FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2073008220> ?p ?o ?g. }

• W2073008220 endingPage "40701" @default.
• W2073008220 startingPage "40694" @default.
• W2073008220 abstract "Mechanisms underlying dietary nutrient regulation of glucose-6-phosphatase (Glc-6-Pase) gene expression are not well understood. Here we investigated the effects of short-chain fatty acids on the expression of this gene in primary cultures of rat hepatocytes and H4IIE hepatoma cells. Propionate, butyrate, valerate, and caproate induced severalfold increases in the expression of Glc-6-Pase mRNA. In reporter gene assays, propionate, valerate, caproate, and also octanoate increased Glc-6-Pase promoter activity by 6-16-fold. Butyrate, by itself, had little or no effect on promoter activity, but it induced a robust increase (45-fold) in promoter activity in cells co-transfected with a plasmid expressing the transcription factor HNF-4α (α isoforms of hepatic nuclear factor 4). HNF-4α also enhanced promoter activity induced by other short-chain fatty acids. A dominant negative form of HNF-4α abrogated the fatty acid-induced promoter activity, a finding that accentuates a role for HNF-4α in the transcription process studied here. In cells transfected with HNF-4α, short-chain fatty acids and trichostatin A, an inhibitor of histone deacetylase, synergistically enhanced promoter activity, suggesting that hyperacetylation of histones is an important component of the transactivation of the Glc-6-Pase gene promoter by HNF-4α. Region-751/-466 of this promoter contains seven putative HNF-4α-binding motifs. Binding of HNF-4α to this region was confirmed by electrophoretic mobility shift and chromatin immunoprecipitation assays, indicating that HNF-4α is recruited to the Glc-6-Pase gene promoter during short-chain fatty acid-induced transcription from this promoter. Mechanisms underlying dietary nutrient regulation of glucose-6-phosphatase (Glc-6-Pase) gene expression are not well understood. Here we investigated the effects of short-chain fatty acids on the expression of this gene in primary cultures of rat hepatocytes and H4IIE hepatoma cells. Propionate, butyrate, valerate, and caproate induced severalfold increases in the expression of Glc-6-Pase mRNA. In reporter gene assays, propionate, valerate, caproate, and also octanoate increased Glc-6-Pase promoter activity by 6-16-fold. Butyrate, by itself, had little or no effect on promoter activity, but it induced a robust increase (45-fold) in promoter activity in cells co-transfected with a plasmid expressing the transcription factor HNF-4α (α isoforms of hepatic nuclear factor 4). HNF-4α also enhanced promoter activity induced by other short-chain fatty acids. A dominant negative form of HNF-4α abrogated the fatty acid-induced promoter activity, a finding that accentuates a role for HNF-4α in the transcription process studied here. In cells transfected with HNF-4α, short-chain fatty acids and trichostatin A, an inhibitor of histone deacetylase, synergistically enhanced promoter activity, suggesting that hyperacetylation of histones is an important component of the transactivation of the Glc-6-Pase gene promoter by HNF-4α. Region-751/-466 of this promoter contains seven putative HNF-4α-binding motifs. Binding of HNF-4α to this region was confirmed by electrophoretic mobility shift and chromatin immunoprecipitation assays, indicating that HNF-4α is recruited to the Glc-6-Pase gene promoter during short-chain fatty acid-induced transcription from this promoter. Glucose-6-phosphatase (Glc-6-Pase) 1The abbreviations used are: Glc-6-Pase, glucose-6-phosphatase; DR, direct repeat; EMSA, electrophoretic mobility shift assay; HDAC, histone deacetylase; HNF-4α, α isoform of hepatic nuclear factor 4; LUC, luciferase; PBS, phosphate-buffered saline; PEPCK, phosphoenolpyruvate carboxykinase; PMSF, phenylmethylsulfonyl fluoride; TSA, trichostatin A; MOPS, 4-morpholinepropanesulfonic acid. is expressed in the liver, kidney, and small intestine (1Chatelain F. Pegorier J.P. Minassian C. Bruni N. Tarpin S. Girard J. Mithieux G. Diabetes. 