FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2073836693> ?p ?o ?g. }

• W2073836693 endingPage "17436" @default.
• W2073836693 startingPage "17429" @default.
• W2073836693 abstract "S91 melanoma cells are growth arrested and differentiate when treated with retinoids. These processes correlate with expression of the retinoic acid receptor (RAR)β gene, which is induced through a retinoic acid response element (βRARE). We wished to determine which endogenous retinoid receptors (RARs and retinoid X receptors, RXRs) mediate induction of the RARβ gene. We show that RXRα and RXRβ are constitutively expressed. Electrophoretic mobility shift assays with nuclear extracts show specific binding to the βRARE (Complex I) in untreated cells, which can be supershifted by antibodies against RXRs but not by anti-RAR antibodies. After 48 h of treatment with retinoic acid, Complex I is replaced by a faster migrating Complex II, which can be supershifted by anti-RARβ and anti-RXRα antibodies. This suggests that induction of the RARβ gene is largely mediated by RXRs only. Accordingly, we also find that 9-cis RA, which activates both RAR and RXR, is a more potent inducer of the RARβ gene than RA, which only activates RAR. After 48 h, all RXRs appear to be titrated by the newly synthesized RARβ into an RARβ•RXR heterodimer complex. Thus, it appears that the βRARE is sequentially occupied by RXR dimers and RAR•RXR heterodimers. S91 melanoma cells are growth arrested and differentiate when treated with retinoids. These processes correlate with expression of the retinoic acid receptor (RAR)β gene, which is induced through a retinoic acid response element (βRARE). We wished to determine which endogenous retinoid receptors (RARs and retinoid X receptors, RXRs) mediate induction of the RARβ gene. We show that RXRα and RXRβ are constitutively expressed. Electrophoretic mobility shift assays with nuclear extracts show specific binding to the βRARE (Complex I) in untreated cells, which can be supershifted by antibodies against RXRs but not by anti-RAR antibodies. After 48 h of treatment with retinoic acid, Complex I is replaced by a faster migrating Complex II, which can be supershifted by anti-RARβ and anti-RXRα antibodies. This suggests that induction of the RARβ gene is largely mediated by RXRs only. Accordingly, we also find that 9-cis RA, which activates both RAR and RXR, is a more potent inducer of the RARβ gene than RA, which only activates RAR. After 48 h, all RXRs appear to be titrated by the newly synthesized RARβ into an RARβ•RXR heterodimer complex. Thus, it appears that the βRARE is sequentially occupied by RXR dimers and RAR•RXR heterodimers. Retinoids, a group of chemically related molecules derived from vitamin A (retinol), regulate a large number of biological processes in vertebrate development, cell growth, differentiation, and homeostasis (1De Luca L.M. FASEB J. 1991; 5: 2924-2933Crossref PubMed Scopus (816) Google Scholar, 2Tabin C.J. Cell. 1991; 66: 199-217Abstract Full Text PDF PubMed Scopus (365) Google Scholar, 3Gudas L.J. Cell Growth. & Differ. 1992; 3: 655-662PubMed Google Scholar). The actions of retinoids are mediated by two classes of nuclear receptors: retinoic acid receptors (RARs)1, 1The abbreviations used are: RARretinoic acid receptorRAall-trans-retinoic acidRXRretinoid X receptorRAREretinoic acid response elementDRdirect repeatEMSAelectrophoretic mobility shift assayECembryonic carcinomaTTNPB4-[2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)1E-propenylbenzoic acidAm80[4-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl)2-naphtalenylcarbamoyl]benzoic acid. which bind all-trans-retinoic acid (RA) and 9-cis-retinoic acid (9-cis-RA) with similar affinities, and retinoid X receptors (RXRs), which bind 9-cis-RA with much higher affinity than RA(3Gudas L.J. Cell Growth. & Differ. 