FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2073546439> ?p ?o ?g. }

• W2073546439 endingPage "13208" @default.
• W2073546439 startingPage "13199" @default.
• W2073546439 abstract "Epstein-Barr virus (EBV)-induced receptor 2 (EBI2) is an orphan seven-transmembrane (7TM) receptor originally identified as the most up-regulated gene (>200-fold) in EBV-infected cells. Here we show that EBI2 signals with constitutive activity through Gαi as determined by a receptor-mediated inhibition of forskolin-induced cAMP production and an induction of the serum response element-driven transcriptional activity in a pertussis toxin-sensitive manner. Gαs and Gαq were not activated constitutively as determined by the lack of cAMP production, the lack of inositol phosphate turnover, and the lack of activities of the transcription factors: cAMP response element-binding protein and nuclear factor-κB. Immunohistochemistry and confocal microscopy of FLAG- and green fluorescent protein-tagged EBI2 revealed cell-surface expression. A putative N-terminal truncated version of EBI2, Δ4-EBI2, showed similar expression and signaling through Gαi as full-length EBI2. By using a 32P-labeled EBI2 probe we found a very high expression in lymphoid tissue (spleen and lymph node) and peripheral blood mononuclear cells and a high expression in lung tissue. Real-time PCR of EBV-infected cells showed high expression of EBI2 during latent and lytic infection, in contrast to the EBV-encoded 7TM receptor BILF1, which was induced during lytic infection. EBI2 clustered with the orphan GPR18 by alignment analysis as well as by close proximity in the chromosomal region 13q32.3. Based on the constitutive signaling and cellular expression pattern of EBI2, it is suggested that it may function in conjunction with BILF1 in the reprogramming of the cell during EBV infection. Epstein-Barr virus (EBV)-induced receptor 2 (EBI2) is an orphan seven-transmembrane (7TM) receptor originally identified as the most up-regulated gene (>200-fold) in EBV-infected cells. Here we show that EBI2 signals with constitutive activity through Gαi as determined by a receptor-mediated inhibition of forskolin-induced cAMP production and an induction of the serum response element-driven transcriptional activity in a pertussis toxin-sensitive manner. Gαs and Gαq were not activated constitutively as determined by the lack of cAMP production, the lack of inositol phosphate turnover, and the lack of activities of the transcription factors: cAMP response element-binding protein and nuclear factor-κB. Immunohistochemistry and confocal microscopy of FLAG- and green fluorescent protein-tagged EBI2 revealed cell-surface expression. A putative N-terminal truncated version of EBI2, Δ4-EBI2, showed similar expression and signaling through Gαi as full-length EBI2. By using a 32P-labeled EBI2 probe we found a very high expression in lymphoid tissue (spleen and lymph node) and peripheral blood mononuclear cells and a high expression in lung tissue. Real-time PCR of EBV-infected cells showed high expression of EBI2 during latent and lytic infection, in contrast to the EBV-encoded 7TM receptor BILF1, which was induced during lytic infection. EBI2 clustered with the orphan GPR18 by alignment analysis as well as by close proximity in the chromosomal region 13q32.3. Based on the constitutive signaling and cellular expression pattern of EBI2, it is suggested that it may function in conjunction with BILF1 in the reprogramming of the cell during EBV infection. The orphan EBI2 2The abbreviations used are: EBI2, Epstein-Barr virus induced receptor 2; EBV, Epstein-Barr virus; 7TM receptors, seven transmembrane spanning α-helix receptors; HHV8, human herpesvirus 8; PBMC, peripheral blood mononuclear cell; NK cell, natural killer cell; CysL1, and -2, cysteinyl leukotriene receptors 1 and 2; Ptx, pertussis toxin; FBS, fetal bovine serum; CREB, cAMP responsive element-binding protein; NF-κB, nuclear factor κB; SRE, serum response element; PAA, phosphonoacetic acid; wt, wild-type; TBS, Tris-buffered saline; wt, wild type; GFP, green fluorescent protein. receptor belongs to the superfamily of rhodopsin-like 7TM receptors (seven-transmembrane segment receptors), also known as G-protein-coupled receptors. The sequencing of the human genome has identified around 700 7TM receptors, and