1998; 47: 882-889Crossref PubMed Scopus (79) Google Scholar) and catalyzes the hydrolysis of glucose 6-phosphate to glucose during gluconeogenesis and glycogenolysis (2Nordlie R.C. Bode A.M. Foster J.D. Proc. Soc. Exp. Biol. Med. 1993; 203: 274-285Crossref PubMed Scopus (47) Google Scholar). Hepatic Glc-6-Pase is a multicomponent complex located in the endoplasmic reticulum and consists of at least five different proteins (2Nordlie R.C. Bode A.M. Foster J.D. Proc. Soc. Exp. Biol. Med. 1993; 203: 274-285Crossref PubMed Scopus (47) Google Scholar, 3Foster J.D. Pederson B.A. Nordlie R.C. Proc. Soc. Exp. Biol. Med. 1997; 215: 314-332Crossref PubMed Scopus (98) Google Scholar) that include three transporters termed T1, T2, and T3, the catalytic unit, and a stabilizer protein (2Nordlie R.C. Bode A.M. Foster J.D. Proc. Soc. Exp. Biol. Med. 1993; 203: 274-285Crossref PubMed Scopus (47) Google Scholar, 4Arion W.J. Lange A.J. Walls H.E. Ballas L.M. J. Biol. Chem. 1980; 255: 10396-10406Abstract Full Text PDF PubMed Google Scholar, 5Burchell A. FASEB J. 1990; 4: 2978-2988Crossref PubMed Scopus (92) Google Scholar, 6Burchell A. Burchell B. Monaco M. Walls H.E. Arion W.J. Biochem. J. 1985; 230: 489-495Crossref PubMed Scopus (21) Google Scholar). Hormones and nutrients such as glucose and fatty acids, which are elevated in poorly controlled diabetes, profoundly modulate the expression of the gene for the catalytic unit (Glc-6-Pase) (7Massillon D. Barzilai N. Chen W. Hu M. Rossetti L. J. Biol. Chem. 1996; 271: 9871-9874Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar, 8Massillon D. Barzilai N. Hawkins M. Prus-Wertheimer D. Rossetti L. Diabetes. 1997; 46: 153-157Crossref PubMed Google Scholar, 9Rajas F. Gautier A. Bady I. Montano S. Mithieux G. J. Biol. Chem. 2002; 277: 15736-15744Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar). Whereas glucose strongly activates expression of this gene, the effect of fatty acids is quite complex and appears to depend on the chain length and state of saturation of the fatty acid (1Chatelain F. Pegorier J.P. Minassian C. Bruni N. Tarpin S. Girard J. Mithieux G. Diabetes. 1998; 47: 882-889Crossref PubMed Scopus (79) Google Scholar, 9Rajas F. Gautier A. Bady I. Montano S. Mithieux G. J. Biol. Chem. 2002; 277: 15736-15744Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar). For example, polyunsaturated fatty acids inhibit, while long-chain saturated fatty acids induce expression of this gene (1Chatelain F. Pegorier J.P. Minassian C. Bruni N. Tarpin S. Girard J. Mithieux G. Diabetes. 1998; 47: 882-889Crossref PubMed Scopus (79) Google Scholar, 9Rajas F. Gautier A. Bady I. Montano S. Mithieux G. J. Biol. Chem. 2002; 277: 15736-15744Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar). However, virtually nothing is known as to whether short-chain fatty acids modulate the expression of the Glc-6-Pase gene or any genes encoding gluconeogenic enzymes. Although the role of nutrients as regulators of gene expression is well documented (10Vaulont S. Vasseur-Cognet M. Kahn A. J. Biol. Chem. 2000; 275: 31555-31558Abstract Full Text Full Text PDF PubMed Scopus (226) Google Scholar, 11Duplus E. Glorian M. Forest C. J. Biol. Chem. 2000; 275: 30749-30752Abstract Full Text Full Text PDF PubMed Scopus (300) Google Scholar, 12Towle H.C. J. Biol. Chem. 1995; 270: 23235-23238Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar, 13Towle H.C. Kaytor E.N. Shih H.M. Biochem. Soc. Trans. 1996; 24: 364-368Crossref PubMed Scopus (17) Google Scholar), the molecular mechanisms by which nutrients, especially fatty acids, modulate gene expression remain a challenge (11Duplus E. Glorian M. Forest C. J. Biol. Chem. 2000; 275: 30749-30752Abstract Full Text Full Text PDF PubMed Scopus (300) Google Scholar, 14Duplus E. Forest C. Biochem. Pharmacol. 2002; 64: 893-901Crossref PubMed Scopus (154) Google Scholar). Stimulation of Glc-6-Pase gene transcription by long-chain saturated fatty acids has been attributed to stabilization of the mRNA (1Chatelain F. Pegorier J.P. Minassian C. Bruni N. Tarpin S. Girard J. Mithieux G. Diabetes. 