states, the iron in the active site remains in its valence state during catalysis (25.Surerus K.K. Chen M. van der Zwaan J.W. Rusnak F.M. Kolk M. Duin E.C. Albracht S.P. Münck E. Biochemistry. 1994; 33: 4980-4993Crossref PubMed Scopus (88) Google Scholar, 38.Huyett J.E. Carepo M. Pamplona A. Franco R. Moura I. Moura J.J. Hoffman B.M. J. Am. Chem. Soc. 1997; 119: 9291-9292Crossref Scopus (86) Google Scholar). The splitting of H2 is known to be a heterolytic process (H2 ⇌ H− + H+) (3.Armstrong F.A. Fontecilla-Camps J.C. Science. 2008; 321: 498-499Crossref PubMed Scopus (54) Google Scholar) and the electrons are believed to be transferred via FeS clusters between the active site and the redox partners of the enzyme. Fourier transform infrared electron paramagnetic resonance soluble hydrogenase Ralstonia eutropha 2-{[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]amino}ethanesulfonic acid N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine matrix-assisted laser desorption ionization time-of-flight tesla. The bidirectional, soluble NAD+- reducing hydrogenase from Re H16 (SH) is a close relative of the cyanobacterial bidirectional hydrogenase and the best characterized of its class. For this enzyme a non-standard coordination of the active [NiFe] site was proposed with one additional cyanide ligand bound to each iron and nickel (15.Happe R.P. Roseboom W. Egert G. Friedrich C.G. Massanz C. Friedrich B. Albracht S.P. FEBS Lett. 2000; 466: 259-263Crossref PubMed Scopus (71) Google Scholar, 16.Van der Linden E. Burgdorf T. Bernhard M. Bleijlevens B. Friedrich B. Albracht S.P. J. Biol. Inorg. Chem. 2004; 9: 616-626Crossref PubMed Scopus (61) Google Scholar, 39.van der Linden E. Burgdorf T. de Lacey A.L. Buhrke T. Scholte M. Fernandez V.M. Friedrich B. Albracht S.P. J. Biol. Inorg. Chem. 2006; 11: 247-260Crossref PubMed Scopus (41) Google Scholar). Such a ligation would possibly protect the catalytic center from binding of oxygen and the related inactivation. The protein was activated by hydrogen in the presence of catalytic amounts of NADH or NADPH (16.Van der Linden E. Burgdorf T. Bernhard M. Bleijlevens B. Friedrich B. Albracht S.P. J. Biol. Inorg. Chem. 2004; 9: 616-626Crossref PubMed Scopus (61) Google Scholar). Under such conditions, no evidence of paramagnetic nickel species could be detected by EPR spectroscopy (16.Van der Linden E. Burgdorf T. Bernhard M. Bleijlevens B. Friedrich B. Albracht S.P. J. Biol. Inorg. Chem. 2004; 9: 616-626Crossref PubMed Scopus (61) Google Scholar). However, in some enzyme preparations significant amounts of Nia-C could also be induced electrochemically or by an excess of NADH or dithionite (39.van der Linden E. Burgdorf T. de Lacey A.L. Buhrke T. Scholte M. Fernandez V.M. Friedrich B. Albracht S.P. J. Biol. Inorg. Chem. 2006; 11: 247-260Crossref PubMed Scopus (41) Google Scholar). Oxygenic photosynthetic microorganisms are a matter of intense interest for the production of hydrogen by solar power. The bidirectional hydrogenase is the enzyme naturally involved in this process in cyanobacteria (10.Appel J. Phunpruch S. Steinmüller K. Schulz R. Arch. Microbiol. 2000; 173: 333-338Crossref PubMed Scopus (161) Google Scholar, 11.Cournac L. Mus F. Bernard L. Guedeney G. Vignais P.M. Peltier G. Int. J. Hydrogen Energy. 2002; 27: 1229-1237Crossref Scopus (87) Google Scholar, 12.Cournac L. Guedeney G. Peltier G. Vignais P.M. J. Bacteriol. 