approximately half of these are believed to encode sensory receptors. The remaining receptors are divided into different classes of which class A (rhodopsin-like) includes the vast majority of the receptors. The cognate ligands have been identified for ∼200 non-sensory 7TM receptors, whereas the rest are still orphan receptors (1Schwartz T.W. Holst B. Foreman J.C. Johansen T. Textbook of Receptor Pharmacology. CRC Press, Boca Raton, FL2003: 65-85Google Scholar). EBI2 was cloned in 1993 as one out of nine up-regulated genes in Epstein-Barr virus (EBV)-infected Burkitt lymphoma cells (2Birkenbach M. Josefsen K. Yalamanchili R. Lenoir G. Kieff E. J. Virol. 1993; 67: 2209-2220Crossref PubMed Google Scholar). These nine genes were up-regulated from 4- to >100-fold upon EBV infection, and two 7TM receptors were identified among the up-regulated genes (Epstein-Barr-induced receptors 1 and 2, EBI1 and -2). EBI1 was later deorphanized as the receptor for the chemokines CCL19/ELC and CCL21/SLC and was consequently renamed CCR7 (3Yoshida R. Imai T. Hieshima K. Kusuda J. Baba M. Kitaura M. Nishimura M. Kakizaki M. Nomiyama H. Yoshie O. J. Biol. Chem. 1997; 272: 13803-13809Abstract Full Text Full Text PDF PubMed Scopus (343) Google Scholar), whereas the ligand(s) for EBI2 still remains to be identified. EBI2 displayed the highest up-regulation (>200-fold) among the nine EBV-induced genes compared with for example 21-fold for CCR7 (2Birkenbach M. Josefsen K. Yalamanchili R. Lenoir G. Kieff E. J. Virol. 1993; 67: 2209-2220Crossref PubMed Google Scholar). Initial expression analyses of the nine genes uncovered an expression of EBI2 in peripheral blood mononuclear cells (PBMCs), tonsils, spleen, and lung tissue (2Birkenbach M. Josefsen K. Yalamanchili R. Lenoir G. Kieff E. J. Virol. 1993; 67: 2209-2220Crossref PubMed Google Scholar). CCR7 and EBI2 are not the only 7TM receptors being regulated by EBV. In fact, up- and down-regulation of endogenous 7TM receptors and ligands are important events following a virus infection, and interestingly, many of these genes belong to the chemokine system (4Cahir-McFarland E.D. Carter K. Rosenwald A. Giltnane J.M. Henrickson S.E. Staudt L.M. Kieff E. J. Virol. 2004; 78: 4108-4119Crossref PubMed Scopus (204) Google Scholar, 5Melchjorsen J. Pedersen F.S. Mogensen S.C. Paludan S.R. J. Virol. 2002; 76: 2780-2788Crossref PubMed Scopus (54) Google Scholar, 6Melchjorsen J. Sorensen L.N. Paludan S.R. J. Leukoc. Biol. 2003; 74: 331-343Crossref PubMed Scopus (129) Google Scholar, 7Rosenkilde M.M. Kledal T.N. Curr. Drug Targets. 2006; 7: 103-118Crossref PubMed Scopus (19) Google Scholar). Molecular mimicry is another approach used by many herpes- and poxviruses to manipulate the host immune system, and again the chemokine system is “over-represented” compared with other 7TM receptor systems (7Rosenkilde M.M. Kledal T.N. Curr. Drug Targets. 2006; 7: 103-118Crossref PubMed Scopus (19) Google Scholar, 8Murphy P.M. Nat. Immunol. 2001; 2: 116-122Crossref PubMed Scopus (287) Google Scholar). Thus, a growing number of herpes- and poxvirus-encoded receptors, and ligands have been identified within the last decade, and most of these receptors bind a broad spectrum of chemokines and signal in a constitutive manner. Of these, the γ2-herpesvirus-encoded ORF74 receptors are the most abundantly characterized receptors (9Arvanitakis L. Geras-Raaka E. Varma A. Gershengorn M.C. Cesarman E. Nature. 1997; 385: 347-350Crossref PubMed Scopus (577) Google Scholar, 10Bais C. Santomasso B. Coso O. Arvanitakis L. Raaka E.G. Gutkind J.S. Asch A.S. Cesarman E. Gershengorn M.C. Mesri E.A. Gerhengorn M.C. Nature. 1998; 391: 86-89Crossref PubMed Scopus (752) Google Scholar, 11Rosenkilde M.M. Kledal T.N. Brauner-Osborne H. Schwartz T.W. J. Biol. Chem. 1999; 274: 956-961Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar). The first γ1-herpesvirus-encoded 7TM receptor (vGPCR) was identified in 2002 in region A5/BILF1 of the porcine lymphotropic herpesvirus-1 by Goltz et al. (12Goltz M. Ericsson T. Patience C. Huang C.A. Noack S. Sachs D.H. Ehlers B. Virology. 2002; 294: 383-393Crossref PubMed Scopus (54) Google Scholar). The same paper described the presence of BILF1 homologs in other γ1-herpesviruses, for instance EBV. The EBV-encoded BILF1 receptor was recently cloned and characterized as a highly constitutively active receptor (13Paulsen S.J. Rosenkilde M.M. Eugen-Olsen J. Kledal T.N. J. Virol. 