1998; 47: 882-889Crossref PubMed Scopus (79) Google Scholar). However, the effects of saturated fatty acids may also involve gene transcription, although this has not been tested. Modulating effects of short-chain fatty acids, if any, have also not been explored. Here we have studied the effect of short-chain fatty acids on Glc-6-Pase gene expression because, like long-chain fatty acids, short-chain fatty acids can also play an important role in energy generation. Using primary cultures of rat hepatocytes and the hepatoma cell line H4IIE, we show that short-chain fatty acids induce Glc-6-Pase gene transcription and that this induction occurs via recruitment of the transcription factor HNF-4α to the Glc-6-Pase promoter. Cell Culture and Transient Transfections—Rat hepatocytes were isolated as described previously (15Massillon D. J. Biol. Chem. 2001; 276: 4055-4062Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). Primary cultures were maintained in RPMI 1640 medium containing 5 mm glucose (15Massillon D. J. Biol. Chem. 2001; 276: 4055-4062Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). H4IIE cells were cultured in 6-well plates at 37°C in Dulbecco's modified Eagle's medium/F-12 (Invitrogen) containing 10% fetal bovine serum and 5% calf serum. Cells were transfected with 1 μgofa -751/+66 proximal portion of the mouse Glc-6-Pase gene promoter linked to luciferase reporter gene using FuGENE 6 transfection reagent (Roche Applied Science) at a 3:1 ratio of FuGENE 6 to DNA according to the manufacturer's instructions. Because we found that various fatty acids induced reporter gene expression in conventional reporter constructs (e.g. Renilla and β-galactosidase) used for normalization in transfection experiments, making it impractical to use such plasmids for this purpose in our experiments, we normalized luciferase activity to the protein content of each sample. In co-transfection experiments, 1 μg of luciferase reporter plasmid was co-transfected with 100 ng of cDNA expression plasmid, and the total amount of DNA was adjusted, if necessary, by adding the empty plasmid. Cells were harvested 24 h after addition of fatty acids, washed twice in 1× phosphate-buffered saline (PBS), and then lysed with 300 μl of Cell Culture Lysis Buffer (Promega, Madison, WI). The lysates were centrifuged at 13,000 × g for 5 min, and 10 μl of the supernatant solution were assayed for luciferase activity. Protein concentrations were determined by the Lowry method using a Bio-Rad assay kit according to the manufacturer's protocol. Each transfection was performed in duplicate at least three times. Expression Plasmids—Expression plasmids harboring genes for wild-type and dominant negative HNF-4α were obtained from Dr. Todd Leff (University of Michigan, Ann Arbor, MI). cDNA for Glc-6-Pase was obtained from Dr. Rebecca Taub (University of Pennsylvania, Philadelphia, PA). cDNA for glucose-6-phosphate translocase was obtained by PCR amplification using the following primers: 5′-ACACAGCTCAGCAGATCCG-3′ and 5′-CCTTAGGGACTGAGGTATTGGC-3′ (GenBank™ accession number NM_031589). The resulting cDNA was subcloned into pCMV-Tag 2A (Stratagene, La Jolla, CA), and the nucleotide sequence was verified by DNA sequencing. Northern Blotting—TRIZOL reagent (Invitrogen) was used to isolate total RNA according to the manufacturer's protocol. The isolated RNA was assessed for purity by the 260/280 nm absorbancy ratios. Electrophoresis of the RNA (20 μg) was performed on a 1.2% formaldehydedenatured agarose gel in 1× MOPS running buffer. After electrophoresis, RNA was transferred to a Hybond-N+ membrane (Amersham Biosciences) and prehybridized for 4 h at 55 °C in Church buffer (0.5 m phosphate buffer, pH 7.0, 7% SDS, 1 mm EDTA, and 1% bovine serum albumin). Hybridization with the 32P-labeled probe that had been labeled with [α-32P]dCTP using the random primer labeling system kit (Amersham Biosciences) was then carried out for 16 h at 55 °C in the same buffer. After hybridization, the membranes were washed twice for 10 min in 2× SSC, 0.1% SDS at room temperature and once in 0.1× SSC, 0.1% SDS for 15 min at 55 °C. The membranes were then exposed to x-ray films for 12-48 h at -80 °C using intensifying screens. The autoradiogram was quantified by scanning densitometry using the Eastman Kodak Co. 1-D analysis software. RNA loading was monitored by ethidium bromide staining of the gels to visualize 18 and 28 S rRNAs. Histone Acetylation Assay—Histones were prepared by acid precipitation as follows. Cells grown in 100-mm dishes were washed three times with ice-cold 1× PBS and then scraped off the dishes into ice-cold PBS. The cells were recovered by centrifugation at 3,000 rpm for 5 min, resuspended in buffer (10 mm HEPES, pH 7.9, 1.5 mm MgCl2, 10 mm KCl, 0.5 mm dithiothreitol, 1.5 mm PMSF), and incubated on ice for 10 min. The suspension was adjusted to pH 2.0 with 2.2 n HCl and then incubated