FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2073430587> ?p ?o ?g. }

• W2073430587 endingPage "12419" @default.
• W2073430587 startingPage "12410" @default.
• W2073430587 abstract "Intersectin-short (intersectin-s) is a multimodule scaffolding protein functioning in constitutive and regulated forms of endocytosis in non-neuronal cells and in synaptic vesicle (SV) recycling at the neuromuscular junction of Drosophila and Caenorhabditis elegans. In vertebrates, alternative splicing generates a second isoform, intersectin-long (intersectin-l), that contains additional modular domains providing a guanine nucleotide exchange factor activity for Cdc42. In mammals, intersectin-s is expressed in multiple tissues and cells, including glia, but excluded from neurons, whereas intersectin-l is a neuron-specific isoform. Thus, intersectin-I may regulate multiple forms of endocytosis in mammalian neurons, including SV endocytosis. We now report, however, that intersectin-l is localized to somatodendritic regions of cultured hippocampal neurons, with some juxtanuclear accumulation, but is excluded from synaptophysin-labeled axon terminals. Consistently, intersectin-l knockdown (KD) does not affect SV recycling. Instead intersectin-l co-localizes with clathrin heavy chain and adaptor protein 2 in the somatodendritic region of neurons, and its KD reduces the rate of transferrin endocytosis. The protein also co-localizes with F-actin at dendritic spines, and intersectin-l KD disrupts spine maturation during development. Our data indicate that intersectin-l is indeed an important regulator of constitutive endocytosis and neuronal development but that it is not a prominent player in the regulated endocytosis of SVs. Intersectin-short (intersectin-s) is a multimodule scaffolding protein functioning in constitutive and regulated forms of endocytosis in non-neuronal cells and in synaptic vesicle (SV) recycling at the neuromuscular junction of Drosophila and Caenorhabditis elegans. In vertebrates, alternative splicing generates a second isoform, intersectin-long (intersectin-l), that contains additional modular domains providing a guanine nucleotide exchange factor activity for Cdc42. In mammals, intersectin-s is expressed in multiple tissues and cells, including glia, but excluded from neurons, whereas intersectin-l is a neuron-specific isoform. Thus, intersectin-I may regulate multiple forms of endocytosis in mammalian neurons, including SV endocytosis. We now report, however, that intersectin-l is localized to somatodendritic regions of cultured hippocampal neurons, with some juxtanuclear accumulation, but is excluded from synaptophysin-labeled axon terminals. Consistently, intersectin-l knockdown (KD) does not affect SV recycling. Instead intersectin-l co-localizes with clathrin heavy chain and adaptor protein 2 in the somatodendritic region of neurons, and its KD reduces the rate of transferrin endocytosis. The protein also co-localizes with F-actin at dendritic spines, and intersectin-l KD disrupts spine maturation during development. Our data indicate that intersectin-l is indeed an important regulator of constitutive endocytosis and neuronal development but that it is not a prominent player in the regulated endocytosis of SVs. Clathrin-mediated endocytosis (CME) 4The abbreviations used are: CME, clathrin-mediated endocytosis; SV, synaptic vesicle; CHC, clathrin heavy chain; AP-2, adaptor protein-2; SH3, Src homology 3; intersectin-l, intersectin-long; intersectin-s, intersectin-short; GEF, guanine nucleotide exchange factor; DS, Down syndrome; DIV, days in vitro; miRNA, microRNA; TRITC, tetramethylrhodamine isothiocyanate; KD, knockdown; TGN, trans-Golgi network; EmGFP, emerald green fluorescent protein. is a major mechanism by which cells take up nutrients, control the surface levels of multiple proteins, including ion channels and transporters, and regulate the coupling of signaling receptors to downstream signaling cascades (1Kobayashi T. Gu F. Gruenberg J. Semin. Cell Dev. Biol. 1998; 9: 517-526Crossref PubMed Scopus (106) Google Scholar, 2Conner S.D. Schmid S.L. Nature. 2003; 422: 37-44Crossref PubMed Scopus (3071) Google Scholar, 3Moos T. Rosengren Nielsen T. Skjorringe T. Morgan E.H. J. Neurochem. 