FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2073636715> ?p ?o ?g. }

• W2073636715 endingPage "7088" @default.
• W2073636715 startingPage "7082" @default.
• W2073636715 abstract "A bioinformatics approach to finding new cases of –1 frameshifting in the expression of human genes revealed a classical retrovirus-like heptanucleotide shift site followed by a potential structural stimulator in the paraneoplastic antigen Ma3 and Ma5 genes. Analysis of the sequence 3′ of the shift site demonstrated that an RNA pseudoknot in Ma3 is important for promoting efficient –1 frame-shifting. Ma3 is a member of a family of six genes in humans whose protein products contain homology to retroviral Gag proteins. The –1 frameshift site and pseudoknot structure are conserved in other mammals, but there are some sequence differences. Although the functions of the Ma genes are unknown, the serious neurological effects of ectopic expression in tumor cells indicate their importance in the brain. A bioinformatics approach to finding new cases of –1 frameshifting in the expression of human genes revealed a classical retrovirus-like heptanucleotide shift site followed by a potential structural stimulator in the paraneoplastic antigen Ma3 and Ma5 genes. Analysis of the sequence 3′ of the shift site demonstrated that an RNA pseudoknot in Ma3 is important for promoting efficient –1 frame-shifting. Ma3 is a member of a family of six genes in humans whose protein products contain homology to retroviral Gag proteins. The –1 frameshift site and pseudoknot structure are conserved in other mammals, but there are some sequence differences. Although the functions of the Ma genes are unknown, the serious neurological effects of ectopic expression in tumor cells indicate their importance in the brain. Although nonoverlapping triplet reading of mRNA codons is the essence of genetic decoding, dynamic nonstandard events at specific sites can permit product diversity and provide regulatory options. One of these recoding events involves shifting to an alternative reading frame by a proportion of ribosomes, thereby changing the linearity of readout. Such utilized frameshifting commonly features both a “shifty site” in the mRNA and an appropriately positioned structural feature in the mRNA that acts to enhance the level of frameshifting, i.e. it is programmed. Although the shift involved can be to either alternative frame, a shift to the –1 frame often involves tRNAs in both the A and P sites detaching from their codons and re-pairing to mRNA at the two overlapping –1 frame codons (1Jacks T. Madhani H.D. Masiarz F.R. Varmus H.E. Cell. 1988; 55: 447-458Abstract Full Text PDF PubMed Scopus (434) Google Scholar, 2Baranov P.V. Gesteland R.F. Atkins J.F. RNA. 2004; 10: 221-230Crossref PubMed Scopus (69) Google Scholar). This tandem detachment and re-pairing usually occurs on a “slippery” heptanucleotide sequence that follows the general pattern of X XXY YYZ where the A and P site tRNAs detach from the zero frame codons XXY YYZ and re-pair after shifting 1 nucleotide to XXX YYY. The spacer region between the shift site and the 3′ structural element is commonly 6–8 nt 2The abbreviations used are: nt, nucleotide(s); ORF, open reading frame; GST, glutathione S-transferase; WT, wild type; IBV, infectious bronchitis virus; KL, kissing loop. (3Takyar S. Hickerson R.P. Noller H.F. Cell. 2005; 120: 49-58Abstract Full Text Full Text PDF PubMed Scopus (365) Google Scholar). The most common 3′ recoding signals for –1 frameshifting are pseudoknots (4Brierley I. Digard P. Inglis S.C. Cell. 1989; 57: 537-547Abstract Full Text PDF PubMed Scopus (491) Google Scholar, 5ten Dam E.B. Pleij C.W. Bosch L. Virus Genes. 1990; 4: 121-136Crossref PubMed Scopus (170) Google Scholar) with distinct features (6Brierley I. Pennell S. Cold Spring Harbor Symp. Quant. Biol. 2001; 66: 233-248Crossref PubMed Scopus (69) Google Scholar, 7Pallan P.S. Marshall W.S. Harp J. Jewett F.C. Wawrzak Z. Brown B.A. Rich A. Egli M. Biochemistry. 2005; 44: 11315-11322Crossref PubMed Scopus (51) Google Scholar). A less common type of pseudoknot is the kissing stem-loop found in the human coronavirus, HCV229E (8Herold J. Siddell S.G. Nucleic Acids Res. 1993; 21: 5838-5842Crossref PubMed Scopus (70) Google Scholar), but bioinformatic studies suggest that it may be involved for transmissible gastroenteritis virus frame-shifting also (9Baranov P.V. Henderson C.M. Anderson C.B. Gesteland R.F. Atkins J.F. Howard M.T. Virol. 