on ice for an additional 30 min followed by centrifugation at 16,060 × g for 15 min at 4 °C. Acetone (1 ml) was added to the supernatant fraction (which contained the acid-soluble proteins) and allowed to incubate overnight at 20 °C. The pellet was collected by centrifugation at 16,060 × g for 15 min, washed with acetone, and air-dried to obtain a white powder containing the histones. A total of 20 μg of protein was fractionated onto a 12% urea gel and transferred onto polyvinylidene difluoride membrane. Membranes were incubated overnight with 50 ng of anti-acetylated H3 antibody/ml (Upstate Biotechnology, Lake Placid, NY) or 1 μg of anti-acetylated H4 antibody/ml (Upstate Biotechnology) followed by a 1:2,000 dilution of anti-rabbit secondary antibody for 2 h. The signals were enhanced by chemiluminescence (Cell Signaling, Beverly, MA). Chromatin Immunoprecipitation Assays—H4IIE cells in 100-mm dishes were fixed with 1% formaldehyde for 10 min at room temperature. Formaldehyde was then neutralized at room temperature (5 min) by adding glycine to a final concentration of 125 mm. Cells were washed twice in ice-cold PBS and collected by scraping in 1 ml of 1% SDS containing 100 μg of sonicated salmon sperm DNA/ml, 0.5 mm PMSF, and 1× mixture of protease inhibitors from Roche Applied Science. Lysates were mixed in a Vortex mixer, and insoluble material was collected by centrifugation at 14,000 × g at 4 °C (for 5 min). The pellets were resuspended in 1 ml of buffer (1% SDS, 10 mm EDTA, 50 mm Tris-HCl (pH 8.1), 0.5 mm PMSF, and 1× mixture of protease inhibitors (Roche Applied Science)) and incubated on ice for 10 min. The samples were sonicated with a Fisher Sonic Dismembrator at setting 10 for six 20-s pulses to achieve an average DNA length of ∼1,000 bp. The remaining insoluble material was removed by centrifugation at 14,000 × g at 4 °C for 5 min. The supernatant solution was diluted with 2 volumes of 1% Nonidet P-40, 350 mm NaCl and incubated overnight at 4 °C with or without 2 μg of anti-HNF-4α antibody. Prior to immunoprecipitation, 20% of the sonicated chromatin from each reaction was saved for assessing total input chromatin. These were processed along with the eluted immunoprecipitates beginning at the cross-link reversal step. Immune complexes were collected by centrifugation at 14,000 × g at 4 °C for 5 min; washed four times in 1% Nonidet P-40, 350 mm NaCl, 100 μg of sonicated salmon sperm DNA/ml; resuspended in 125 μlof1% SDS, 16 μg of salmon sperm DNA/ml; and eluted by heating to 85 °C for 10 min. Cross-linking was reversed by incubation of the eluate for 6 h at 65 °C. Samples were diluted with 125 μl of water containing 160 μg of proteinase K/ml and incubated for 1 h at 50 °C. DNA was purified by extraction with phenol/chloroform and precipitated with 2.5 volumes of ethanol containing 5 μg of glycogen/ml and then pelleted by microcentrifugation. The pellets were resuspended in 50 μl of H2O and analyzed by PCR using the following primers to analyze target sites (sites 4 and 5 in Fig. 4A): 5′-GGGCTCTGTCTTTATGGTCTCC-3′ (forward) and 5′-TGCTACTGCCGGAAGTGAC-3′ (reverse). The PCR cycles were 95 °C for 1 min, 65 °C for 1 min, and 72 °C for 2 min. Following 30 cycles of amplification, the PCR products were separated by electrophoresis on a 1.5% agarose gel and analyzed by ethidium bromide staining. Nuclear Extracts—Nuclear extracts were prepared from H4IIE cells plated in 100-mm dishes. Cells were washed twice with ice-cold PBS, harvested with a cell scraper, and centrifuged at 4 °C for 5 min at 1,500 × g. Cell pellets were resuspended in 10 volumes of ice-cold lysis buffer (10 mm HEPES (pH 7.9), 10 mm KCl, 1.5 mm MgCl2, 0.5 mm EDTA, 0.5 mm dithiothreitol, 0.5 mm PMSF, 0.3 mm Na3VO4,5mm NaF, 1× protease inhibitor mixture (Roche Applied Science), and 0.05% Nonidet P-40), incubated on ice for 10 min, and centrifuged for 10 min at 2,000 × g. Nuclear pellets were resuspended in 2 volumes of ice-cold storage buffer (20 mm HEPES (pH 7.9), 10 mm KCl, 1.5 mm MgCl2, 0.5 mm EDTA, 0.3 mm Na3VO4,5mm NaF, 1× mixture of protease inhibitor (Roche Applied Science), 0.5 mm dithiothreitol, 0.5 mm PMSF, 0.1% Nonidet P-40, and 25% glycerol) and incubated on ice for 30 min. After centrifugation for 10 min at 14,000 × g, the supernatant fraction was frozen in aliquots and stored at -80 °C. Electrophoretic Mobility Shift Assays (EMSAs)—Oligonucleotide probes were end-labeled with T4 polynucleotide kinase (New England BioLabs, Beverly, MA). Nuclear extracts (5 or 10 μg of protein) from H4IIE cells were incubated for 15 min at room temperature in the presence of 2 μg of poly(dI-dC) in a reaction mixture containing 25 mm HEPES (pH 7.9), 60 mm KCl, 2.5 mm MgCl2, 0.1 mm EDTA, 0.75 mm dithiothreitol, 1 mm PMSF, 5% glycerol, and the end-labeled oligonucleotide probe(50,000 cpm). For competition assays, the extracts were preincubated with 100-fold molar excess of the unlabeled oligonucleotides. If antibody binding was to be tested, 4 μg of the indicated antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) were preincubated on ice for 30 min with the reaction mixture before adding the labeled probe. The samples were loaded onto a prerun, 16-cm-long, 1.5-mm-thick 4% acrylamide-bisacrylamide (29:1) gel prepared in 1× TBE buffer (89 mm Tris base, 89 mm boric acid, 2 mm EDTA (pH 8.0)). After electrophoresis for 2-3 h at 200 V (at 4 °C), the gel was dried and exposed to Kodak films at -80 °C for 3-24 h with intensifying screens. The radiolabeled bands were detected by autoradiography. Each gel mobility shift assay was repeated with at least two independently prepared nuclear extracts. Western Blotting—Supernatants and nuclear extracts were prepared as described under“Nuclear Extracts.' Then 20 μg of nuclear extract proteins were separated by SDS-PAGE on a 7.5% gel followed by transfer to polyvinylidene difluoride membrane. The membrane was then blocked in a 5% solution of nonfat dry milk prepared in 1× PBS and 0.05% Tween 20. The membrane was then stained with fast green (Sigma). After destaining, the membrane was incubated with a goat polyclonal anti-HNF-4α antibody (Santa Cruz Biotechnology, Inc.). Proteins were detected by enhanced chemiluminescence with horseradish peroxidase-conjugated secondary antibodies (New England BioLabs). Short-chain Fatty Acids Induce Glc-6-Pase Gene Expression—In Northern blotting assays to assess the effects of short-chain fatty acids (acetate, propionate, butyrate, valerate, and caproate) on steady-state levels of Glc-6-Pase mRNA, acetate had no effect, whereas all other short-chain fatty acids tested induced robust increases in Glc-6-Pase mRNA levels in primary cultures of rat hepatocytes (Fig. 1). This effect was genespecific because mRNA levels for glucose-6-phosphate translocase, which is associated with the Glc-6-Pase complex, was not affected by the various fatty acids tested (Fig. 1). Next we wondered whether short-chain fatty acids might affect the expression of another gene encoding a key gluconeogenic enzyme. In this regard, we assessed the effect of the short-chain fatty acids on steady-state levels of PEPCK mRNA. As shown in Fig. 1(third panel from top), the various short-chain fatty acids also increased PEPCK mRNA levels to varying degrees, the most potent being butyrate, which provoked a greater than 5-fold increase in PEPCK mRNA levels. Transcriptional Activation of Glc-6-Pase by Short-chain Fatty Acids Requires DNA Sequence Elements Located in the Non-coding Region—The data in Fig. 1 demonstrate that short-chain fatty acids induce Glc-6-Pase expression from the endogenous promoter. We then used the luciferase reporter gene assay to monitor transcription from the transfected promoter. For these experiments, H4IIE cells were transfected with a -751/+66 bp fragment of the Glc-6-Pase promoter linked to the luciferase reporter gene (-751/+66-LUC) (16Streeper R.S. Svitek C.A. Chapman S. Greenbaum L.E. Taub R. O'Brien R.M. J. Biol. Chem. 1997; 272: 11698-11701Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar), and the transcriptional activity of this promoter construct in the presence of various short-chain fatty acids was then measured. In doseresponse pilot experiments, valerate was the most potent, producing maximal response at 1 mm, while propionate and caproate induced maximal promoter activity at 2.5 mm (data not shown). Therefore, subsequent experiments were carried out with a 2.5 mm concentration of each fatty acid with the exception of valerate, which was used at 1 mm. At these concentrations, caproate and valerate induced a 5-6-fold increase in promoter activity (Fig. 2A); propionate had a much lesser effect (about 2-fold), while acetate and butyrate had little or no effect (Fig. 2A). We also assessed the effect of the short-chain fatty acids on transcription from the PEPCK gene promoter, a promoter that responds also to gluconeogenic stimuli (17Hanson R.W. Reshef L. Annu. Rev. Biochem. 