2007; 103: 1730-1740Crossref PubMed Scopus (321) Google Scholar, 4von Zastrow M. Sorkin A. Curr. Opin. Cell Biol. 2007; 19: 436-445Crossref PubMed Scopus (223) Google Scholar, 5Hanyaloglu A.C. von Zastrow M. Annu. Rev. Pharmacol. Toxicol. 2008; 48: 537-568Crossref PubMed Scopus (472) Google Scholar). In neurons, CME takes on additional specialized roles; it is an important process regulating synaptic vesicle (SV) availability through endocytosis and recycling of SV membranes (6Sara Y. Mozhayeva M.G. Liu X. Kavalali E.T. J. Neurosci. 2002; 22: 1608-1617Crossref PubMed Google Scholar, 7Mani M. Lee S.Y. Lucast L. Cremona O. Di Paolo G. De Camilli P. Ryan T.A. Neuron. 2007; 56: 1004-1018Abstract Full Text Full Text PDF PubMed Scopus (141) Google Scholar), it shapes synaptic plasticity (8Wu L.G. Betz W.J. Biophys. J. 1998; 74: 3003-3009Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar, 9Evergren E. Zotova E. Brodin L. Shupliakov O. Neuroscience. 2006; 141: 123-131Crossref PubMed Scopus (19) Google Scholar, 10Kavalali E.T. J. Physiol. 2007; 585: 669-679Crossref PubMed Scopus (31) Google Scholar), and it is crucial in maintaining synaptic membranes and membrane structure (11Poodry C.A. Edgar L. J. Cell Biol. 1979; 81: 520-527Crossref PubMed Scopus (140) Google Scholar). Numerous endocytic accessory proteins participate in CME, interacting with each other and with core components of the endocytic machinery such as clathrin heavy chain (CHC) and adaptor protein-2 (AP-2) through specific modules and peptide motifs (12McPherson P.S. Ritter B. Mol. Neurobiol. 2005; 32: 73-87Crossref PubMed Google Scholar). One such module is the Eps15 homology domain that binds to proteins bearing NPF motifs (13Salcini A.E. Confalonieri S. Doria M. Santolini E. Tassi E. Minenkova O. Cesareni G. Pelicci P.G. Di Fiore P.P. Genes Dev. 1997; 11: 2239-2249Crossref PubMed Scopus (286) Google Scholar, 14Montesinos M.L. Castellano-Munoz M. Garcia-Junco-Clemente P. Fernandez-Chacon R. Brain Res. 2005; 49: 416-428Crossref Scopus (29) Google Scholar). Another is the Src homology 3 (SH3) domain, which binds to proline-rich domains in protein partners (15McPherson P.S. Cell Signal. 1999; 11: 229-238Crossref PubMed Scopus (89) Google Scholar). Intersectin is a multimodule scaffolding protein that interacts with a wide range of proteins, including several involved in CME (16Yamabhai M. Hoffman N.G. Hardison N.L. McPherson P.S. Castagnoli L. Cesareni G. Kay B.K. J. Biol. Chem. 1998; 273: 31401-31407Abstract Full Text Full Text PDF PubMed Scopus (246) Google Scholar). Intersectin has two N-terminal Eps15 homology domains that are responsible for binding to epsin, SCAMP1, and numb (17Sengar A.S. Wang W. Bishay J. Cohen S. Egan S.E. EMBO J. 1999; 18: 1159-1171Crossref PubMed Scopus (182) Google Scholar, 18Fernandez-Chacon R. Achiriloaie M. Janz R. Albanesi J.P. Sudhof T.C. J. Biol. Chem. 2000; 275: 12752-12756Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar, 19Nishimura T. Yamaguchi T. Tokunaga A. Hara A. Hamaguchi T. Kato K. Iwamatsu A. Okano H. Kaibuchi K. Mol. Biol. Cell. 2006; 17: 1273-1285Crossref PubMed Scopus (90) Google Scholar), a central coil-coiled domain that interacts with Eps15 and SNAP-23 and -25 (17Sengar A.S. Wang W. Bishay J. Cohen S. Egan S.E. EMBO J. 1999; 18: 1159-1171Crossref PubMed Scopus (182) Google Scholar, 20Okamoto M. Schoch S. Sudhof T.C. J. Biol. Chem. 1999; 274: 18446-18454Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar, 21Wang W. Bouhours M. Gracheva E.O. Liao E.H. Xu K. Sengar A.S. Xin X. Roder J. Boone C. Richmond J.E. Zhen M. Egan S.E. Traffic. 2008; 9: 742-754Crossref PubMed Scopus (31) Google Scholar), and five SH3 domains in its C-terminal region that interact with multiple proline-rich domain proteins, including synaptojanin, dynamin, N-WASP, CdGAP, and mSOS (16Yamabhai M. Hoffman N.G. Hardison N.L. McPherson P.S. Castagnoli L. Cesareni G. Kay B.K. J. Biol. Chem. 1998; 273: 31401-31407Abstract Full Text Full Text PDF PubMed Scopus (246) Google Scholar, 22Tong X.K. Hussain N.K. de Heuvel E. Kurakin A. Abi-Jaoude E. Quinn C.C. Olson M.F. Marais R. Baranes D. Kay B.K. McPherson P.S. EMBO J. 2000; 19: 1263-1271Crossref PubMed Scopus (82) Google Scholar, 23Hussain N.K. Jenna S. Glogauer M. Quinn C.C. Wasiak S. Guipponi M. Antonarakis S.E. Kay B.K. Stossel T.P. Lamarche-Vane N. McPherson P.S. Nat. Cell Biol. 2001; 3: 927-932Crossref PubMed Scopus (300) Google Scholar, 24Irie F. Yamaguchi Y. Nat. Neurosci. 