2005; 332: 498-510Crossref PubMed Scopus (157) Google Scholar). Examples of genes that require –1 frameshifting for expression are well known in viral genomes. There is only one demonstrated case of –1 frameshifting in a mammalian cellular gene (10Shigemoto K. Brennan J. Walls E. Watson C.J. Stott D. Rigby P.W. Reith A.D. Nucleic Acids Res. 2001; 29: 4079-4088Crossref PubMed Scopus (85) Google Scholar, 11Manktelow E. Shigemoto K. Brierley I. Nucleic Acids Res. 2005; 33: 1553-1563Crossref PubMed Scopus (73) Google Scholar), but it does not display the phylogenetic breadth of the +1 frameshifting utilized in decoding antizyme mRNA, conserved from mammals to yeasts (12Ivanov I.P. Gesteland R.F. Atkins J.F. Nucleic Acids Res. 2000; 28: 3185-3196Crossref PubMed Google Scholar). Frameshifting near the end of a coding sequence often allows a proportion of ribosomes to access an ORF that extends beyond the zero frame terminator so that the transframe (coupled ORF) protein is longer than that of standard decoding. The easiest class of –1 programmed frame-shift events to search for is one that has conserved architecture of two ORFs that partially overlap and contains a defined shift site. In these cases conservation of an independent ORF2 helps to distinguish significant candidates from a genomic background that contains sequencing errors and pseudogenes. However, cases such as the Escherichia coli dnaX gene, which utilizes a –1 frameshift to cause a proportion of ribosomes to access a stop codon in the new frame near the frameshift site, demonstrate that frameshifting can be utilized to yield an additional product that lacks a carboxyl-terminal domain of the product of standard decoding. In attempting to identify cases of this nature, searches for two long and partially overlapping ORFs will be fruitless because ORF2 will be wholly contained within the sequence encoding ORF1 and can be small or nonexistent. In addition to identifying an appropriate pair of ORFs that will support a given type of recoding, a specific frameshift site must be identified. The classic heptanucleotide –1 shift site followed by a pseudoknot, as described above, provides a straightforward target for bioinformatic searches. Other possible shift sites are less well defined and thus more complicated to identify. For example, the potential for both A and P site tRNAs to re-pair in the new frame can be difficult to discern (13Licznar P. Mejlhede N. Prère M.F. Wills N.M. Gesteland R.F. Atkins J.F. Fayet O. EMBO J. 2003; 22: 4770-4778Crossref PubMed Scopus (48) Google Scholar). In yet other cases, our current knowledge does not adequately predict the likelihood of frameshifting (14Atkins J.F. Herr A.J. Massiere C. O'Connor M. Ivanov I.P. Gesteland R.F. Garrett R.A. Douthwaite S.R. Liljas A. Matheson A.T. Moore P.B. Noller H.F. The Ribosome, Structure, Function, Antibiotics and Cellular Interactions. ASM Press, Washington, D. C.2000: 369-383Google Scholar, 15Griffiths A. Chen S.H. Horsburgh B.C. Coen D.M. J. Virol. 2003; 77: 4703-4709Crossref PubMed Scopus (40) Google Scholar). A recent case in point is that reported for the generation of polyalanine runs from long CAG tracts in the MJD-1 transcript (related to a late onset neurodegenerative disorder) where there is no conventional heptanucleotide frame-shift site (16Toulouse A. Au-Yeung F. Gaspar C. Roussel J. Dion P. Rouleau G.A. Hum. Mol. Genet. 2005; 14: 2649-2660Crossref PubMed Scopus (50) Google Scholar). Diverse approaches are needed to discern the extent to which programmed –1 frameshifting is utilized in decoding eukaryotic cellular genes. Here we report a functional –1 frameshifting site in a mammalian cellular gene, Ma3, identified by a bioinformatic analysis of mRNA sequences searching for a classic heptanucleotide shift site followed by a pseudoknot and contained in the overlap between two ORFs. A counterpart exists in the human Ma5 gene, but the 3′ stimulator was not analyzed in detail. Ma3 and Ma5 are members of a family of mammalian genes whose protein products are the target of immunity associated with paraneoplastic disorders whose symptoms, though associated with tumors elsewhere in the body, are not directly caused by the tumors or the treatment of them. These disorders are often the consequence of an autoimmune response to antigens ectopically expressed in the tumor cells that target the protein(s) normally expressed by the affected cells. Ma1 is expressed in the brain and testis, Ma2 in the brain, and Ma3 in the brain and testis and to a lesser extent in the trachea, kidney, and heart. Immunity to Ma2 and sometimes additional immunity to Ma1 and Ma3 are associated with brainstem encephalitis and cerebral degeneration (17Rosenfeld M.R. Eichen J.G. Wade D.F. Posner J.B. Dalmau J. Ann. Neurol. 