1997; 66: 581-611Crossref PubMed Scopus (631) Google Scholar, 18Roesler W.J. Vandenbark G.R. Hanson R.W. J. Biol. Chem. 1989; 264: 9657-9664Abstract Full Text PDF PubMed Google Scholar, 19Hanson R.W. Patel Y.M. Adv. Enzymol. Relat. Areas Mol. Biol. 1994; 69: 203-281PubMed Google Scholar). When the H4IIE cells were transfected with a -490 bp proximal fragment of the PEPCK gene promoter that has all the necessary elements for hormonal regulation of this gene (20Patel Y.M. Yun J.S. Liu J. McGrane M.M. Hanson R.W. J. Biol. Chem. 1994; 269: 5619-5628Abstract Full Text PDF PubMed Google Scholar, 21Liu J. Hanson R.W. Mol. Cell. Biochem. 1991; 104: 89-100PubMed Google Scholar, 22Liu J.S. Park E.A. Gurney A.L. Roesler W.J. Hanson R.W. J. Biol. Chem. 1991; 266: 19095-19102Abstract Full Text PDF PubMed Google Scholar), the short-chain fatty acids elicited substantial increases in PEPCK gene promoter activity, the most potent being butyrate and valerate, which induced 16-17-fold increases in the activity of the promoter (Fig. 2B). Taken together with the data on the mRNA levels for both PEPCK and Glc-6-Pase (see Fig. 1), these results suggest a concerted response to the inductive effect of these short-chain fatty acids by at least two genes encoding two different gluconeogenic enzymes. The little or no effect of butyrate on the Glc-6-Pase promoter activity was rather surprising considering that this fatty acid induced robust increases not only in Glc-6-Pase mRNA level (see Fig. 1, top panel) but also in PEPCK mRNA levels and PEPCK gene promoter activity (see Fig. 2B). However, it is important to note that in other experiments described in Fig. 5 (A and B), the inductive effect of butyrate on Glc-6-Pase promoter activity was evident when the cells were co-transfected with expression plasmid for HNF-4α, suggesting that the mechanism of induction of this promoter by butyrate may be more complex than that by other short-chain fatty acids. We did not observe cell death in our studies with butyrate as assessed by trypan blue dye exclusion; therefore, apoptosis reported in PLC/PRF/5 hepatoma cells cultured for 72 h with butyrate (23Hung W.C. Chuang L.Y. Br. J. Cancer. 1999; 80: 705-710Crossref PubMed Scopus (21) Google Scholar) was not manifest in our experiments. To identify the fatty acid-responsive region(s) within the Glc-6-Pase promoter, a series of deletions in the -751/+66-LUC construct was created by exonuclease digestion and by PCR. The constructs were then used in transient transfection assays (Fig. 3) with caproate as the test fatty acid. Sequence deletion in the -751/-553 segment resulted in induced promoter activity in both basal (about 4-fold) and fatty acid-stimulated (up to 18-fold) conditions. Deletions in the -466/-276 segment provoked a progressive decline in promoter activity, but beyond -276 bp there was no major effect of the fatty acid. Thus, it is apparent that the -751/-276 region of the promoter accounted for most of the robust transcriptional response to the fatty acid. Similar results were obtained with valerate. Our interest in deciphering the identity of the cis-positive elements that are involved in the transcriptional activation of Glc-6-Pase by the short-chain fatty acids was stimulated by the report (9Rajas F. Gautier A. Bady I. Montano S. Mithieux G. J. Biol. Chem. 2002; 277: 15736-15744Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar) that overexpression of the transcription factor HNF-4α can transactivate the rat Glc-6-Pase promoter in HeLa cells, which normally do not express this gene. It is known that HNF-4α binds DNA as homodimers to the direct repeat of the nucleotide consensus sequence 5′-AGGTCA-3′ separated by one (DR1) or two base pairs (DR2) (24Aranda A. Pascual A. Physiol. Rev. 2001; 81: 1269-1304Crossref PubMed Scopus (1178) Google Scholar). Inspection of the Glc-6-Pase promoter using the TRANSFAC data base (25Heinemeyer T. Chen X. Karas H. Kel A.E. Kel O.V. Liebich I Meinhardt T. Reuter I. Schacherer F. Wingender E. Nucleic Acids Res. 1999; 27: 318-322Crossref PubMed Scopus (271) Google Scholar) shows seven DR motifs as schematized in Fig. 4A. Six of these putative