2002; 5: 1117-1118Crossref PubMed Scopus (234) Google Scholar, 25Jenna S. Hussain N.K. Danek E.I. Triki I. Wasiak S. McPherson P.S. Lamarche-Vane N. J. Biol. Chem. 2002; 277: 6366-6373Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). The rich binding capability of intersectin has linked it to various functions from CME (17Sengar A.S. Wang W. Bishay J. Cohen S. Egan S.E. EMBO J. 1999; 18: 1159-1171Crossref PubMed Scopus (182) Google Scholar, 26Hussain N.K. Yamabhai M. Ramjaun A.R. Guy A.M. Baranes D. O'Bryan J.P. Der C.J. Kay B.K. McPherson P.S. J. Biol. Chem. 1999; 274: 15671-15677Abstract Full Text Full Text PDF PubMed Scopus (151) Google Scholar, 27Simpson F. Hussain N.K. Qualmann B. Kelly R.B. Kay B.K. McPherson P.S. Schmid S.L. Nat. Cell Biol. 1999; 1: 119-124Crossref PubMed Scopus (233) Google Scholar) and signaling (22Tong X.K. Hussain N.K. de Heuvel E. Kurakin A. Abi-Jaoude E. Quinn C.C. Olson M.F. Marais R. Baranes D. Kay B.K. McPherson P.S. EMBO J. 2000; 19: 1263-1271Crossref PubMed Scopus (82) Google Scholar, 28Ma Y.J. Okamoto M. Gu F. Obata K. Matsuyama T. Desaki J. Tanaka J. Sakanaka M. J. Neurosci. Res. 2003; 71: 468-477Crossref PubMed Scopus (21) Google Scholar, 29Mohney R.P. Das M. Bivona T.G. Hanes R. Adams A.G. Philips M.R. O'Bryan J.P. J. Biol. Chem. 2003; 278: 47038-47045Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar) to mitogenesis (30Adams A. Thorn J.M. Yamabhai M. Kay B.K. O'Bryan J.P. J. Biol. Chem. 2000; 275: 27414-27420Abstract Full Text Full Text PDF PubMed Google Scholar, 31O'Bryan J.P. Mohney R.P. Oldham C.E. Oncogene. 2001; 20: 6300-6308Crossref PubMed Scopus (51) Google Scholar) and regulation of the actin cytoskeleton (23Hussain N.K. Jenna S. Glogauer M. Quinn C.C. Wasiak S. Guipponi M. Antonarakis S.E. Kay B.K. Stossel T.P. Lamarche-Vane N. McPherson P.S. Nat. Cell Biol. 2001; 3: 927-932Crossref PubMed Scopus (300) Google Scholar). Intersectin functions in SV recycling at the neuromuscular junction of Drosophila and C. elegans where it acts as a scaffold, regulating the synaptic levels of endocytic accessory proteins (21Wang W. Bouhours M. Gracheva E.O. Liao E.H. Xu K. Sengar A.S. Xin X. Roder J. Boone C. Richmond J.E. Zhen M. Egan S.E. Traffic. 2008; 9: 742-754Crossref PubMed Scopus (31) Google Scholar, 32Koh T.W. Verstreken P. Bellen H.J. Neuron. 2004; 43: 193-205Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar, 33Marie B. Sweeney S.T. Poskanzer K.E. Roos J. Kelly R.B. Davis G.W. Neuron. 2004; 43: 207-219Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar, 34Rose S. Malabarba M.G. Krag C. Schultz A. Tsushima H. Di Fiore P.P. Salcini A.E. Mol. Biol. Cell. 2007; 18: 5091-5099Crossref PubMed Google Scholar). In vertebrates, the intersectin gene is subject to alternative splicing, and a longer isoform (intersectin-l) is generated that is expressed exclusively in neurons (26Hussain N.K. Yamabhai M. Ramjaun A.R. Guy A.M. Baranes D. O'Bryan J.P. Der C.J. Kay B.K. McPherson P.S. J. Biol. Chem. 1999; 274: 15671-15677Abstract Full Text Full Text PDF PubMed Scopus (151) Google Scholar, 28Ma Y.J. Okamoto M. Gu F. Obata K. Matsuyama T. Desaki J. Tanaka J. Sakanaka M. J. Neurosci. Res. 2003; 71: 468-477Crossref PubMed Scopus (21) Google Scholar, 35Tsyba L. Skrypkina I. Rynditch A. Nikolaienko O. Ferenets G. Fortna A. Gardiner K. Genomics. 2004; 84: 106-113Crossref PubMed Scopus (21) Google Scholar, 36Yu Y. Chu P.Y. Bowser D.N. Keating D.J. Dubach D. Harper I. Tkalcevic J. Finkelstein D.I. Pritchard M.A. Hum. Mol. Genet. 2008; 17: 3281-3290Crossref PubMed Scopus (72) Google Scholar). This isoform has all the binding modules of its short (intersectin-s) counterpart but also has additional domains: a DH and a PH domain that provide guanine nucleotide exchange factor (GEF) activity specific for Cdc42 (23Hussain N.K. Jenna S. Glogauer M. Quinn C.C. Wasiak S. Guipponi M. Antonarakis S.E. Kay B.K. Stossel T.P. Lamarche-Vane N. McPherson P.S. Nat. Cell Biol. 2001; 3: 927-932Crossref PubMed Scopus (300) Google Scholar, 37Snyder J.T. Worthylake D.K. Rossman K.L. Betts L. Pruitt W.M. Siderovski D.P. Der C.J. Sondek J. Nat. Struct. Biol. 2002; 9: 468-475Crossref PubMed