2001; 50: 339-348Crossref PubMed Google Scholar). Our results indicate that the human paraneoplastic antigen Ma3 gene contains a functional heptanucleotide shift sequence and a classical H-type pseudoknot that promotes –1 frameshifting at ∼20% efficiency both in vitro and in vivo. Bioinformatic Analysis—Programs written in Perl were used to analyze 20,763 human mRNA sequences from the RefSeq data base at NCBI (www.ncbi.nlm.nih.gov/RefSeq/). The sequences were searched for ORF pairs in which ORF1 was the annotated coding sequence (CDS) and ORF2 extended at least 300 nt beyond ORF1 and was in the –1 frame relative to it. The overlapping sequences from these 5,709 ORF pairs were searched for the retrovirus-like heptanucleotide shift sites, A AAA AAC, U UUA AAC, G GGA AAC, and U UUU UUA, shown in the zero reading frame (18Hatfield D.L. Levin J.G. Rein A. Oroszlan S. Adv. Virus Res. 1992; 41: 193-239Crossref PubMed Scopus (97) Google Scholar). For the 1,153 sequences where such a motif was found, a 50-nt region downstream from the shift site was analyzed with the zipfold server (19Zuker M. Nucleic Acids Res. 2003; 31: 3406-3415Crossref PubMed Scopus (10393) Google Scholar) to determine the minimum free energy of potential secondary structures. Sequences that had a ΔG of –8 kcal/mol or less were analyzed with mfold (19Zuker M. Nucleic Acids Res. 2003; 31: 3406-3415Crossref PubMed Scopus (10393) Google Scholar, 20Mathews D.H. Sabina J. Zuker M. Turner D.H. J. Mol. Biol. 1999; 288: 911-940Crossref PubMed Scopus (3230) Google Scholar) to generate graphical representations of all available folds. These RNA secondary structure graphics were inspected manually to search for stem-loops that could be extended to pseudoknots with similarity to known frameshift stimulators. Protein Sequence Analysis—Searches with the Ma3 protein sequence were conducted with Psi-BLAST (21Altschul S.F. Madden T.L. Schäffer A.A. Zhang J. Zhang Z. Miller W. Lipman D.J. Nucleic Acids Res. 1997; 25: 3389-3402Crossref PubMed Scopus (60158) Google Scholar) in the nr data base at NCBI. Supplemental Table S2 shows the species and accession number of sequences considered to be homologs to Ma3. Sequences were searched for protein coding domains with the HMMER algorithm using the Pfam data base (22Sonnhammer E.L. Eddy S.R. Birney E. Bateman A. Durbin R. Nucleic Acids Res. 1998; 26: 320-322Crossref PubMed Scopus (575) Google Scholar). Protein sequences from orthologs of the Ma3 gene in human, chimp, macaque, orangutan, mouse, and rat were aligned with ClustalX (23Thompson J.D. Gibson T.J. Plewniak F. Jeanmougin F. Higgins D.G. Nucleic Acids Res. 1997; 24: 4876-4882Crossref Scopus (35593) Google Scholar). Columns that contained any gaps were removed, and a phylogenetic tree was bootstrapped by the neighbor joining method also using ClustalX. The trees were prepared for publication with TreeView (24Page R.D.M. Comput. Appl. Biosci. 1996; 12: 357-358PubMed Google Scholar). Construction of Clones for in Vitro and in Vivo Frameshifting Assays—The 435-nt region of Ma3 containing the shift site and potential kissing loops sequence was amplified by PCR using primers ATATTAGGTCACCAGGCTGCAGTTGAGTCGGGAAAC and ATATTAGGTACCAGGGGTGGTTGGATGAGCAGGAC (BstEII and KpnI restriction sites underlined) for the GST-β-globin vector, pGB01 (25Matsufuji S. Matsufuji T. Miyazaki Y. Murakami Y. Atkins J.F. Gesteland R.F. Hayashi S. Cell. 1995; 80: 51-60Abstract Full Text PDF PubMed Scopus (414) Google Scholar). Either a human brain cDNA library (Invitrogen) or human genomic DNA (Promega) was used as template for the PCRs. Following amplification, the products were restricted and run on an agarose gel. The correct sized fragments were isolated from a gel slice and ligated into BstEII/KpnI-digested