2005; 79: 536-546Crossref PubMed Scopus (110) Google Scholar, 14Beisser P.S. Verzijl D. Gruijthuijsen Y.K. Beuken E. Smit M.J. Leurs R. Bruggeman C.A. Vink C. J. Virol. 2005; 79: 441-449Crossref PubMed Scopus (91) Google Scholar). The knowledge about the orphan EBV-induced EBI2 receptor is limited to the original cloning paper (2Birkenbach M. Josefsen K. Yalamanchili R. Lenoir G. Kieff E. J. Virol. 1993; 67: 2209-2220Crossref PubMed Google Scholar) and to a study showing a lack of simian immunodeficiency virus cell entry cofactor function for EBI2 (15Farzan M. Choe H. Martin K. Marcon L. Hofmann W. Karlsson G. Sun Y. Barrett P. Marchand N. Sullivan N. Gerard N. Gerard C. Sodroski J. J. Exp. Med. 1997; 186: 405-411Crossref PubMed Scopus (253) Google Scholar). In the present study we compare the primary structure of EBI2 with other herpesvirus-related 7TM receptors (i.e. the herpesvirus-encoded receptors) and a selection of endogenous 7TM receptors. We find that EBI2 does not resemble any of the herpesvirus-encoded 7TM receptors but is closest related to the orphan 7TM GPR18 and the two lipid receptors cysteinyl leukotriene receptor 1 and 2 (CysL1 and -2). In addition, we find that EBI2 clusters with GPR18 in region q32.3 at chromosome 13. We characterize EBI2 in terms of signaling activities at the level of G-proteins as well as at the level of the transcriptional activity. The cellular as well as tissue expression of EBI2 is characterized and the expression of EBI2 during the different replication states of EBV is quantified by real-time PCR and compared with the BILF1 receptor expression. We find that the constitutive signaling through Gαi and the cell-surface localization of EBI2 is similar to BILF1 (13Paulsen S.J. Rosenkilde M.M. Eugen-Olsen J. Kledal T.N. J. Virol. 2005; 79: 536-546Crossref PubMed Scopus (110) Google Scholar), whereas the expression pattern during virus infection varies, because EBI2 is expressed during latent as well as lytic replication, whereas BILF1 is induced during lytic infection. Materials—EBI2 was cloned from a human spleen cDNA library from Stratagene (La Jolla, CA) and corresponded to the GenBank™ accession number L08177. The human CCR7 was kindly provided by Martin Lipp (Molecular Tumor Genetics, MDC-Berlin, Germany). The human chemokines CCL19 and CCL21 were purchased from PeproTech (London, England). The promiscuous chimeric G-protein GαΔ6qi4myr (abbreviated Gqi4myr) was kindly provided by Evi Kostenis (7TM-Pharma, Denmark). LipofectAMINE™ 2000 Reagent and Opti-MEM 1 were purchased from Invitrogen. LucLite (lyophilized substrate solution) was from Packard (Boston, MA). myo-[3H]Inositol, cAMP-EIA kit, and anti-mouse horseradish peroxidase-conjugated antibody were from Amersham Biosciences. Pertussis toxin (Ptx), forskolin, 3-isobutyl-1-methylxanthine, and anti-FLAG (M2) antibody were from Sigma. AG 1-X8 anion-exchange resin was from Bio-Rad. Site-directed Mutagenesis—The human EBI2 was inserted into a set of different eukaryotic expression vectors: the pTEJ8 vector (16Johansen T.E. Schøller M.S. Tolstoy S. Schwartz T.W. FEBS Lett. 1990; 267: 289-294Crossref PubMed Scopus (143) Google Scholar), the pcDNA3 vector, the pEGFP-N1 vector, and a modified pcDNA3 vector with a FLAG tag inserted upstream of the polylinker region kindly provided by Kate Hansen (7TM-Pharma, Denmark). N-terminal truncation of EBI2 (Δ4) was made by PCR using the wild-type/full-length EBI2 as template. All reactions were carried out using the Pfu polymerase (Stratagene). The wild-type and truncated EBI2 DNA were verified by DNA sequencing on an ABI 310 sequencer from PerkinElmer Life Sciences. Transfections and Tissue Culture—COS-7 cells were grown at 10% CO2 and 37 °C in Dulbecco's modified Eagle's medium with Glutamax (Invitrogen, cat. no 21885-025) adjusted with 10% fetal bovine serum (FBS), 180 units/ml penicillin, and 45 μg/ml streptomycin (PenStrep). HEK293 cells were grown in Dulbecco's modified Eagle's medium adjusted to contain 4500 mg/liter glucose (cat. no. 31966-021) with the same amount FBS and PenStrep as the COS-7 cells at 10% CO2 and 37 °C. The HEK293 cell media was modified to hold heat-inactivated FBS and no PenStrep during luciferase based assays. Stable transfected and naïve