Scopus (191) Google Scholar) and a C2 domain at the C terminus. Through its GEF activity and binding to actin regulatory proteins, including N-WASP, intersectin-l has been implicated in actin regulation and the development of dendritic spines (19Nishimura T. Yamaguchi T. Tokunaga A. Hara A. Hamaguchi T. Kato K. Iwamatsu A. Okano H. Kaibuchi K. Mol. Biol. Cell. 2006; 17: 1273-1285Crossref PubMed Scopus (90) Google Scholar, 23Hussain N.K. Jenna S. Glogauer M. Quinn C.C. Wasiak S. Guipponi M. Antonarakis S.E. Kay B.K. Stossel T.P. Lamarche-Vane N. McPherson P.S. Nat. Cell Biol. 2001; 3: 927-932Crossref PubMed Scopus (300) Google Scholar, 24Irie F. Yamaguchi Y. Nat. Neurosci. 2002; 5: 1117-1118Crossref PubMed Scopus (234) Google Scholar). In addition, because the rest of the binding modules are shared between intersectin-s and -l, it is generally thought that the two intersectin isoforms have the same endocytic functions. In particular, given the well defined role for the invertebrate orthologs of intersectin-s in SV endocytosis, it is thought that intersectin-l performs this role in mammalian neurons, which lack intersectin-s. Defining the complement of intersectin functional activities in mammalian neurons is particularly relevant given that the protein is involved in the pathophysiology of Down syndrome (DS). Specifically, the intersectin gene is localized on chromosome 21q22.2 and is overexpressed in DS brains (38Pucharcós C. Fuentes J.J. Casas C. de la Luna S. Alcántara S. Arbonés M.L. Soriano E. Estivill X. Pritchard M. Eur. J. Hum. Genet. 1999; 7: 704-712Crossref PubMed Scopus (67) Google Scholar). Interestingly, alterations in endosomal pathways are a hallmark of DS neurons and neurons from the partial trisomy 16 mouse, Ts65Dn, a model for DS (39Cataldo A.M. Peterhoff C.M. Troncoso J.C. Gomez-Isla T. Hyman B.T. Nixon R.A. Am. J. Pathol. 2000; 157: 277-286Abstract Full Text Full Text PDF PubMed Scopus (618) Google Scholar, 40Cataldo A.M. Petanceska S. Peterhoff C.M. Terio N.B. Epstein C.J. Villar A. Carlson E.J. Staufenbiel M. Nixon R.A. J. Neurosci. 2003; 23: 6788-6792Crossref PubMed Google Scholar). Thus, an endocytic trafficking defect may contribute to the DS disease process. Here, the functional roles of intersectin-l were studied in cultured hippocampal neurons. We find that intersectin-l is localized to the somatodendritic regions of neurons, where it co-localizes with CHC and AP-2 and regulates the uptake of transferrin. Intersectin-l also co-localizes with actin at dendritic spines and disrupting intersectin-l function alters dendritic spine development. In contrast, intersectin-l is absent from presynaptic terminals and has little or no role in SV recycling. Neuronal Cultures and Transfections—Experiments were performed on primary hippocampal cultures from E18 rats, prepared as described (41Burman J.L. Wasiak S. Ritter B. de Heuvel E. McPherson P.S. FEBS Lett. 2005; 579: 2177-2184Crossref PubMed Scopus (22) Google Scholar) and maintained in culture from between 10 and 21 days in vitro (DIV). Neurons were grown in Neurobasal medium supplemented with penicillin/streptomycin, l-glutamine, B-27, and N-2 supplements (Invitrogen). At 4-7 DIV, neurons were transduced with lentivirus (see below) or transfected using Lipofectamine 2000 (Invitrogen), following the manufacturer's guidelines. miRNA Vectors and Viruses—Three separate microRNA (miRNA) sequences (intersectin #1, #2, and #3) were generated to target rat intersectin-l. Intersectin #1 and #2 are against regions that are also found in intersectin-s, whereas intersectin #3 is specific to intersectin-l. The sequences target intersectin-l mRNA starting at nucleotides 2085 (intersectin #1), 2205 (intersectin #2), and 5337 (intersectin #3) and are CAAGCCGGAAGTGCAAGACAA, GAGTGCCAAAGTGGTGTATTA, and GGTCTTGTCATGGCTTCTAGA, respectively. A non-targeting miRNA was used for controls, and its sequence is AATTCTCCGAACGTGTCACGT. Oligonucleotides encoding the miRNA sequences were cloned into pcDNA 6.2-GW/EmGFP-miR plasmid (Invitrogen). The EmGFP-miR cassette was then amplified by PCR and subcloned into the pRRLsinPPT vector, and VSVG pseudotyped virus was produced in HEK-293T cells. Virus particles were purified by ultracentrifugation and titered in HEK-293T cells. Antibodies for Immunofluorescence