pGB01. A series of deletions was generated using primers to the appropriate 3′ sequence and cloned as above. For the constructs containing mutations in the human Ma3 pseudoknot sequence or WT mouse Ma 3 and human Ma 5, complementary oligonucleotides were synthesized containing the overhangs for BstEII and KpnI. The polylinker region of the dual luciferase vector, p2luc (26Grentzmann G. Ingram J. Kelly P.J. Gesteland R.F. Atkins J.F. RNA. 1998; 4: 479-486Crossref PubMed Scopus (45) Google Scholar) was modified to introduce additional cloning sites. A region of p2luc was amplified by PCR using the following primers: ATATAAGTCGACTTGGATCCCCCGGGGAGCTCAGATCTACGGGCCCTCTCGAGGAAGACGCCAAAAACATAAAGAAAGGC (SalI, BamHI, SmaI, SacI, BglII, ApaI, and XhoI sites underlined) and CCAGAGGAATTCCATTA TCAGTGCAATTGTTTTGTC (EcoRI site underlined). The 692-bp PCR fragment was digested with SalI and EcoRI and ligated into p2luc, also digested with SalI and EcoRI, generating the vector, p2lucj. The human Ma3 pseudoknot sequence was introduced on complementary oligonucleotides containing the overhangs for SalI and XhoI that were cloned into the SalI/XhoI-digested p2lucj. All of the sequences were verified by automated dideoxy sequencing. In Vitro Frameshifting Assays—100 ηg of plasmid DNA from the GST-β-globin constructs was added to a 10-μl TnT T7-coupled transcription/translation rabbit reticulocyte lysate (Promega). Incubations were carried out at 30 °C for 1 h. Following treatment with 100 μg/ml RNase A at room temperature for 10 min, 30 μl of SDS sample buffer was added. The products were separated by 15% SDS-PAGE, and the gels were fixed, dried, and exposed to a phosphorimaging screen. The data were collected on a Molecular Dynamics phosphorimaging instrument and analyzed by ImageQuant software. The frameshifting efficiencies were determined by normalizing for the number of methionine residues in each product and calculating the percentage of frameshifting [frameshift/(termination + frameshift)] × 100%. The WT human Ma3 pseudoknot sequence promotes frameshifting at ∼20%. The efficiencies of the mutant, mouse Ma3, and human Ma5 sequences are reported relative to WT Ma3 (100%). All of the constructs were assayed at least three times, and the average is reported. In Vivo Frameshifting Assays—The dual luciferase assays were performed as previously described (9Baranov P.V. Henderson C.M. Anderson C.B. Gesteland R.F. Atkins J.F. Howard M.T. Virol. 2005; 332: 498-510Crossref PubMed Scopus (157) Google Scholar). A putative –1 frameshift site was identified in the human paraneoplastic antigen Ma3 gene. The original accession for Ma3 was NM_013364.1, and this sequence was used for the bioinformatic analysis. Shortly after work began on the experimental analysis of Ma3, NM_013364.1 was updated by NCBI staff to a new version, NM_013364.2, in which the sequence was revised. An internal region of 121 nt was deleted removing the heptanucleotide shift site. To resolve the conflict between these two sequences, diagnostic PCRs of human brain cDNAs with primers flanking the reported deletion were performed to determine whether the transcript was spliced as indicated by the revised sequence. No evidence for splicing was observed (data not shown). PCR products were also generated from the same cDNA library using primers specific to the 5′ coding sequence of the initiating Ma3 reading frame and the 3′ coding sequence of the –1 reading frame. These PCR fragments were cloned, and several clones were sequenced. There were no spliced variants, although there was evidence of editing in regions distant from the frameshift site in a minority of cases (data not shown). The potential frameshift site in Ma3, G GGA AAC, is followed by a 6-nt spacer and a predicted classical H-type pseudoknot. The Ma3 sequence further 3′ of the predicted pseudoknot was inspected, and two additional potential stem-loop structures were discovered, the loops of which could interact with the first stem-loop to form kissing loops (Fig. 1A). Therefore, the region tested encompassed the potential kissing loops sequence (411 nt 3′ of the putative frameshift site) that included the potential pseudoknot. The –1 Frameshift Event Is Efficient in Reticulocyte Lysates—To determine whether the predicted frameshift site in Ma3 is functional, the region including 15 nt 5′ and 411 nt 