L12 cells were grown in RPMI supplemented with 10% FBS, PenStrep, and the selection marker G418 for the EBI2-expressing cell lines. Transfection of the COS-7 cells was performed by using the calcium phosphate precipitation method (11Rosenkilde M.M. Kledal T.N. Brauner-Osborne H. Schwartz T.W. J. Biol. Chem. 1999; 274: 956-961Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar). HEK293 cells were transfected by the LipofectAMINE™ 2000 Reagent in the serum-free media Opti-MEM 1 according to the manufacturer's description for all experiments. L12 cells were stably transfected by electroporation. Briefly, EBI2-GFP DNA was linearized and transferred into a 0.4-cm cuvette, and a single electroporation pulse at 250 V and 960 microfarads was applied. The electroporated cells were incubated for 10 min at room temperature and transferred to culture at 37 °C in RPMI supplemented with 10% fetal calf serum. Geneticin (G418) was added to a final concentration of 800 mg/ml 48 h after transfection, and the cells were plated in 96-well plates (25,000 cells/well) (17Sabroe I. Conroy D.M. Gerard N.P. Li Y. Collins P.D. Post T.W. Jose P.J. Williams T.J. Gerard C.J. Ponath P.D. J. Immunol. 1998; 161: 6139-6147PubMed Google Scholar). After 3 weeks, five G418-resistant clones were selected for further FACS sorting according to EBI2-GFP expression (see below). FACS Sorting and Fluorescence Analysis of Stably Transfected L12 Cells—Five different EBI2-GFP-expressing L12 cell clones were each FACS-sorted by a BD Biosciences FACS Vantage SE, Diva into a fraction with no EBI2 expression, a fraction with low EBI2 expression, and a fraction with high EBI2 expression. Among the EBI2-expressing fractions, four fractions were chosen representing the spectrum from low to high EBI2 expression. These four fractions were analyzed in respect of adenylate cyclase inhibition (cAMP-assay, see below), and the signaling activities were compared with the EBI2 expression level. Purification and Fractionation of PBMCs in B-lymphocytes, T-lymphocytes, Monocytes, and NK Cells—Buffy-coats from four healthy blood donors were obtained 16 h after blood collection. The reminiscent erythrocytes were lysed by a 1:1 mixture of the buffy-coats with Hoffman's reagent (0.16 NH4Cl, 0.10 mm Na2EDTA, and 10 mm NaHCO3), and the granulocytes were separated from the PBMCs by density centrifugation using the reagent Lymphoprep (AXIS-SHIELD, Oslo, Norway) according to the manufacturer's recommendations. The PBMCs were further fractionated into T-lymphocytes, B-lymphocytes, monocytes, and NK cells by CD3-, CD19-, CD14-, and CD56-covered magnetic beads, respectively (Micro-beads from Miltenyi Biotec GmbH, Bergisch Gladbach, Germany). Briefly, the PBMCs were mixed with the antibody-covered Micro-beads (2 μl of Micro-beads per 107 cells), and the mixtures were subsequently applied to MS-columns (Miltenyi Biotec GmbH) that were attached to a MiniMac separator (Miltenyi Biotec GmbH). The purification efficiencies of T-lymphocytes, B-lymphocytes, monocytes, and NK cells were determined by FACS analysis using perCpCy5 (Peridinin chlorophyll protein cyanin), phycoerythrin, or fluorescein isothiocyanate-labeled CD3, CD19, CD14, and CD56 antibodies (DAKO, Denmark) and found to be 85–95%. Real-time PCR Analysis of EBI2 Expression in T-lymphocytes, B-lymphocytes, Monocytes, and NK Cells—Total RNA was extracted from isolated T-lymphocytes, B-lymphocytes, monocytes, and NK cells using a QIAamp RNA Blood Mini kit (Qiagen, Valencia, CA). Subsequently, cDNA was synthesized from 1 μg of total RNA using the ImProm II Reverse Transcriptase kit (Promega, Madison, WI). Quantification of EBI2 transcript levels in the PBMC subsets was performed using the SYBR Premix Ex TaqRT-PCR kit (Takara Bio Inc., Shiga, Japan) and the Mx3000P system (Stratagene). Expression of β-actin was used for copy number normalization. A calibrator consisting of a mixture of cDNA from all samples was included in each run to facilitate comparative analysis. Each sample was assessed three times in triplicates. The primer pairs used were as follows: EBI2 forward: 5′-GAATCGGAGATGCCTTGTGT-3′; EBI2 reverse: 5′-GCCTCCTGCTTTGACATAGG-3′; β-actin forward: 5′-CGTCTTCCCCTCCATCGT-3′; β-actin reverse: 5′-CGCCCACATAGGAATCCTTC-3′. Amplification efficiency of the primer pair was validated using serial dilutions of