and Western Blots—Mouse monoclonal antibodies against the following proteins were from the indicated source: intersectin (ESE-1) and AP-1 (BD Bioscience, Franklin Lakes, NJ); PSD95 (mab-045, ABR); synaptophysin (clone SVP38, Sigma); CHC (X22 produced from hybridomas purchased from ATCC); and α-adaptin (AP.6, ABR). F-actin was stained with TRITC-phalloidin (Sigma). Rabbit polyclonal antibodies for intersectin (27Simpson F. Hussain N.K. Qualmann B. Kelly R.B. Kay B.K. McPherson P.S. Schmid S.L. Nat. Cell Biol. 1999; 1: 119-124Crossref PubMed Scopus (233) Google Scholar) and clathrin light chain (42Allaire P.D. Ritter B. Thomas S. Burman J.L. Denisov A.Y. Legendre-Guillemin V. Harper S.Q. Davidson B.L. Gehring K. McPherson P.S. J. Neurosci. 2006; 26: 13202-13212Crossref PubMed Scopus (54) Google Scholar) have been described previously. For immunofluorescence, fluorophore-conjugated secondary antibodies were from Jackson ImmunoResearch laboratories and Invitrogen. Immunofluorescence images were acquired with a Zeiss LSM 510 Meta confocal inverted microscope using Plan-Apochromat 63× (numerical aperture, 1.4) or 100× (numerical aperture, 1.4) lenses. Endocytosis Assays—FM4-64 uptake and analysis were performed as previously described (42Allaire P.D. Ritter B. Thomas S. Burman J.L. Denisov A.Y. Legendre-Guillemin V. Harper S.Q. Davidson B.L. Gehring K. McPherson P.S. J. Neurosci. 2006; 26: 13202-13212Crossref PubMed Scopus (54) Google Scholar). For CME of transferrin, neuronal cultures were starved with unsupplemented Neurobasal media overnight prior to the experiment. Alexa-Fluor 546-transferrin (Invitrogen) was diluted to 12.5 μg/ml in Hanks' balanced salt solution (Invitrogen) and was continuously perfused in the imaging chamber during the entire length of live cell imaging. For quantification, regions of interest were drawn to outline the somatodendritic regions of neurons using ImageJ software (NIH). Total fluorescence in the regions of interest was measured and plotted over time. A linear regression was performed on the fluorescence time courses to calculate the rate of uptake. Uptake rates were averaged over multiple experiments as indicated in the legend to Fig. 6. Analysis of Dendritic Spines—Primary hippocampal cultures at 9-11 DIV were transferred to a recording chamber mounted on an upright confocal microscope (DMLFSA, Leica Microsystems, Heidelberg, Germany) with a Leica SP2 scanhead, and cultures were continuously perfused with ∼30 °C Hanks' balanced salt solution. EmGFP-labeled tertiary dendrites were imaged with a Leica 63× (numerical aperture, 0.9) water immersion lens in three-dimensional stacks with voxel dimensions of 61 × 61 × 250-300 nm. Areas of interest were cropped and further processed for deconvolution using Huygens Pro Software (Scientific Volume Imaging, Hilversum, The Netherlands) through a full maximum likelihood extrapolation algorithm. Volume rendering and quantification was carried out using Imaris software (Bitplane, Zurich). Dendritic spines were quantified as previously described (43McKinney R.A. Capogna M. Dürr R. Gähwiler B.H. Thompson S.M. Nat. Neurosci. 1999; 2: 44-49Crossref PubMed Scopus (439) Google Scholar). Briefly, spines that have short necks but a large, mushroom-shaped head correspond to the “mushroom” class. Spines that have an elongated neck (>1 μm in length) but only a small head correspond to the “long-thin” class. In addition, “filopodia”-type protrusions were typically >3 μm in length, lacking a distinct head, similar to those found during synaptogenesis (44Fiala J.C. Feinberg M. Popov V. Harris K.M. J. Neurosci. 1998; 18: 8900-8911Crossref PubMed Google Scholar). Intersectin Knockdown Does Not Affect SV Recycling in Hippocampal Neurons—Intersectin has been shown to be present and to regulate SV recycling at invertebrate neuromuscular synapses (21Wang W. Bouhours M. Gracheva E.O. Liao E.H. Xu K. Sengar A.S. Xin X. Roder J. Boone C. Richmond J.E. Zhen M. Egan S.E. Traffic. 2008; 9: 742-754Crossref PubMed Scopus (31) Google Scholar, 32Koh T.W. Verstreken P. Bellen H.J. Neuron. 2004; 43: 193-205Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar, 33Marie B. Sweeney S.T. Poskanzer K.E. Roos J. Kelly R.B. Davis G.W. Neuron. 