3′ of the G GGA AAC frameshift site was amplified by PCR. The region was cloned between two ORFs, glutathione S-transferase, and rabbit β-globin, such that –1 frameshifting was required for expression of the 3′ ORF. The vector, pGB01, contained a T7 promoter, and frameshifting activity was monitored in a coupled transcription/translation rabbit reticulocyte lysate system. The cloned region of the Ma3 sequence, +411, promoted –1 frameshifting at a level of 20% (Fig. 1B). To investigate the importance of the potential RNA structures, a series of deletions was constructed that successively removed the predicted structural elements, and the effects on –1 frameshifting were measured. Removal of the potential distal and proximal kissing loop structures, as well as sequences 3′ of the potential pseudoknot, constructs +374, +271, +198, and +122, had a small positive effect on the frameshifting (Fig. 1B and Table 1). The potential pseudoknot sequence, +53, supported frameshifting at the same level as the sequence encompassing both the potential proximal and distal kissing loops. In contrast, a construct containing only the first stem-loop of the predicted pseudoknot, +37, showed a dramatic reduction in frameshifting to 25% of the entire pseudoknot sequence (WT). Interestingly, when U34 was changed to C in the construct containing only the first stem-loop (+37 C34), allowing the formation of a G-C pair in place of a G:U wobble pair, frameshifting was observed at 54% of the wild type level (Table 1). The basal level of frameshifting with the G GGA AAC shift site and the 6-nt spacer (+6) was 4% of WT (Fig. 1B and Table 1). Mutation of the frameshift site to C GGC AAC to prevent tandem tRNA slippage further reduced frameshifting to 1% of WT (Fig. 1B and Table 1).TABLE 1The effect of mutations on — 1 frameshiftingConstructEffectWT%+411WT proximal and distal KL100+374Deletion of distal KL120+271Proximal KL126+198Deletion of proximal KL125+122Deletion of proximal KL124+53 (WT)Pseudoknot100+37Stem 1 only25+37, C34Strengthened stem 1 only54+6Frameshift site and spacer4C GGC AACMutant frameshift site1C8C9Disrupt stem 14G35G36Disrupt stem 18C15C16Disrupt stem 13G28G29Disrupt stem 12C8C9::G35G36Restore stem 162C15C16::G28G29Restore stem 142C23Disrupt stem 29G50Disrupt stem 214G24Disrupt stem 24C49Disrupt stem 219C23G24Disrupt stem 23C49G50Disrupt stem 214C23:G50Restore stem 2120G24:C49Restore stem 274C23G24::C49G50Restore stem 281G18U19Mutant loop 1120ΔA26Delete bulged A3C26Change bulged A21Human Ma5Pseudoknot54Mouse Ma3Pseudoknot75C34Stem 1150A1Spacer52G5Spacer115G18Loop 1108A40Loop 2120 Open table in a new tab Testing the Potential Pseudoknot Structure in Vitro—Sequences containing the presumptive pseudoknot were sufficient to stimulate a high level of –1 frameshifting. The pseudoknot structure was tested by making disruptive mutations in stems 1 and 2 as well as double mutations that restored the base pairing in the stems (Fig. 2A). The disruptive mutations in stem 1, C8C9, C15C16, G35G36, and G28G29 gave drastic reductions in –1 frameshifting, to 4, 3, 8, and 2% of WT, respectively (Fig. 2B, lanes 2–5, and Table 1). In constructs where the compensatory mutations would restore base pairing in stem 1, –1 frameshifting was observed at 62 (C8C9::G35G36) and 42% (C15C16::G28G29) of WT (Fig. 2B, lanes 6 and 7, and Table 1). The disruptive mutations in stem 2 also showed a greatly reduced level of frameshifting, C23, 9%; G24, 4%; C23G24, 3%; G50, 14%; C49, 19%; and C49G50, 14% of WT (Fig. 2C, lanes 3–8, and Table 1). The restorative constructs resulted in frameshifting levels relative to WT of 120% for C23:G50, 74% for G24:C49, and 81% for C23G24::C49G50 (Fig. 2C, lanes 9–11, and Table 1). It is interesting to note that restoring stem 2 resulted in activity closer to the wild type level than for restoring stem 1, as has been observed for other recoding stimulator pseudoknots (27Wills N.M. Gesteland R.F. Atkins J.F. Proc. Natl Acad. Sci. U. S. A. 1991; 88: 6991-6995Crossref PubMed Scopus (126) Google Scholar, 28Chamorro M. Parkin N. Varmus H.E. Proc. Natl Acad. Sci. U. S. A. 1992; 89: 713-717Crossref PubMed Scopus (142) Google Scholar). Other features of the pseudoknot were tested by making mutations. Changing the sequence of loop 1 from CA to GU, G18U19, had a positive effect on frameshifting (120% of WT) (Fig. 