2004; 186: 1737-1746Crossref PubMed Scopus (204) Google Scholar). In this work we present a newly developed rapid and gentle purification protocol for Synechocystis sp. PCC 6803 and the first characterization of the enzymes active site and its iron-sulfur centers by a combination of FTIR and EPR spectroscopy. The wild type strains Synechocystis sp. PCC 6803, Nostoc sp. PCC 7120, and the Synechocystis mutants were grown in BG-11 (40.Rippka R. Deruelles J. Waterbury J.B. Herdman M. Stanier R. J. Gen. Microbiol. 1979; 111: 1-61Crossref Google Scholar) supplemented with 5 mm TES, pH 8, at 28 °C and 50 μE m−2 s−1 bubbled with air. For purification, Synechocystis mutant strain E3 was cultured in 5-liter glass bottles. The cells were harvested at 20 min by centrifugation at 6,000 × g. DNA cloning and PCR amplification were performed using standard procedures (41.Sambrook J. Russel D.W. Molecular Cloning: A Laboratory Manual. Cold Spring Habor Laboratory Press, Cold Spring Harbor, NY2001Google Scholar). All primer sequences used during the cloning procedure are listed in Table 1. To insert a psbAII promoter upstream of the hoxE gene from Synechocystis, a PCR product was amplified using the primer pairs E-out1/E-in1 and E-in2/E-out2. The gentamycin cassette that had been amplified with primers Gm1 and Gm2 was then fused to these two PCR products as described (42.Hoffmann D. Gutekunst K. Klissenbauer M. Schulz-Friedrich R. Appel J. FEBS J. 2006; 273: 4516-4527Crossref PubMed Scopus (48) Google Scholar). The resulting product was ligated into pCRII-TOPO (Invitrogen). In the final step this vector was cut by KpnI and NdeI, and the psbAII promoter of pDH1 (42.Hoffmann D. Gutekunst K. Klissenbauer M. Schulz-Friedrich R. Appel J. FEBS J. 2006; 273: 4516-4527Crossref PubMed Scopus (48) Google Scholar) was excised with the same enzymes and inserted into these sites.TABLE 1Primer sequences used during cloning proceduresPrimerSequence 5′–3′Anahyp1CATATGGCGACTGAGGAAATTCGAnahyp2TAGCTAGTCGACGATTAAGGAAAAACTGGTACE-in1GGTTCGTGCCTTCATCCGTCGACTGATTGGGAGAGCCTAAACCE-out1TCTGAGCGATGAACTGAGAAACE-in2TACCGCCACCTAACAATTCGGTACCAGGATTTTCATATGACCGTTGCCACE-out2AACTGTTACTTAACCAAGGTTGGm1GTCGACGGATGAAGGCACGAACCGm2GTCGACGAATTGTTAGGTGGCGHoxF-in1GAACTGCGGGTGGCTCCAGCTAGCGACTTTGAGTAATTCTTCATAHoxF-out1CTTTTTAGAAGGGGAAGCTAHoxF-in2GAGCCACCCGCAGTTCGAGAAATAGTTCGGATCCTTATCCACTCAGTTAHoxF-out2CAGTGGCTTGGATAAATTCT Open table in a new tab For construction of the Strep-tag II mutant (E3), the Strep-tag II sequence with an Alanin-Serin-linker (Fig. 2) was fused to the C terminus of the HoxF protein. Then, two PCR products from the genomic DNA of Synechocystis PCC 6803 were amplified using primer pairs HoxF-out1/HoxF-in1 and HoxF-in2/HoxF-out2. The overlapping parts of the Strep-tag II sequence in these products could be fused together with a second PCR. Primer HoxF-in2 contained the restriction site for the enzyme BamHI, at this site the kanamycin resistance cassette from pUC4K was inserted as a selection marker in the same orientation as hox genes. To get a hyp gene expression construct, the respective operon of Nostoc sp. PCC 7120 was amplified by PCR using primers Anahyp1 and Anahyp2. The resulting 6.7-kb PCR product was cloned downstream of the psbAII promoter into Synechocystis expression vector pDH2. The latter vector was constructed by cutting the kanamycin cassette out of pDH1 with restriction enzymes XhoI and SacI, and ligating the chloramphenicol resistance cassette from pKS-CAT (HindIII and SacI digested) into the pDH1 vector in a half-blunt end ligation reaction. This construct