the calibrator sample being satisfactory in both cases. Phosphatidylinositol Assay (PI Turnover)—COS-7 cells were transfected according to the procedure mentioned above. Briefly, 2 × 106 cells were transfected with increasing amounts of receptor or vector control cDNA (from 0 to 10 μg/flask) with or without 30 μg of the promiscuous chimeric G-protein, Gqi4myr, which turns the Gαi-coupled signal into the Gαq pathway (phospholipase C activation measured as PI turnover), or the Gqs5, which turns the Gαs-coupled signal into the Gαq pathway (18Kostenis E. Trends Pharmacol. Sci. 2001; 22: 560-564Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar). One day after transfection, COS-7 cells (2.5 × 104 cells/well) were incubated for 24 h with 2 μCi of myo-[3H]inositol in 0.4 ml of growth medium per well. Cells were washed twice in 20 mm Hepes, pH 7.4, supplemented with 140 mm NaCl, 5 mm KCl, 1 mm MgSO4, 1 mm CaCl2, 10 mm glucose, and 0.05% (w/v) bovine serum albumin, and the cells were incubated in 0.4 ml of buffer supplemented with 10 mm LiCl at 37 °C for 90 min. Cells were extracted by addition of 1 ml of 10 mm formic acid to each well followed by incubation on ice for 30–60 min. The generated [3H]inositol phosphates were purified on AG 1-X8 anion-exchange resin (19Berridge M.J. Dawson M.C. Downes C.P. Heslop J.P. Irvin R.F. Biochem. J. 1983; 212: 473-482Crossref PubMed Scopus (1541) Google Scholar). Determinations were made in duplicates. Adenylate Cyclase Inhibition Assay (cAMP-assay)—HEK293 cells were seeded at 35,000 cells/well in culture plates 1 day prior to transfection and were transfected with 50 ng/well EBI2 or the pcDNA3 vector as control. 24 h after the transfection, the cells were washed twice in HBS buffer (25 mm Hepes, pH 7.2, supplemented with 0.75 mm NaH2PO4, 140 mm NaCl, and 0.05% (w/v) bovine serum albumin and incubated for 30 min at 37 °C in HBS buffer supplemented with 1 mm of the phosphodiesterase inhibitor 3-isobutyl-1-methylxanthine and various concentrations of the adenylate cyclase activator forskolin. After incubation, the cells were placed on ice, the medium was removed, and the cAMP concentration was measured using the cAMP-EIA kit (Amersham Biosciences). The effect of 100 and 500 ng/ml Ptx was tested by adding it to the cells immediately following transfection. Naïve and stably transfected L12 cell lines were seeded at 50,000 cells/well 24 h before cAMP determination performed as described for the HEK293 cells above. Determinations were made in duplicates. Constitutive CREB, NF-κB, and SRE cis-Reporting Luciferase Assay— Cells were seeded at 35,000 cells/well in culture plates 24 h prior to transfection and were transfected with 50 ng/well of the (cis)-reporter plasmid (pCREB-Luc, pSRE-LUC, and pNF-κB-Luc) and concentrations from 0 to 50 ng/well of receptor plasmid. Immediately following transfection, the cells were given new media with variations in the concentrations of FBS (10% for the NF-κB and 0.1% for the CREB and the SRE reporter system) and incubated for 18 h in the presence or absence of Ptx. One day after transfection, the cells containing the CREB-luciferase receptor (and EBI2 or pcDNA3 vector) were given new media with or without forskolin and incubated for 5 h. All cells were washed twice in Dulbecco's phosphate-buffered saline (0.9 mm CaCl2, 2.7 mm KCl, 1.5 mm KH2PO4, 0.5 mm MgCl2, 137 mm NaCl, and 8.1 mm Na2HPO4), and the luminescence was measured in a micro plate scintillation and luminescence counter (Top-counter, Packard) after 10 min incubation in 100 μl of Dulbecco's phosphate-buffered saline together with 100 μlof LucLite substrate. Determinations were made in quadruples. Microscopy—Transiently transfected HEK293 cells and stably transfected L12 cells expressing the EBI2 receptor fused to green fluorescent protein (GFP), EBI2-GFP, were analyzed using a Zeiss ConfoCor2 LSM-FCS confocal microscope (Carl Zeiss, Germany) equipped with an Argon/2 laser (488 nm) using an apochromat 63×/1.4 oil differential interference contrast immersion lens. Surface Enzyme-Linked Immunosorbent Assay—HEK293 cells were transfected with the N-terminal FLAG-tagged variants of EBI2 wt and Δ4-EBI2 for the enzyme-linked immunosorbent assay in parallel with cells used for the CREB assay. The cells were washed once in TBS (35 mm Tris-HCl, 140 mm NaCl, pH 7.4), fixed