HNF-4-binding sites lie in the -751/-276 region of the promoter. To verify whether these sites actually bind HNF-4, EMSAs were performed. For these assays, we used two labeled probes corresponding to nucleotides -751/-686 (Fig. 4, B, C, and D) and -462/-382 (Fig. 4E) in the Glc-6-Pase gene promoter. The -751/-686 probe contains sites 1 and 2, while the -462/-382 probe contains sites 4 and 5 in Fig. 4A. Three or four protein-DNA complexes (see arrows in Fig. 4) were detected with both probes; with the -462/-382 probe the signals were more intense than with the -751/-686 probe, suggesting that binding sites in this probe may have higher affinity for HNF-4 than sites in the -751/-686 probe. In both cases, unlabeled probes competitively displaced these complexes as expected. In experiments with the -751/-686 probe, an oligonucleotide (CCAAGGTCACCATGTCATTT) (-749/-726) that contained the sequence (underlined) identified as site 1 in Fig. 4A was an effective competitor against the formation of these complexes (Fig. 4C, lanes 4 and 5 versus lanes 2 and 3). Against this probe, an oligonucleotide (TCCAGGACAACAAAGCCCTAC) (-459/-439) that contained the sequence (underlined) identified as site 4 in Fig. 4A was not as effective a competitor as the -749/-726 oligonucleotide (Fig. 4D, lanes 4 and 5 versus lanes 2 and 3), although some displacement was noticeable. This was not surprising since site 4 is absent in the -751/-686 probe. However, in experiments conducted with the -462/-382 probe (Fig. 4E), this oligonucleotide (i.e. TCCAGGACAACAAAGCCCTAC) (-459/-439) was a much better competitor against this probe (Fig. 4E, lanes 6 and 7 versus lanes 2 and 3) than against the -751/-686 probe (see Fig. 4D). This is consistent with the fact that site 4 is absent in the -751/-686 probe. Because the two probes used for these assays contain four of the seven DR motifs in the Glc-6-Pase gene promoter, we interpret these oligonucleotide competition data to mean that one or more of these sites can bind HNF-4α. To confirm this notion, anti-HNF-4α antibodies were used in the gel mobility shift assays. Although no clearly defined supershifted band was discernible, band intensity of the slowest moving band decreased in the presence of anti-HNF-4α antibodies (Fig. 4, B and E, compare lane 2 with lane 4 and lane 3 with lane 5 for both panels), a phenomenon usually indicating that the antibodies may be preventing DNA binding or that proteins binding to sequences adjacent to the transcription factor-binding site(s) interfere with binding of transcription factor to the probe used (26Carey M. Smale S.T. Transcriptional Regulation in Eukaryotes: Concept, Strategies, and Techniques. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY2000: 266-268Google Scholar). These results are consistent with the interpretation that HNF-4α is contained in the protein component of this complex. If HNF-4α were relevant for short-chain fatty acid-induced regulation of Glc-6-Pase gene expression, then transfection of plasmids harboring the gene for HNF-4α would be expected to increase transcription from the Glc-6-Pase gene promoter. Conversely transfection of dominant negative HNF-4α should interfere with transcription from this promoter. Both experimental approaches were utilized in this study. First, using the wild-type promoter (-751/+66-LUC) and a truncated version (-553/+66-LUC) that exhibited the highest promoter activity as seen in Fig. 3, co-transfection with an expression plasmid for HNF-4α provoked robust increases in promoter activity in response to various short-chain fatty acids as well as to octanoate, a medium-chain fatty acid (Fig. 5, A and B). With the wild-type promoter construct (-751/+66-LUC), transcriptional re" @default.
• W2073008220 created "2016-06-24" @default.
• W2073008220 creator A5006874803 @default.
• W2073008220 creator A5012762595 @default.
• W2073008220 creator A5053656145 @default.
• W2073008220 creator A5055642743 @default.
• W2073008220 date "2003-10-01" @default.
• W2073008220 modified "2023-10-18" @default.
• W2073008220 title "Regulation of Glucose-6-phosphatase Gene Expression in Cultured Hepatocytes and H4IIE Cells by Short-chain Fatty Acids" @default.
• W2073008220 cites W1506966309 @default.
• W2073008220 cites W1511443862 @default.
• W2073008220 cites W1518205060 @default.
• W2073008220 cites W1526998224 @default.
