FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2072969560> ?p ?o ?g. }

• W2072969560 endingPage "3621" @default.
• W2072969560 startingPage "3615" @default.
• W2072969560 abstract "Human T-cell leukemic virus type 1 (HTLV-1)–infected T cells express the fucosyltransferase (Fuc-T) VIIgene involved in the biosynthesis of the leukocyte sialyl Lewis X, which may be related to tissue infiltration in patients with malignant adult T-cell leukemia. HTLV-1 induces Fuc-T VIItranscription through the viral transactivator Tax, although the underlying molecular mechanism remains unknown. In the present study, we analyzed the role of the cis-activating element in Tax activation using reporter constructs bearing the 5′-regulatory region of Fuc-T VII in Jurkat T cells. A sequence (GGCTGTGGGGGCGTCATATTGCCCTGG) covering a half-palindromic cyclic adenosine monophosphate (cAMP)–responsive element (CRE) was found to be required for Tax activation of the Fuc-T VII promoter. We further demonstrated that transcription factors of the CRE-binding protein (CREB)/activating transcription factor (ATF) family bind to this CRE-like sequence and that Tax binds in association with CREB and the coactivator CREB-binding protein (CBP) in Jurkat T cells. This element, containing the G+C–rich flanking sequences, is homologous to the Tax-responsive viral CREs in the HTLV-1 long terminal repeat (LTR)–promoter. Furthermore, CREMα, an isoform of CREB deficient in the glutamine-rich domains, was found to activate the Fuc-T VII promoter in a phosphorylation-independent manner, similar to the viral CRE in HTLV-1 LTR but in contrast to the phosphorylation-dependent activation of the cellular CREs by Tax. These findings indicate that the Fuc-T VII promoter is transactivated by Tax in concert with CBP through a CRE-like sequence in a manner similar to that of viral CRE in HTLV-1 LTR." @default.
• W2072969560 created "2016-06-24" @default.
• W2072969560 creator A5002187727 @default.
• W2072969560 creator A5012798768 @default.
• W2072969560 creator A5022831685 @default.
• W2072969560 creator A5027786827 @default.
• W2072969560 creator A5031599575 @default.
• W2072969560 creator A5032513799 @default.
• W2072969560 creator A5063748677 @default.
• W2072969560 creator A5083607348 @default.
• W2072969560 date "2003-05-01" @default.
• W2072969560 modified "2023-10-14" @default.
• W2072969560 title "Transactivation of the fucosyltransferase VII gene by human T-cell leukemia virus type 1 Tax through a variant cAMP-responsive element" @default.
• W2072969560 cites W1488783754 @default.
• W2072969560 cites W1489241767 @default.
• W2072969560 cites W1489305157 @default.
• W2072969560 cites W1499999049 @default.
• W2072969560 cites W1593766594 @default.
• W2072969560 cites W1630990577 @default.
• W2072969560 cites W1638598493 @default.
• W2072969560 cites W1647336621 @default.
• W2072969560 cites W1665862639 @default.
• W2072969560 cites W1720344590 @default.
• W2072969560 cites W1900762885 @default.
• W2072969560 cites W1915336795 @default.
• W2072969560 cites W1955037330 @default.
• W2072969560 cites W1964337986 @default.
• W2072969560 cites W1968468124 @default.
• W2072969560 cites W1984092048 @default.
• W2072969560 cites W1993243592 @default.
• W2072969560 cites W1996339709 @default.
• W2072969560 cites W1998461588 @default.
• W2072969560 cites W1999156595 @default.
• W2072969560 cites W1999569383 @default.
• W2072969560 cites W2004520528 @default.
• W2072969560 cites W2007927210 @default.
• W2072969560 cites W2009621572 @default.
• W2072969560 cites W2015773923 @default.
• W2072969560 cites W2016534065 @default.
• W2072969560 cites W2016941709 @default.
• W2072969560 cites W2018351756 @default.
• W2072969560 cites W2018922006 @default.
• W2072969560 cites W202880800 @default.
• W2072969560 cites W2031096289 @default.
• W2072969560 cites W2032496145 @default.
• W2072969560 cites W2033265652 @default.
• W2072969560 cites W2039871973 @default.
• W2072969560 cites W2042976701 @default.
• W2072969560 cites W2049496770 @default.
• W2072969560 cites W2054072640 @default.
• W2072969560 cites W2060913542 @default.
• W2072969560 cites W2064087386 @default.
• W2072969560 cites W2074351361 @default.
• W2072969560 cites W2075855923 @default.
• W2072969560 cites W2099675490 @default.
• W2072969560 cites W2106250017 @default.
• W2072969560 cites W2125883145 @default.
• W2072969560 cites W2133044221 @default.
• W2072969560 cites W2137840298 @default.
• W2072969560 cites W2142204748 @default.
• W2072969560 cites W2145245707 @default.
• W2072969560 cites W2146419650 @default.
• W2072969560 cites W2147489899 @default.
• W2072969560 cites W2149138755 @default.
• W2072969560 cites W2156797668 @default.
• W2072969560 cites W2158644988 @default.
• W2072969560 cites W2395185936 @default.
• W2072969560 cites W2410864367 @default.
• W2072969560 cites W4313343458 @default.
• W2072969560 doi "https://doi.org/10.1182/blood-2002-07-2301" @default.
• W2072969560 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12506041" @default.
• W2072969560 hasPublicationYear "2003" @default.
• W2072969560 type Work @default.
• W2072969560 sameAs 2072969560 @default.
• W2072969560 citedByCount "55" @default.
• W2072969560 countsByYear W20729695602012 @default.
• W2072969560 countsByYear W20729695602013 @default.
• W2072969560 countsByYear W20729695602014 @default.
• W2072969560 countsByYear W20729695602015 @default.
• W2072969560 countsByYear W20729695602016 @default.
• W2072969560 countsByYear W20729695602018 @default.
• W2072969560 countsByYear W20729695602019 @default.
• W2072969560 countsByYear W20729695602020 @default.
• W2072969560 countsByYear W20729695602021 @default.
• W2072969560 countsByYear W20729695602022 @default.
• W2072969560 countsByYear W20729695602023 @default.
• W2072969560 crossrefType "journal-article" @default.
• W2072969560 hasAuthorship W2072969560A5002187727 @default.
• W2072969560 hasAuthorship W2072969560A5012798768 @default.
• W2072969560 hasAuthorship W2072969560A5022831685 @default.
• W2072969560 hasAuthorship W2072969560A5027786827 @default.
• W2072969560 hasAuthorship W2072969560A5031599575 @default.
• W2072969560 hasAuthorship W2072969560A5032513799 @default.
• W2072969560 hasAuthorship W2072969560A5063748677 @default.
• W2072969560 hasAuthorship W2072969560A5083607348 @default.
• W2072969560 hasBestOaLocation W20729695601 @default.
• W2072969560 hasConcept C101762097 @default.
• W2072969560 hasConcept C104317684 @default.

• next