2B, lane 9, and Table 1). The presence of a presumptive unpaired A26 residue between stems 1 and 2 is reminiscent of the “bulged” A that induces a kink between two stems and is required for efficient frameshifting at the gag-pro junction in mouse mammary tumor virus (29Shen L.X. Tinoco Jr., I. J. Mol. Biol. 1995; 247: 963-978Crossref PubMed Scopus (181) Google Scholar, 30Chen X. Chamorro M. Lee S.I. Shen L.X. Hines J.V. Tinoco Jr., I. Varmus H.E. EMBO J. 1995; 14: 842-852Crossref PubMed Scopus (109) Google Scholar). When the A26 residue was changed to C, C26, frameshifting was reduced to 21% of WT (Fig. 2C, lane 13, and Table 1). More strikingly, when A26 was deleted, frame-shifting was virtually eliminated, 3% of WT (Fig. 2C, lane 12, and Table 1), indicating the importance of the A residue and raising the possibility that it is responsible for causing a required kink between the stems. Ma5 and other Ma3 genes contain a putative –1 frameshift site, G GGA AAC, followed by a potential pseudoknot (see below). The frameshift regions from human Ma5 and mouse Ma3 were tested for activity in reticulocyte lysates. The human Ma5 sequence was 54% as efficient as the human Ma3 sequence, whereas the mouse Ma3 sequence was 75% as efficient (Table 1). There are five nucleotide differences between the mouse and human Ma3 pseudoknot regions. One change, U34 → C replaces a G:U wobble pair in stem 1 in human Ma3 with a G-C pair, which should increase the thermodynamic stability of the stem. The effect of the G10-C34 base pair in the context of the human Ma3 pseudoknot is to increase frameshifting to 150% of WT (Fig. 2B, lane 8, and Table 1). Two of the other nucleotide differences between the mouse and human sequences occur in the spacer region. Replacement of G1 by A or A5 by G in the human sequence resulted in 52 and 115% of WT frameshifting (Table 1). The remaining two nucleotide differences occur in the loop regions of the pseudoknot. Replacing C18 in loop 1 with G or G40 in loop 2 with A in the human sequence increased frameshifting to 108 and 120% of WT, respectively (Table 1). Testing the Pseudoknot Sequence in Vivo—The human Ma3 pseudoknot sequence promotes efficient –1 frameshifting in vitro.To test whether frameshifting is functional in vivo, the pseudoknot region was cloned into a dual luciferase reporter where expression of the 3′ reporter, firefly luciferase, is dependent on –1 frameshifting. The plasmids were transfected into HEK 293 cells, and Renilla and firefly luciferase activities were measured in cell lysates. The Ma3 pseudoknot promoted –1 frameshifting at a level of 18%, comparable with the in vitro level of 20% (data not shown). Orthologs in Other Organisms—Homology searches with BLAST (21Altschul S.F. Madden T.L. Schäffer A.A. Zhang J. Zhang Z. Miller W. Lipman D.J. Nucleic Acids Res. 1997; 25: 3389-3402Crossref PubMed Scopus (60158) Google Scholar) using human paraneoplastic Ma3 sequence revealed similar Ma3 genes in mouse, rat, chimpanzee, and macaque. The alignment of the pseudoknot sequences shows that the stem regions are highly conserved, whereas there are some differences in the spacer and loops (currently the only chimp sequence available ends at the zero frame terminator codon within the pseudoknot). In the rodents, stem 1 is strengthened by the replacement of the G-U wobble pair (in primates) with a G-C pair. Although these species are closely related, the fact that mutations in the pseudoknot region appear to be accumulating preferentially in the loop and spacer regions suggests selection for the pseudoknot. Family of Ma Genes—There are currently six genes in the human genome annotated as being part of the paraneoplastic Ma family. These are designated Ma1, Ma2, Ma3, MAOP-1 (Ma4), Ma5, and PNMA6A. We will use Ma6 to refer to PNMA6A in this paper. Each of the sequences was analyzed for frameshifting features and protein coding domains. All of the Ma genes show homology to the same region of various retrotransposon Gag proteins (Fig. 3), although only the Ma2 and Ma3 genes have homology that are assigned e values of less than 0.001 by the HMMER algorithm (22Sonnhammer E.L. Eddy S.R. Birney E. Bateman A. Durbin R. Nucleic Acids Res. 1998; 26: 320-322Crossref PubMed Scopus (575) Google Scholar). Ma3 is the only member of the family to contain a CCHC zinc finger. As noted above, Ma5 