2004; 43: 207-219Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar, 34Rose S. Malabarba M.G. Krag C. Schultz A. Tsushima H. Di Fiore P.P. Salcini A.E. Mol. Biol. Cell. 2007; 18: 5091-5099Crossref PubMed Google Scholar). Because invertebrates only express orthologs of intersectin-s, and intersectin-s is not expressed in mammalian neurons (26Hussain N.K. Yamabhai M. Ramjaun A.R. Guy A.M. Baranes D. O'Bryan J.P. Der C.J. Kay B.K. McPherson P.S. J. Biol. Chem. 1999; 274: 15671-15677Abstract Full Text Full Text PDF PubMed Scopus (151) Google Scholar, 28Ma Y.J. Okamoto M. Gu F. Obata K. Matsuyama T. Desaki J. Tanaka J. Sakanaka M. J. Neurosci. Res. 2003; 71: 468-477Crossref PubMed Scopus (21) Google Scholar, 35Tsyba L. Skrypkina I. Rynditch A. Nikolaienko O. Ferenets G. Fortna A. Gardiner K. Genomics. 2004; 84: 106-113Crossref PubMed Scopus (21) Google Scholar, 36Yu Y. Chu P.Y. Bowser D.N. Keating D.J. Dubach D. Harper I. Tkalcevic J. Finkelstein D.I. Pritchard M.A. Hum. Mol. Genet. 2008; 17: 3281-3290Crossref PubMed Scopus (72) Google Scholar), it is possible that intersectin-l fulfills this function in vertebrates including mammals. In fact, in lamprey, which expresses intersectin-l, disruption of intersectin function through injection of antibodies or overexpression of SH3 domains disrupts CME of SVs, although these reagents do not distinguish intersectin-s from intersectin-l (45Evergren E. Gad H. Walther K. Sundborger A. Tomilin N. Shupliakov O. J. Neurosci. 2007; 27: 379-390Crossref PubMed Scopus (71) Google Scholar). To test for a possible role for intersectin-l in SV recycling in mammalian neurons, we first analyzed its localization in hippocampal cultures. When neurons expressing monomeric red fluorescent protein to reveal cell morphology were stained for intersectin, the protein was found in puncta that were distributed in neuronal processes and throughout the cell body (Fig. 1A). Double labeling immunofluorescence with an antibody against synaptophysin, a marker of axonal boutons revealed little or no co-localization of intersectin with synaptophysin (Fig. 1, A and B). This result is in fact entirely consistent with the recent observation of Nishimura et al. (19Nishimura T. Yamaguchi T. Tokunaga A. Hara A. Hamaguchi T. Kato K. Iwamatsu A. Okano H. Kaibuchi K. Mol. Biol. Cell. 2006; 17: 1273-1285Crossref PubMed Scopus (90) Google Scholar) that GFP-intersectin-l transfected in hippocampal neurons does not co-localize with synaptophysin. Thus, intersectin does not appear to be a major component of pre-synaptic boutons but is instead localized to somatodendritic regions. Recently, Yu et al. (36Yu Y. Chu P.Y. Bowser D.N. Keating D.J. Dubach D. Harper I. Tkalcevic J. Finkelstein D.I. Pritchard M.A. Hum. Mol. Genet. 2008; 17: 3281-3290Crossref PubMed Scopus (72) Google Scholar) demonstrated that intersectin null mice display a subtle but significant slowing of SV endocytosis. Thus, despite the fact there is little or no intersectin expression in the presynaptic compartment of hippocampal neurons, we sought to examine for possible defects in CME of SVs using a loss-of-function approach. To this end, we took advantage of a lentiviral system that we have developed to deliver inhibitory miRNA into post-mitotic cells, including neurons. 5B. Ritter and P.S. McPherson, unpublished results. We used three different miRNA sequences to KD intersectin-l in neurons. Two of the miRNAs (intersectin #1 and #2) target sequences that are common with intersectin-s, whereas a third miRNA (intersectin #3) targets a sequence specific to intersectin-l. Neuronal cultures transduced with the various intersectin targeted viruses or a control virus were lysed and processed for Western blot analysis. Intersectin #1- and #2-encoding viruses caused a decrease in the levels of both intersectin-s (∼140 kDa) and intersectin-l (∼190 kDa) as detected with two different antibodies (Fig. 2A). Intersectin #3 miRNA caused a selective decrease in the level of intersectin-l with no affect on the level of intersectin-s coming from glia (Fig. 2A). The levels of the multiple variants of clathrin light chains serve as loading controls and are equivalent between samples. Intersectin KD was also readily detectable by immunofluorescence where images from cultures treated with different miRNA-encoding viruses and control virus were taken with