1992; 3: 655-662PubMed Google Scholar, 4Glass C.K. DiRenzo J. Kurokawa R. Han Z. DNA Cell Biol. 1991; 10: 623-638Crossref PubMed Scopus (89) Google Scholar, 5Leid M. Kastner P. Chambon P. Trends Biochem. Sci. 1992; 17: 427-433Abstract Full Text PDF PubMed Scopus (804) Google Scholar, 6Stunnenberg H.G. BioEssays. 1993; 15: 309-315Crossref PubMed Scopus (139) Google Scholar). RARs and RXRs belong to an extensive gene family of ligand-dependent transcription factors that together form the steroid/thyroid hormone receptor superfamily(7Evans R.M. Science. 1988; 240: 889-895Crossref PubMed Scopus (6335) Google Scholar, 8Beato M. Cell. 1989; 56: 335-344Abstract Full Text PDF PubMed Scopus (2852) Google Scholar). There are three types of both RARs and RXRs (α, β, and γ), encoded by separate genes, that have different spatio/temporal expression patterns(9Zelent A. Krust A. Petkovich M. Kastner P. Chambon P. Nature. 1989; 339: 714-717Crossref PubMed Scopus (677) Google Scholar, 10Dolle P. Ruberte E. Leroy P. Morriss-Kay G. Chambon P. Development. 1990; 110: 1133-1151Crossref PubMed Google Scholar, 11Kastner P. Krust A. Mendelsohn C. Garnier J.M. Zelent A. Leroy P. Staub A. Chambon P. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 2700-2704Crossref PubMed Scopus (276) Google Scholar, 12Ruberte E. Dolle P. Krust A. Zelent A. Morriss-Kay G. Chambon P. Development. 1990; 108: 213-222Crossref PubMed Google Scholar, 13Ruberte E. Dolle P. Chambon P. Morriss-Kay G. Development. 1991; 111: 45-60Crossref PubMed Google Scholar, 14Mangelsdorf D.J. Borgmeyer U. Heyman R.A. Zhou J.Y. Ong E.S. Oro A.E. Kakizuka A. Evans R.M. Genes & Dev. 1992; 6: 329-344Crossref PubMed Scopus (1067) Google Scholar). In addition, they are also subject to alternative splicing and/or alternate promoter choice, thereby generating a large family of mainly N-terminally different receptor isoforms(1De Luca L.M. FASEB J. 1991; 5: 2924-2933Crossref PubMed Scopus (816) Google Scholar, 5Leid M. Kastner P. Chambon P. Trends Biochem. Sci. 1992; 17: 427-433Abstract Full Text PDF PubMed Scopus (804) Google Scholar). Thus, it is conceivable that certain RAR•RXR isoforms may serve specific genetic programs. retinoic acid receptor all-trans-retinoic acid retinoid X receptor retinoic acid response element direct repeat electrophoretic mobility shift assay embryonic carcinoma 4-[2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)1E-propenylbenzoic acid [4-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl)2-naphtalenylcarbamoyl]benzoic acid. RARs and RXRs bind specific DNA elements in the promoter region of target genes called RA response elements (RAREs). The majority of RAREs appears to consist of two direct repeats (DR), or half-sites, of the sequence AGGTCA spaced by five nucleotides (DR5)(15Naar A.M. Boutin J.