has the same G GGA AAC shift site and a pseudoknot, distinct but similar in both sequence and structure to the Ma3 pseudoknot. Although Ma6 sequence has the potential to form a strong stem-loop or pseudoknot near the end of ORF1, it is quite different in both structure and sequence from the pseudoknot in Ma3. None of the other Ma genes contain a classical retroviral shift site including the G GGA AAC motif found in Ma3. Phylogenetic analysis of the members of the Ma gene family from various mammals shows that the Ma3 genes from orangutan and crabeating macaque (NCBI GenBank™ accession numbers CR861370.1 and AB062932, respectively) cluster with the Ma2 genes from the other species (Fig. 4). Closer analysis of these gene sequences reveals that they have clearly been incorrectly annotated and are, in fact, Ma2 genes. In this systematic search for new cases of recoding, the first mammalian cellular gene identified with a classic –1 programmed shift site and stimulatory pseudoknot was human Ma3. The Ma3 gene has many features similar to retroelements including conservation of a well defined zinc finger and other regions of the Gag protein from several retrotransposons. However, none of the Ma family of genes code for domains in the Pol protein, i.e. aspartyl protease, reverse transcriptase, or integrase, and thus, they are certainly not associated with any active retroelements. The only previously known mammalian gene to utilize –1 programmed frameshifting in its expression, edr (embryonal carcinoma differentiation regulated) in mice (10Shigemoto K. Brennan J. Walls E. Watson C.J. Stott D. Rigby P.W. Reith A.D. Nucleic Acids Res. 2001; 29: 4079-4088Crossref PubMed Scopus (85) Google Scholar, 11Manktelow E. Shigemoto K. Brierley I. Nucleic Acids Res. 2005; 33: 1553-1563Crossref PubMed Scopus (73) Google Scholar) and PEG10, the homolog in humans, resembles Ma3 in having homology to retroelement gag genes. The CCHC-zinc fingers are similar in Ma3 and edr, but the other retrovirus-like feature in edr, a putative aspartyl protease catalytic site, is absent in Ma3. Interestingly, searches for homology to the Ma3 protein using Psi-BLAST (21Altschul S.F. Madden T.L. Schäffer A.A. Zhang J. Zhang Z. Miller W. Lipman D.J. Nucleic Acids Res. 1997; 25: 3389-3402Crossref PubMed Scopus (60158) Google Scholar) reveal that the best homology hits in the sequence data bases are to retroelements from Japanese rice. In these retroelements, however, a single frame encodes the Gag-Pol polyprotein (as is the case with most retroelements in plants (31Gao X. Havecker E.R. Baranov P.V. Atkins J.F. Voytas D.F. RNA. 2003; 9: 1422-1430Crossref PubMed Scopus (64) Google Scholar)), whereas Ma3 clearly has a retrovirus-like –1 frameshifting mechanism. This similarity could have resulted from an artifact of the Psi-BLAST search algorithm; inferring phylogeny from homology is not always accurate. It could also suggest that the history of the Ma family of genes is more complex than straight-forward descent from a single retroelement. Proteins encoded by mobile genetic elements occasionally evolve to assume cellular roles (32Gao X. Voytas D.F. Trends Genet. 2005; 21: 133-137Abstract Full Text Full Text PDF PubMed Scopus (26) Google Scholar, 33Ono R. Nakamura K. Inoue K. Naruse M. Usami T. Wakisaka-Saito N. Hino T. Suzuki-Migishima R. Ogonuki N. Miki H. Kohda T. Ogura A. Yokoyama M. Kaneko-Ishino T. Ishino F. Nat. Genet. 2006; 38: 101-106Crossref PubMed Scopus (315) Google Scholar). It is perhaps not surprising that a proportion of them also utilize frameshifting, which is well known in the decoding of retroviruses and, to an increasing extent, in retroelements (31Gao X. Havecker E.R. Baranov P.V. Atkins J.F. Voytas D.F. RNA. 2003; 9: 1422-1430Crossref PubMed Scopus (64) Google Scholar, 34Stahl G. Ben Salem S. Li Z. McCarty G. Raman A. Shah M. Farabaugh P.J. Co" @default.
• W2073636715 created "2016-06-24" @default.
• W2073636715 creator A5022276406 @default.
• W2073636715 creator A5030164941 @default.
• W2073636715 creator A5033458397 @default.
• W2073636715 creator A5050295401 @default.
• W2073636715 creator A5060219897 @default.
• W2073636715 date "2006-03-01" @default.
• W2073636715 modified "2023-10-01" @default.
• W2073636715 title "A Functional –1 Ribosomal Frameshift Signal in the Human Paraneoplastic Ma3 Gene" @default.