in 4% glutaraldehyde for 10 min, and incubated in blocking solution (2% bovine serum albumin in TBS) for 30 min at room temperature. The cells were subsequently kept at room temperature and incubated 2 h with anti-FLAG (M1) antibody (2 μg/ml) in TBS supplemented with 1% bovine serum albumin and 1 mm CaCl2. After three washes in TBS with 1 mm CaCl2 the cells were incubated with goat anti-mouse horseradish peroxidase-conjugated antibody in the same buffer as the anti-FLAG antibody for 1 h. After three washes in TBS with 1 mm CaCl2 the immune reactivity was revealed by the addition of horseradish peroxidase substrate according to manufacture's instruction. Tissue Expression Analysis—This was performed using Clontech's Multiple Tissue Expression Array according to the manufacturer's recommendation. Briefly, a PCR fragment corresponding to the EBI2 sequence from bp 160–403 was obtained using the primers GTCGTCATTGTTCAAAACAGG (forward) and GCACCACAGCAATGAAGC (reverse). The fragment was 32P-labeled and used as probe for hybridization to the Multiple Tissue Expression Array. The data were visualized by a Molecular Imager FX (Bio-Rad) and analyzed using the Quantity One Program (Bio-Rad). Stimulation of EBV-infected Cells—Akata+ and B95.8 were grown in RPMI 1640 medium (Invitrogen, 21875-034) supplemented with 10% FBS and 100 units penicillin and streptavidin per milliliter. The cells were incubated at 37 °C, and 5% CO2. Approximately 107 cells were used for each assay. Prior to stimulation cells were pelleted by centrifugation and resuspended in media (106 cells/ml). The Akata+ cells were stimulated with 0.5% v/v IgG antibody (DAKO, A042410), or IgG antibody plus 300 μg/ml PAA (phosphonoacetic acid) to inhibit viral DNA replication for 3 h, whereas the B95.8 cells were stimulated with 6 mm butyrate and 10 ng/ml phorbol 12-tetradecanoate 13-acetate. Cells were resuspended in media with or without PAA and grown for 48 h. RNA Isolation and Real-time PCR—The RNAqoues 4-PCR kit (Ambion, cat no. 1914) was used for isolation of RNA. cDNA was synthesized using a First Strand Transcription cDNA synthesis kit from Roche Applied Science (cat. no. 04379012001), and the amount of RNA used varied between 1 and 3μg. Primer sequences were BILF1 (5′-CTATCAGCCTGACATCCATT-3′), EBI2 (5′-ACACAAGGCATCTCCGATTC-3′), BZLF1 (5′-GGAACACCAATGTCTGCTAG-3′), gp350 (5′-TGTCAGCTGGCCAAAGTCAA-3′), and EBNA3C (5′-TTTCTTGCTCTCTTGGTCCA-3′). Real-time PCR were run on a LightCycler using the LightCycler-Fast-Start DNA Master SYBR green I kit from Roche Applied Science (cat. no. 2239264). The forward primers were BILF1 (5′-GTCAATGCAACGGAAGATGC-3′), EBI2 (5′-GTCTTCATCATTGGGCTCGT-3′), BZLF1 (5′-CTCCGACATAACCCAGAATC-3′), gp350 (5′-TACACCATCCAGAGCCTGAT-3′), and EBNA3C (5′-GGGATATCGTACAGCAACAC-3′), and the reverse primers as mentioned above were used. For standard curves a series of 10-fold dilutions was prepared, reaching from 102 to 108 copies of a construct containing the gene of interest. The program used for amplification was 95 °C for 10 min followed by 45 cycles of 95 °C for 10 s, 60 °C for 5 s, and 72 °C for 10 s. Finally a melting curve was determined by heating to 95 °C. In each run both positive and negative controls were included. The plasmids used to create the standard curve were used for the positive control to know the specific number of copies. Fragment length was analyzed on agarose gels. EBI2 Groups with GPR18 and the Two Lipid Receptors CysL1 and -2— Numerous alignments and structural analyses in the literature have suggested different grouping for EBI2 among endogenous 7TM receptors (20Lapinsh M. Gutcaits A. Prusis P. Post C. Lundstedt T. Wikberg J.E. Protein Sci. 2002; 11: 795-805Crossref PubMed Scopus (102) Google Scholar, 21Vassilatis D.K. Hohmann J.G. Zeng H. Li F. Ranchalis J.E. Mortrud M.T. Brown A. Rodriguez S.S. Weller J.R. Wright A.C. Bergmann J.E. Gaitanaris G.A. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 4903-4908Crossref PubMed Scopus (604) Google Scholar, 22Joost, P., and Methner, A. (2002) Genome Biology http://genomebiology.com/2002/3/11/research/0063Google Scholar). However, the primary structure of EBI2 has never been compared with the herpesvirus-encoded 7TM receptors, and we therefore aligned EBI2 with a broad selection of endogenous and viral 7TM receptors (Fig. 1). We included the receptors recently suggested to be closest to EBI2 (GPR18, CysL1, and -2 (21Vassilatis D.K. Hohmann J.G. Zeng H. Li F. Ranchalis J.E. Mortrud M.T. Brown A. Rodriguez S.S. Weller J.R. Wright A.C. Bergmann J.E. Gaitanaris G.A. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 4903-4908Crossref PubMed Scopus (604) Google Scholar, 22Joost, P., and Methner, A. (2002) Genome Biology http://genomebiology.com/2002/3/11/research/0063Google Scholar)) together with a selection of monoamine and peptide receptors: the α2 and β1-adrenergic receptors, the ghrelin, the neurotensin receptor 2, and the melanocortin receptors 1 and 2 and selected orphan receptors (GPR3, -6, -9, and -39). Many of these were chosen due to their constitutive signaling (ghrelin, neurotensin receptor 2, melanocortin receptors 1 and 2, and GPR3, -6, -9, and -39). The chemokine system was represented by the endogenous receptors CCR1, -2, -4, and -8, CXCR1–4, XCR1, CX3CR1, and RDC1 together with certain constitutively active herpesvirus-encoded receptors (2Birkenbach M. Josefsen K. Yalamanchili R. Lenoir G. Kieff E. J. Virol. 1993; 67: 2209-2220Crossref PubMed Google Scholar, 23Rosenkilde M.M. Schwartz T.W. Bradshaw R.A. Dennis E.A. Handbook of Cell Signaling. Elsevier, New York2004: 779-785Google Scholar). Thus, we included the EBV-encoded receptor (BILF1), the γ2-herpesvirus-encoded ORF74 receptors from human herpesvirus 8 (ORF74-HHV8), from herpesvirus saimiri (ORF74-HVS, previously identified as HVS-ECRF3) and from equine herpesvirus 2 (ORF74-EHV2) and the human cytomegalovirus-encoded US28 and US27 receptors. EBI2, as expected (21Vassilatis D.K. Hohmann J.G. Zeng H. Li F. Ranchalis J.E. Mortrud M.T. Brown A. Rodriguez S.S. Weller J.R. Wright A.C. Bergmann J.E. Gaitanaris G.A. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 4903-4908Crossref PubMed Scopus (604) Google Scholar, 22Joost, P., and Methner, A. (2002) Genome Biology http://genomebiology.com/2002/3/11/research/0063Google Scholar), only grouped with the GPR18 and the CysL1 and -2 receptors among the endogenous receptors. No structural homology was found between EBI2 and the family of constitutively active (β- and γ-herpesvirus-encoded 7TM receptors) (Fig. 1A). Interestingly, analysis of the chromosomal localization of EBI2, GPR18, and the CysL1 and -2 receptors revealed an intimate relationship between EBI2 and GPR18, because both genes were located at chromosome 13 in the region 13q32.3 at the minus strand, with only 32,792 bp separation. Another related gene, EBI2-like (a pseudogene) was also found in this region 100,923 bp from GPR18. In the same region, but at the positive strand, an unrelated gene, PGDH-like 1 (phosphoglycerate dehydrogenase-like 1) was flanking both GPR18 and EBI2 (Fig. 1B). This close proximity was not found for the CysL1 and -2 receptors that were located at Xq13.2–21.1 and 13q14.12-q21.1, respectively. EBI2 Is Expressed at the Cell Surface and Signals Constitutively through Gαi in a Ptx-sensitive Manner—The cellular expression was analyzed in two different cell lines, the laboratory fibroblast HEK293 cell line used for binding and signaling characterization of 7TM receptors in general, and the pre-B-cell lymphocyte cell line L12, chosen due to the original cloning of EBI2 from B-lymphocytes infected with EBV. As shown in Fig. 2, EBI2 fused to green-fluorescent protein (EBI2-GFP) localized predominantly to the cell-membrane in both cell lines, as shown for the majority of endogenous 7TM receptors (1Schwartz T.W. Holst B. Foreman J.C. Johansen T. Textbook of Receptor Pharmacology. CRC Press, Boca Raton, FL2003: 65-85Google Scholar). To study whether EBI2 is a functional receptor, we tested for putative signaling through a variety of G-proteins. The Gαi coupling of EBI2 was initially analyzed by means of cAMP formation in transiently transfected HEK293 in the absence and presence of forskolin (a direct activator of adenylate cyclase). As sho" @default.
• W2073546439 created "2016-06-24" @default.
• W2073546439 creator A5002142558 @default.
• W2073546439 creator A5012450083 @default.
• W2073546439 creator A5021396103 @default.
• W2073546439 creator A5033914407 @default.
• W2073546439 creator A5035872776 @default.
• W2073546439 creator A5036878025 @default.
• W2073546439 creator A5038335267 @default.
• W2073546439 creator A5047181655 @default.