-M. Lipkin S.M. Yu V.C. Holloway J.F. Glass C.K. Rosenfeld M.G. Cell. 1991; 65: 1267-1279Abstract Full Text PDF PubMed Scopus (463) Google Scholar, 16Umesono K. Murakami K.K. Thompson C.C. Evans R.M. Cell. 1991; 65: 1255-1266Abstract Full Text PDF PubMed Scopus (1497) Google Scholar). Numerous in vitro experiments have shown that RARs and RXRs bind with low affinity as homodimers to DR5, but, when mixed, RAR•RXR heterodimers can form that bind with much higher affinity than either homodimer. These data, together with transfection experiments in mammalian cells and yeast, suggest that the heterodimer is the transcriptionally active species when both partners are present (17Yu V.C. Delsert C. Andersen B. Holloway J.M. Devary O.V. Naar A.M. Kim S.Y. Boutin J.-M. Glass C.K. Rosenfeld M.G. Cell. 1991; 67: 1251-1266Abstract Full Text PDF PubMed Scopus (1060) Google Scholar, 18Bugge T.H. Pohl J. Lonnoy O. Stunnenberg H.G. EMBO J. 1992; 11: 1409-1418Crossref PubMed Scopus (349) Google Scholar, 19Durand B. Saunders M. Leroy P. Leid M. Chambon P. Cell. 1992; 71: 73-85Abstract Full Text PDF PubMed Scopus (358) Google Scholar, 20Kliewer S.A. Umesono K. Mangelsdorf D.J. Evans R.M. Nature. 1992; 355: 446-449Crossref PubMed Scopus (1241) Google Scholar, 21Leid M. Kastner P. Lyons R. Nakshatri H. Saunders M. Zacharewski T. Chen J.-Y. Staub A. Garnier J.-M. Mader S. Chambon P. Cell. 1992; 68: 377-395Abstract Full Text PDF PubMed Scopus (1023) Google Scholar, 22Marks M.S. Hallenbeck P.L. Nagata T. Segars J.H. Appella E. Nikodem V.M. Ozato K. EMBO J. 1992; 11: 1419-1435Crossref PubMed Scopus (367) Google Scholar, 23Zhang X.-K. Hoffmann B. Tran P.B.-V. Graupner G. Pfahl M. Nature. 1992; 355: 441-445Crossref PubMed Scopus (793) Google Scholar, 24Hall B.L. Smit-McBride Z. Privalsky M.L. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 6929-6933Crossref PubMed Scopus (57) Google Scholar, 25Heery D.M. Zacharewski T. Pierrat B. Gronemeyer H. Chambon P. Losson R. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 4281-4285Crossref PubMed Scopus (72) Google Scholar, 26Mader S. Chen J.-Y. Chen Z. White J. Chambon P. Gronemeyer H. EMBO J. 1993; 12: 5029-5041Crossref PubMed Scopus (197) Google Scholar). However, it was recently found that an element with a spacing of one nucleotide (DR1) is also bound by RAR•RXR heterodimers but in a transcriptionally inactive conformation. In contrast, in the presence of 9-cis-RA, RXR homodimers specifically can bind and activate transcription from promoters with this element(27Mangelsdorf D.J. Umesono K. Kliewer S.A. Borgmeyer U. Ong E.S. Evans R.M. Cell. 1991; 66: 555-561Abstract Full Text PDF PubMed Scopus (525) Google Scholar, 28Zhang X.-K. Lehmann J. Hoffmann B. Dawson M.I. Cameron J. Graupner G. Hermann T. Tran P. Pfahl M. Nature. 1992; 358: 587-591Crossref PubMed Scopus (521) Google Scholar). An interesting aspect of retinoids is their effect on differentiation of neoplastic cells, both in vivo and in vitro (1, 3 and references therein). For instance, there are over 200 retinoid-sensitive tumor cell lines that could provide a useful model system to gain insight into how retinoids affect malignant growth(29Amos B. Lotan R. Methods Enzymol. 1990; 189: 100-109Google Scholar). In this report, we have focused on the murine melanoma cell line S91. Upon treatment with RA, these cells become growth arrested and display an enhanced differentiated phenotype, exemplified by the formation of more and longer dendritic extensions and an increase in melanin synthesis(30Lotan R. Giotta G. Nork E. Nicolson G.L. J. Natl. Cancer Inst. 1978; 60: 1035-1041Crossref PubMed Scopus (134) Google Scholar, 31Lotan R. Lotan D. J. Cell. Physiol. 1981; 106: 179-189Crossref PubMed Scopus (67) Google Scholar, 32Clifford J.L. Petkovich M. Chambon P. Lotan R. Mol. Endocrinol. 