• W2073636715 cites W1590826940 @default.
• W2073636715 cites W167474878 @default.
• W2073636715 cites W1839549959 @default.
• W2073636715 cites W1963611146 @default.
• W2073636715 cites W1970969100 @default.
• W2073636715 cites W1972855007 @default.
• W2073636715 cites W1978326447 @default.
• W2073636715 cites W1984700926 @default.
• W2073636715 cites W1989319130 @default.
• W2073636715 cites W1990401246 @default.
• W2073636715 cites W1999410197 @default.
• W2073636715 cites W2005439008 @default.
• W2073636715 cites W2008700564 @default.
• W2073636715 cites W2009818318 @default.
• W2073636715 cites W2012192331 @default.
• W2073636715 cites W2012302177 @default.
• W2073636715 cites W2014528494 @default.
• W2073636715 cites W2019337061 @default.
• W2073636715 cites W2035613303 @default.
• W2073636715 cites W2035825330 @default.
• W2073636715 cites W2040843640 @default.
• W2073636715 cites W2047135941 @default.
• W2073636715 cites W2051501806 @default.
• W2073636715 cites W2064370916 @default.
• W2073636715 cites W2064929678 @default.
• W2073636715 cites W2066654791 @default.
• W2073636715 cites W2067191137 @default.
• W2073636715 cites W2073289420 @default.
• W2073636715 cites W2078947806 @default.
• W2073636715 cites W2087297426 @default.
• W2073636715 cites W2092974248 @default.
• W2073636715 cites W2093702519 @default.
• W2073636715 cites W2097382368 @default.
• W2073636715 cites W2101164055 @default.
• W2073636715 cites W2110433308 @default.
• W2073636715 cites W2112017997 @default.
• W2073636715 cites W2116915784 @default.
• W2073636715 cites W2124871329 @default.
• W2073636715 cites W2125912475 @default.
• W2073636715 cites W2129815091 @default.
• W2073636715 cites W2134709176 @default.
• W2073636715 cites W2141157874 @default.
• W2073636715 cites W2149407899 @default.
• W2073636715 cites W2149701165 @default.
• W2073636715 cites W2152669810 @default.
• W2073636715 cites W2158714788 @default.
• W2073636715 cites W2159678490 @default.
• W2073636715 cites W2160216077 @default.
• W2073636715 cites W2161612890 @default.
• W2073636715 cites W2167402805 @default.
• W2073636715 cites W2210162472 @default.
• W2073636715 doi "https://doi.org/10.1074/jbc.m511629200" @default.
• W2073636715 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16407312" @default.
• W2073636715 hasPublicationYear "2006" @default.
• W2073636715 type Work @default.
• W2073636715 sameAs 2073636715 @default.
• W2073636715 citedByCount "73" @default.
• W2073636715 countsByYear W20736367152012 @default.
• W2073636715 countsByYear W20736367152013 @default.
• W2073636715 countsByYear W20736367152014 @default.
• W2073636715 countsByYear W20736367152015 @default.
• W2073636715 countsByYear W20736367152016 @default.
• W2073636715 countsByYear W20736367152017 @default.
• W2073636715 countsByYear W20736367152018 @default.
• W2073636715 countsByYear W20736367152019 @default.
• W2073636715 countsByYear W20736367152020 @default.
• W2073636715 countsByYear W20736367152021 @default.
• W2073636715 countsByYear W20736367152022 @default.
• W2073636715 countsByYear W20736367152023 @default.
• W2073636715 crossrefType "journal-article" @default.
• W2073636715 hasAuthorship W2073636715A5022276406 @default.
• W2073636715 hasAuthorship W2073636715A5030164941 @default.
• W2073636715 hasAuthorship W2073636715A5033458397 @default.
• W2073636715 hasAuthorship W2073636715A5050295401 @default.
• W2073636715 hasAuthorship W2073636715A5060219897 @default.
• W2073636715 hasBestOaLocation W20736367151 @default.
• W2073636715 hasConcept C104317684 @default.
• W2073636715 hasConcept C185592680 @default.
• W2073636715 hasConcept C199360897 @default.
• W2073636715 hasConcept C2779843651 @default.
• W2073636715 hasConcept C29906990 @default.
• W2073636715 hasConcept C41008148 @default.
• W2073636715 hasConcept C501734568 @default.
• W2073636715 hasConcept C54355233 @default.
• W2073636715 hasConcept C86803240 @default.
• W2073636715 hasConcept C95444343 @default.
• W2073636715 hasConcept C95811502 @default.
• W2073636715 hasConceptScore W2073636715C104317684 @default.

• next