the same microscope settings (Fig. 2B). Alternatively, we used transfection of miRNA-encoding plasmids. Neurons transfected with the various intersectin miRNAs showed reduced intersectin immunofluorescence staining (Fig. 2C). These data demonstrate the effectiveness of the intersectin KD, and, importantly, they indicate that the immunofluorescence signal seen with the intersectin antibody is specific for intersectin. We also observed that intersectin miRNAs targeting the region of intersectin-l common with intersectin-s were able to eliminate intersectin staining in glia, whereas the intersectin-l-specific miRNA did not affect the levels of intersectin in glial cells (data not shown). Thus, the intersectin miRNA-encoding reagents are effective for intersectin KD. We measured SV endocytosis with the membrane dye FM4-64 as previously described (42Allaire P.D. Ritter B. Thomas S. Burman J.L. Denisov A.Y. Legendre-Guillemin V. Harper S.Q. Davidson B.L. Gehring K. McPherson P.S. J. Neurosci. 2006; 26: 13202-13212Crossref PubMed Scopus (54) Google Scholar). When comparing FM4-64 uptake in axons of transfected neurons with their non-transfected neighbors, we found no difference in axonal bouton fluorescence intensity upon intersectin KD (Fig. 3A). Averaging the amount of FM4-64 uptake in hundreds of boutons from multiple cultures/transfections revealed no significant effect of intersectin KD, regardless of which intersectin miRNA was used (Fig. 3B). Our data demonstrate that intersectin is not present in axonal boutons and that it does not appear to function in CME of SVs in mammalian hippocampal neurons. Intersectin Co-localizes with Markers of Clathrin-coated Structures in the Soma and Dendrites—Despite its seeming lack of function in SV endocytosis, intersectin could still participate in endocytic events in neurons. To examine this possibility, we studied the localization of intersectin in relationship to CHC, the central component of clathrin-coated pits and clathrin-coated vesicles. In neurons, CHC is localized to clathrin-coated structures that form at the trans-Golgi network (TGN) and the plasma membrane in somatodendritic regions. CHC is also found in synaptic boutons, were it co-localizes with synaptophysin and other pre-synaptic markers. Intersectin was found to partially co-localize with CHC in dendrites (Fig. 4) suggesting that a pool of the protein is present on endocytic clathrin-coated pits. Consistent with this notion we detected co-localization of intersectin with AP-2 in dendrites (Fig. 5A). Because, like CHC, a significant pool of AP-2 in neurons is found in pre-synaptic boutons, the CHC and AP-2 puncta that are negative for intersectin likely represent, to a large part, the pre-synaptic component. We also noted a pool of intersectin in the juxtanuclear area (Figs. 4 and 5). This pool of intersectin was also found to co-localize with CHC (Fig. 4), suggesting that intersectin is present on clathrin-coated structures at the TGN. Consistent with this notion, the juxtanuclear pool of intersectin was seen to co-localize in part with adaptor protein-1 (AP-1), a component and marker of TGN-derived clathrin-coated pits (Fig. 5B). Little co-localization was seen with GM130, a marker of the cis-Golgi (data not shown). Therefore, intersectin localizes to multiple clathrin-coated membranes in the somatodendritic region of neurons.FIGURE 5Intersectin co-localizes with clathrin adaptor proteins. A: top panels, confocal fluorescent images of a dendritic region of a representative cultured hippocampal neuron immunostained for intersectin (green) and AP-2 (red). Middle and lower panels, higher magnification images from the field indicated by the white box in the upper panels. Examples of co-localizing structures are indicated by arrowheads. Scale bars are 5 μm. B: confocal fluorescent images of the cell body of a representative cultured hippocampal neuron immunostained for intersectin (green) and AP-1 (red). Scale bar is 10 μm.View Large Image Figure ViewerDownload Hi-res" @default.
• W2073430587 created "2016-06-24" @default.
• W2073430587 creator A5003846789 @default.
• W2073430587 creator A5005135366 @default.
• W2073430587 creator A5034896977 @default.
• W2073430587 creator A5036171088 @default.
• W2073430587 creator A5064549807 @default.