was transformed into the Strep-tag II mutant E3. All constructs were sequenced before transformation in Synechocystis. All purification steps were carried out at 4 °C under aerobic conditions. After washing and resuspending the pellet in buffer W (100 mm Tris-HCl, 150 mm NaCl, pH 8.0) the cells were disrupted by three passages through a chilled French pressure cell (Sim Amicon) at 20,000 p.s.i. To obtain the soluble fraction the extract was centrifuged at 24,000 × g for 1 h. Subsequently, a concentrated ammonium sulfate solution was slowly added to a final concentration of 20%. After centrifuging for 30 min at 11,000 × g, the supernatant was applied to a 5-ml gravity flow Strep-Tactin-Sepharose column (IBA, Göttingen, Germany). Unbound proteins were removed by washing 5 times with 1 column volume of buffer W. Recombinant protein was eluted by adding buffer E (buffer W with 2.5 mm desthiobiotin (IBA, Göttingen, Germany)) and the elution fraction was concentrated by centrifugation at 7,500 × g in centrifugal filters (Amicon Ultra 4, 10 K, Millipore, Eschborn, Germany). H2 production was measured with a Clark-type electrode (43.Wang R. Healey F.P. Myers J. Plant Physiol. 1971; 48: 108-110Crossref PubMed Google Scholar) in the presence of 5 mm methyl viologen and 10 mm sodium dithionite (10.Appel J. Phunpruch S. Steinmüller K. Schulz R. Arch. Microbiol. 2000; 173: 333-338Crossref PubMed Scopus (161) Google Scholar). Protein concentrations were determined by the Bradford assay (Bio-Rad, Laboratories) using bovine serum albumin as a standard (44.Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (214455) Google Scholar). Proteins were separated by electrophoresis in 16.5% Tricine-SDS gels (45.Schägger H. Nat. Protoc. 2006; 1: 16-22Crossref PubMed Scopus (1893) Google Scholar), and either stained with Coomassie Brilliant Blue or transferred to nitrocellulose membranes (Porablot, Macherey-Nagel, Düren, Germany). Proteins were detected with antibodies raised against Synechocystis HoxF (1:1000) and HoxH (1:100) (10.Appel J. Phunpruch S. Steinmüller K. Schulz R. Arch. Microbiol. 2000; 173: 333-338Crossref PubMed Scopus (161) Google Scholar) or against the HypD (1:500) (46.Jones A.K. Lenz O. Strack A. Buhrke T. Friedrich B. Biochemistry. 2004; 43: 13467-13477Crossref PubMed Scopus (45) Google Scholar) of R. eutropha and the ECL system (Amersham Biosciences). Strep-tag II antibodies, obtained from IBA (Göttingen, Germany) were used as described by the manufacturer. As a protein marker, the prestained protein ladder PageRuler (Fermentas, St. Leon-Rot, Germany) was used. The excised gel slices were bleached, reduced with dithiothreitol, and acylated with jodacetamide. After digestion with trypsin, all mass spectra were acquired with a MALDI-TOF mass spectrometer (ABI Voyager-STR). The measurements were carried out with an α-cyano-4-hydroxycinnamic acid matrix. They were calibrated externally and internally using a standard Sequazyme Peptide Mass Standard kit and by the peptides generated by the autoproteolysis of trypsin. Protein identification by mass spectrometry data was achieved using the Protein Prospectors MS-Fit program (University of California, San Francisco, CA) and the Mascot search engine (version 2.0, Matrix Science Ltd.). Determination of the subunit stoichiometry was performed using a Procise 492 protein sequencer (Applied Biosystems, Foster City, CA). The integrated peak areas of the separated 3-phenyl-2-thiohydantoin-derivatives during 13 Edman