• W2073546439 creator A5071806328 @default.
• W2073546439 date "2006-05-01" @default.
• W2073546439 modified "2023-10-06" @default.
• W2073546439 title "Molecular Pharmacological Phenotyping of EBI2" @default.
• W2073546439 cites W1501401884 @default.
• W2073546439 cites W1575024932 @default.
• W2073546439 cites W1802980406 @default.
• W2073546439 cites W1976547902 @default.
• W2073546439 cites W1979382115 @default.
• W2073546439 cites W1979964053 @default.
• W2073546439 cites W1982047106 @default.
• W2073546439 cites W1982527304 @default.
• W2073546439 cites W1988743962 @default.
• W2073546439 cites W1989814102 @default.
• W2073546439 cites W1990601982 @default.
• W2073546439 cites W1992335354 @default.
• W2073546439 cites W1995055452 @default.
• W2073546439 cites W2000932088 @default.
• W2073546439 cites W2002514583 @default.
• W2073546439 cites W2002566401 @default.
• W2073546439 cites W2007576186 @default.
• W2073546439 cites W2018943211 @default.
• W2073546439 cites W2030261483 @default.
• W2073546439 cites W2040034628 @default.
• W2073546439 cites W2047600489 @default.
• W2073546439 cites W2053631933 @default.
• W2073546439 cites W2069442142 @default.
• W2073546439 cites W2077416276 @default.
• W2073546439 cites W2082633256 @default.
• W2073546439 cites W2089471365 @default.
• W2073546439 cites W2090639515 @default.
• W2073546439 cites W2092280881 @default.
• W2073546439 cites W2100641088 @default.
• W2073546439 cites W2108431380 @default.
• W2073546439 cites W2111010158 @default.
• W2073546439 cites W2124328573 @default.
• W2073546439 cites W2128445390 @default.
• W2073546439 cites W2130164640 @default.
• W2073546439 cites W2135474288 @default.
• W2073546439 cites W2142081586 @default.
• W2073546439 cites W2144618266 @default.
• W2073546439 cites W2163611230 @default.
• W2073546439 cites W2166823073 @default.
• W2073546439 cites W2168531609 @default.
• W2073546439 cites W2168774029 @default.
• W2073546439 cites W2168988227 @default.
• W2073546439 cites W2187317746 @default.
• W2073546439 cites W92043842 @default.
• W2073546439 doi "https://doi.org/10.1074/jbc.m602245200" @default.
• W2073546439 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16540462" @default.
• W2073546439 hasPublicationYear "2006" @default.
• W2073546439 type Work @default.
• W2073546439 sameAs 2073546439 @default.
• W2073546439 citedByCount "97" @default.
• W2073546439 countsByYear W20735464392012 @default.
• W2073546439 countsByYear W20735464392013 @default.
• W2073546439 countsByYear W20735464392014 @default.
• W2073546439 countsByYear W20735464392015 @default.
• W2073546439 countsByYear W20735464392016 @default.
• W2073546439 countsByYear W20735464392017 @default.
• W2073546439 countsByYear W20735464392018 @default.
• W2073546439 countsByYear W20735464392019 @default.
• W2073546439 countsByYear W20735464392020 @default.
• W2073546439 countsByYear W20735464392021 @default.
• W2073546439 countsByYear W20735464392022 @default.
• W2073546439 countsByYear W20735464392023 @default.
• W2073546439 crossrefType "journal-article" @default.
• W2073546439 hasAuthorship W2073546439A5002142558 @default.
• W2073546439 hasAuthorship W2073546439A5012450083 @default.
• W2073546439 hasAuthorship W2073546439A5021396103 @default.
• W2073546439 hasAuthorship W2073546439A5033914407 @default.
• W2073546439 hasAuthorship W2073546439A5035872776 @default.
• W2073546439 hasAuthorship W2073546439A5036878025 @default.
• W2073546439 hasAuthorship W2073546439A5038335267 @default.
• W2073546439 hasAuthorship W2073546439A5047181655 @default.
• W2073546439 hasAuthorship W2073546439A5071806328 @default.
• W2073546439 hasBestOaLocation W20735464391 @default.
• W2073546439 hasConcept C185592680 @default.
• W2073546439 hasConcept C41008148 @default.
• W2073546439 hasConcept C70721500 @default.
• W2073546439 hasConcept C86803240 @default.
• W2073546439 hasConceptScore W2073546439C185592680 @default.
• W2073546439 hasConceptScore W2073546439C41008148 @default.
• W2073546439 hasConceptScore W2073546439C70721500 @default.
• W2073546439 hasConceptScore W2073546439C86803240 @default.
• W2073546439 hasIssue "19" @default.
• W2073546439 hasLocation W20735464391 @default.
• W2073546439 hasOpenAccess W2073546439 @default.

• next