• W2073430587 creator A5073868341 @default.
• W2073430587 creator A5087872406 @default.
• W2073430587 date "2009-05-01" @default.
• W2073430587 modified "2023-10-18" @default.
• W2073430587 title "Intersectin Regulates Dendritic Spine Development and Somatodendritic Endocytosis but Not Synaptic Vesicle Recycling in Hippocampal Neurons" @default.
• W2073430587 cites W1508658015 @default.
• W2073430587 cites W1534752637 @default.
• W2073430587 cites W1566432282 @default.
• W2073430587 cites W1900601199 @default.
• W2073430587 cites W1965793946 @default.
• W2073430587 cites W1968432442 @default.
• W2073430587 cites W1973949147 @default.
• W2073430587 cites W1980602971 @default.
• W2073430587 cites W1980869115 @default.
• W2073430587 cites W1985714049 @default.
• W2073430587 cites W1986248861 @default.
• W2073430587 cites W1990012947 @default.
• W2073430587 cites W1995025647 @default.
• W2073430587 cites W1995855359 @default.
• W2073430587 cites W1998791478 @default.
• W2073430587 cites W2002190857 @default.
• W2073430587 cites W2011761299 @default.
• W2073430587 cites W2013348217 @default.
• W2073430587 cites W2015132539 @default.
• W2073430587 cites W2038905197 @default.
• W2073430587 cites W2045499828 @default.
• W2073430587 cites W2053010338 @default.
• W2073430587 cites W2053606589 @default.
• W2073430587 cites W2057180168 @default.
• W2073430587 cites W2072883807 @default.
• W2073430587 cites W2077858270 @default.
• W2073430587 cites W2079950503 @default.
• W2073430587 cites W2080240639 @default.
• W2073430587 cites W2080579127 @default.
• W2073430587 cites W2091612053 @default.
• W2073430587 cites W2095233739 @default.
• W2073430587 cites W2098376550 @default.
• W2073430587 cites W2098479740 @default.
• W2073430587 cites W2103762808 @default.
• W2073430587 cites W2104704429 @default.
• W2073430587 cites W2105012896 @default.
• W2073430587 cites W2109823971 @default.
• W2073430587 cites W2114855385 @default.
• W2073430587 cites W2120126891 @default.
• W2073430587 cites W2120328091 @default.
• W2073430587 cites W2121220699 @default.
• W2073430587 cites W2131198699 @default.
• W2073430587 cites W2134159136 @default.
• W2073430587 cites W2136405876 @default.
• W2073430587 cites W2140563438 @default.
• W2073430587 cites W2147169401 @default.
• W2073430587 cites W2149967863 @default.
• W2073430587 cites W2152741987 @default.
• W2073430587 cites W2153637044 @default.
• W2073430587 cites W2154960142 @default.
• W2073430587 cites W2156016682 @default.
• W2073430587 cites W2159367229 @default.
• W2073430587 cites W2167806590 @default.
• W2073430587 cites W2172206418 @default.
• W2073430587 cites W2313356399 @default.
• W2073430587 cites W2322129974 @default.
• W2073430587 cites W2330928871 @default.
• W2073430587 cites W4231727205 @default.
• W2073430587 doi "https://doi.org/10.1074/jbc.m809746200" @default.
• W2073430587 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2673308" @default.
• W2073430587 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/19258322" @default.
• W2073430587 hasPublicationYear "2009" @default.
• W2073430587 type Work @default.
• W2073430587 sameAs 2073430587 @default.
• W2073430587 citedByCount "85" @default.
• W2073430587 countsByYear W20734305872012 @default.
• W2073430587 countsByYear W20734305872013 @default.
• W2073430587 countsByYear W20734305872014 @default.
• W2073430587 countsByYear W20734305872015 @default.
• W2073430587 countsByYear W20734305872016 @default.
• W2073430587 countsByYear W20734305872017 @default.
• W2073430587 countsByYear W20734305872018 @default.
• W2073430587 countsByYear W20734305872019 @default.
• W2073430587 countsByYear W20734305872020 @default.
• W2073430587 countsByYear W20734305872021 @default.
• W2073430587 countsByYear W20734305872022 @default.
• W2073430587 countsByYear W20734305872023 @default.
• W2073430587 crossrefType "journal-article" @default.
• W2073430587 hasAuthorship W2073430587A5003846789 @default.
• W2073430587 hasAuthorship W2073430587A5005135366 @default.
• W2073430587 hasAuthorship W2073430587A5034896977 @default.
• W2073430587 hasAuthorship W2073430587A5036171088 @default.
• W2073430587 hasAuthorship W2073430587A5064549807 @default.
• W2073430587 hasAuthorship W2073430587A5073868341 @default.
• W2073430587 hasAuthorship W2073430587A5087872406 @default.
• W2073430587 hasBestOaLocation W20734305871 @default.

• next