degradation cycles were used for quantification of the relative protein amounts. Protein samples were filled in X-Band EPR tubes (Rototec Spintec 707-SQ-250). For reductive activation catalytic amounts (5 mol % of protein) of NADH or NADPH were added and the samples were flushed with 100% H2 gas for 30 min in a glove box with an anaerobic atmosphere (5% H2, 95% N2). Sodium dithionite solution was prepared in an anoxic buffer, and the reduction was carried out under an argon atmosphere by adding a 20-fold excess to the sample. Furthermore, excess NADH was added to another sample that had been incubated with hydrogen and frozen after 30 min. In order to produce the highest oxidized state(s) in the enzyme, experiments with an excess of 2,6-dichloroindophenol were also carried out. Aliquots of the protein samples after various chemical treatments were taken for the FTIR spectroscopic investigations, whereas the main fraction was studied by EPR spectroscopy. Infrared spectra were recorded on a Bruker Tensor 27 FTIR spectrometer equipped with a liquid nitrogen-cooled MCT detector at a spectral resolution of 2 cm−1. The sample (0.1–0.6 mm protein) was held in a temperature-controlled (10 °C), gas-tight liquid cell (volume ∼7 μl, path length ≈50 μm) with CaF2 windows, whereas the sample chamber was purged with dried air. To follow the inactivation process after various chemical reactions, spectra were collected subsequently as a function of time while allowing air to penetrate slowly into the liquid cell. Subsequently, the FTIR spectra were baseline corrected by means of a spline function implemented within OPUS 4.2 software supplied by Bruker. The spectra shown in this work were normalized with respect to the integral intensity of the CO stretching bands. X-Band EPR measurements at 9.5 GHz were carried out on a Bruker ESP300E spectrometer equipped with a rectangular microwave cavity working in the TE102 mode. The samples were placed in an Oxford ESR 900 helium-flow cryostat controlled with an Oxford ITC502 to allow measurements at temperatures between room temperature and 4 K. The microwave frequency was detected with an EIP frequency counter (Microwave Inc.). To obtain accurate g values the magnetic field was calibrated with an external standard (lithium particles embedded in LiF matrix) with a known g value of 2.002293 (47.Stesmans A. Van Gorp G. Rev. Sci. Instrum. 1989; 60: 2949-2952Crossref Scopus (65) Google Scholar). Simulations of the" @default.
• W2072697616 created "2016-06-24" @default.
• W2072697616 creator A5026942895 @default.
• W2072697616 creator A5039254257 @default.
• W2072697616 creator A5046252920 @default.
• W2072697616 creator A5052975327 @default.
• W2072697616 creator A5084861865 @default.
• W2072697616 creator A5090447170 @default.
• W2072697616 date "2009-12-01" @default.
• W2072697616 modified "2023-10-13" @default.
• W2072697616 title "Overexpression, Isolation, and Spectroscopic Characterization of the Bidirectional [NiFe] Hydrogenase from Synechocystis sp. PCC 6803" @default.
• W2072697616 cites W1502569710 @default.
• W2072697616 cites W1564565358 @default.
• W2072697616 cites W1632501685 @default.
• W2072697616 cites W1882597211 @default.
• W2072697616 cites W1968992426 @default.
• W2072697616 cites W1976922306 @default.
• W2072697616 cites W1980071371 @default.
• W2072697616 cites W1981804683 @default.
• W2072697616 cites W1982048806 @default.
• W2072697616 cites W1983925681 @default.
• W2072697616 cites W1985244259 @default.