• W2073008220 cites W1527396710 @default.
• W2073008220 cites W1553229669 @default.
• W2073008220 cites W1563624749 @default.
• W2073008220 cites W1585252702 @default.
• W2073008220 cites W1919133853 @default.
• W2073008220 cites W1963507142 @default.
• W2073008220 cites W1971690128 @default.
• W2073008220 cites W1987284343 @default.
• W2073008220 cites W1988362340 @default.
• W2073008220 cites W1993736467 @default.
• W2073008220 cites W2007044047 @default.
• W2073008220 cites W2026441085 @default.
• W2073008220 cites W2032019900 @default.
• W2073008220 cites W2035026805 @default.
• W2073008220 cites W2036639816 @default.
• W2073008220 cites W2036649917 @default.
• W2073008220 cites W2043605055 @default.
• W2073008220 cites W2053510126 @default.
• W2073008220 cites W2054696920 @default.
• W2073008220 cites W2060696024 @default.
• W2073008220 cites W2070424667 @default.
• W2073008220 cites W2087247206 @default.
• W2073008220 cites W2092901567 @default.
• W2073008220 cites W2114683402 @default.
• W2073008220 cites W2116233022 @default.
• W2073008220 cites W2118161551 @default.
• W2073008220 cites W2121973484 @default.
• W2073008220 cites W2123687793 @default.
• W2073008220 cites W2133208346 @default.
• W2073008220 cites W2138907486 @default.
• W2073008220 cites W2139731427 @default.
• W2073008220 cites W2150012875 @default.
• W2073008220 cites W2154755276 @default.
• W2073008220 cites W2160307370 @default.
• W2073008220 cites W2162244331 @default.
• W2073008220 cites W2165427270 @default.
• W2073008220 cites W2168466279 @default.
• W2073008220 cites W2326576739 @default.
• W2073008220 cites W2340743577 @default.
• W2073008220 cites W91590527 @default.
• W2073008220 cites W99191881 @default.
• W2073008220 cites W2038831281 @default.
• W2073008220 doi "https://doi.org/10.1074/jbc.m303182200" @default.
• W2073008220 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12915406" @default.
• W2073008220 hasPublicationYear "2003" @default.
• W2073008220 type Work @default.
• W2073008220 sameAs 2073008220 @default.
• W2073008220 citedByCount "41" @default.
• W2073008220 countsByYear W20730082202012 @default.
• W2073008220 countsByYear W20730082202013 @default.
• W2073008220 countsByYear W20730082202014 @default.
• W2073008220 countsByYear W20730082202015 @default.
• W2073008220 countsByYear W20730082202016 @default.
• W2073008220 countsByYear W20730082202018 @default.
• W2073008220 countsByYear W20730082202019 @default.
• W2073008220 countsByYear W20730082202020 @default.
• W2073008220 countsByYear W20730082202021 @default.
• W2073008220 crossrefType "journal-article" @default.
• W2073008220 hasAuthorship W2073008220A5006874803 @default.
• W2073008220 hasAuthorship W2073008220A5012762595 @default.
• W2073008220 hasAuthorship W2073008220A5053656145 @default.
• W2073008220 hasAuthorship W2073008220A5055642743 @default.
• W2073008220 hasBestOaLocation W20730082201 @default.
• W2073008220 hasConcept C104317684 @default.
• W2073008220 hasConcept C150194340 @default.
• W2073008220 hasConcept C153911025 @default.
• W2073008220 hasConcept C160160445 @default.
• W2073008220 hasConcept C178666793 @default.
• W2073008220 hasConcept C181199279 @default.
• W2073008220 hasConcept C185592680 @default.
• W2073008220 hasConcept C202751555 @default.
• W2073008220 hasConcept C2776200302 @default.
• W2073008220 hasConcept C2779202576 @default.
• W2073008220 hasConcept C55493867 @default.
• W2073008220 hasConcept C86803240 @default.
• W2073008220 hasConceptScore W2073008220C104317684 @default.
• W2073008220 hasConceptScore W2073008220C150194340 @default.
• W2073008220 hasConceptScore W2073008220C153911025 @default.
• W2073008220 hasConceptScore W2073008220C160160445 @default.
• W2073008220 hasConceptScore W2073008220C178666793 @default.
• W2073008220 hasConceptScore W2073008220C181199279 @default.
• W2073008220 hasConceptScore W2073008220C185592680 @default.
• W2073008220 hasConceptScore W2073008220C202751555 @default.
• W2073008220 hasConceptScore W2073008220C2776200302 @default.
• W2073008220 hasConceptScore W2073008220C2779202576 @default.

• next