• W2072697616 cites W1985502526 @default.
• W2072697616 cites W1987861995 @default.
• W2072697616 cites W1992990770 @default.
• W2072697616 cites W1993324181 @default.
• W2072697616 cites W1993929532 @default.
• W2072697616 cites W1999706217 @default.
• W2072697616 cites W2001383430 @default.
• W2072697616 cites W2001569923 @default.
• W2072697616 cites W2004263736 @default.
• W2072697616 cites W2011910038 @default.
• W2072697616 cites W2012418721 @default.
• W2072697616 cites W2013046539 @default.
• W2072697616 cites W2019356464 @default.
• W2072697616 cites W2020936377 @default.
• W2072697616 cites W2021588372 @default.
• W2072697616 cites W2023678343 @default.
• W2072697616 cites W2031264453 @default.
• W2072697616 cites W2034184914 @default.
• W2072697616 cites W2036153245 @default.
• W2072697616 cites W2037381429 @default.
• W2072697616 cites W2040358298 @default.
• W2072697616 cites W2042072944 @default.
• W2072697616 cites W2044358680 @default.
• W2072697616 cites W2044852484 @default.
• W2072697616 cites W2053365019 @default.
• W2072697616 cites W2055155126 @default.
• W2072697616 cites W2058649621 @default.
• W2072697616 cites W2059081508 @default.
• W2072697616 cites W2062658639 @default.
• W2072697616 cites W2067228734 @default.
• W2072697616 cites W2067473649 @default.
• W2072697616 cites W2071890379 @default.
• W2072697616 cites W2072454801 @default.
• W2072697616 cites W2074724924 @default.
• W2072697616 cites W2084325104 @default.
• W2072697616 cites W2087067651 @default.
• W2072697616 cites W2092638302 @default.
• W2072697616 cites W2093329804 @default.
• W2072697616 cites W2101706283 @default.
• W2072697616 cites W2116403749 @default.
• W2072697616 cites W2117421619 @default.
• W2072697616 cites W2131502017 @default.
• W2072697616 cites W2133728369 @default.
• W2072697616 cites W2134808690 @default.
• W2072697616 cites W2135179038 @default.
• W2072697616 cites W2146051607 @default.
• W2072697616 cites W2155823284 @default.
• W2072697616 cites W2159775601 @default.
• W2072697616 cites W4230123174 @default.
• W2072697616 cites W4236262546 @default.
• W2072697616 cites W4247476339 @default.
• W2072697616 cites W4293247451 @default.
• W2072697616 doi "https://doi.org/10.1074/jbc.m109.028795" @default.
• W2072697616 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2794762" @default.
• W2072697616 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/19801638" @default.
• W2072697616 hasPublicationYear "2009" @default.
• W2072697616 type Work @default.
• W2072697616 sameAs 2072697616 @default.
• W2072697616 citedByCount "54" @default.
• W2072697616 countsByYear W20726976162012 @default.
• W2072697616 countsByYear W20726976162013 @default.
• W2072697616 countsByYear W20726976162014 @default.
• W2072697616 countsByYear W20726976162015 @default.
• W2072697616 countsByYear W20726976162016 @default.
• W2072697616 countsByYear W20726976162017 @default.
• W2072697616 countsByYear W20726976162018 @default.
• W2072697616 countsByYear W20726976162019 @default.
• W2072697616 countsByYear W20726976162020 @default.
• W2072697616 countsByYear W20726976162022 @default.
• W2072697616 countsByYear W20726976162023 @default.
• W2072697616 crossrefType "journal-article" @default.
• W2072697616 hasAuthorship W2072697616A5026942895 @default.
• W2072697616 hasAuthorship W2072697616A5039254257 @default.
• W2072697616 hasAuthorship W2072697616A5046252920 @default.
• W2072697616 hasAuthorship W2072697616A5052975327 @default.
• W2072697616 hasAuthorship W2072697616A5084861865 @default.

• next