1990; 4: 1546-1555Crossref PubMed Scopus (73) Google Scholar). The occurrence of malignant melanoma has been steadily on the rise(33Goldstein A.M. Tucker M.A. Curr. Opin. Oncol. 1993; 5: 358-363Crossref PubMed Scopus (28) Google Scholar), and prognosis is still poor when discovered in advanced state. Unfortunately, little is known about the molecular events of malignant change in melanocytes, and S91 cells may be very useful for these studies. Previous reports have shown that RARα and RARγ are constitutively expressed in S91 cells but that RARβ is rapidly induced by treatment with retinoids. RARβ expression is maximal after 24 h and is independent of de novo protein synthesis(32Clifford J.L. Petkovich M. Chambon P. Lotan R. Mol. Endocrinol. 1990; 4: 1546-1555Crossref PubMed Scopus (73) Google Scholar, 34Redfern C.P.F. Daly A.K. Latham J.A.E. Todd C. FEBS Lett. 1990; 273: 19-22Crossref PubMed Scopus (30) Google Scholar). Interestingly, retinoids that fail to induce RARβ do not cause growth arrest(32Clifford J.L. Petkovich M. Chambon P. Lotan R. Mol. Endocrinol. 1990; 4: 1546-1555Crossref PubMed Scopus (73) Google Scholar), and differentiation becomes phenotypically apparent only after RARβ mRNA levels have reached their highest levels(30Lotan R. Giotta G. Nork E. Nicolson G.L. J. Natl. Cancer Inst. 1978; 60: 1035-1041Crossref PubMed Scopus (134) Google Scholar). One interpretation is that a certain threshold level of RARβ is required to facilitate differentiation of S91 cells. It is, therefore, important to know which proteins regulate RARβ expression. Retinoid-dependent induction of the RARβ2 gene (the major RARβ isoform) is mediated through an RARE in the RARβ2 promoter (βRARE, a DR5-like element), which has been well characterized in in vitro studies(35Hoffmann B. Lehmann J.M. Zhang X.K. Hermann T. Husmann M. Graupner G. Pfahl M. Mol. Endocrinol. 1990; 4: 1727-1736Crossref PubMed Scopus (197) Google Scholar, 36Sucov H.M. Murakami K.H. Evans R.M. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 5392-5396Crossref PubMed Scopus (414) Google Scholar, 37de The H. Vivanco-Ruiz M.D.M. Tiollais P. Stunnenberg H. Dejean A. Nature. 1990; 343: 177-180Crossref PubMed Scopus (846) Google Scholar). In this report, we investigated which endogenous, intracellular RAR•RXR isoforms mediate the retinoid-dependent induction of the RARβ gene in S91 cells. Our data provide evidence that, surprisingly, a complex containing RXRs, but not RAR•RXR heterodimers, largely regulates RARβ gene expression. Poly(A)+ RNA was extracted from cells grown at about 60% confluency in 5-8 flasks (162 cm2) for each time point, using a poly(A)+ RNA isolation kit (Stratagene, La Jolla, CA). Total RNA was isolated from 2 flasks for each time point according to (38Chirgwin J.M. Przybyla A.E. MacDonald R.J. Rutter W.J. Biochemistry. 1979; 18: 5294-5299Crossref PubMed Scopus (16654) Google Scholar). 1 εg of poly(A)+ RNA or 15 εg of total RNA was subjected to electrophoresis through a denaturing formaldehyde-agarose gel (1%), transferred to a nylon membrane (Duralon-UV, Stratagene, La Jolla, CA) according to (39Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar), and cross-linked in a Stratagene Stratalinker. Northern blots were hybridized with the following DNA restriction fragments, which had been gel-purified and random-primed in the presence of [α-32P]dCTP: RARβ, EcoRI-EagI fragment from pSG5RARβ; RXRα, AvaI fragment from pBSRXRα; RXRβ, EcoRI-NheI fragment from pBSRXRβ and a cyclophilin BamHI fragment. Blots were washed in 0.1 × SSC, 0.1% SDS at 55°C and autoradiographed. Quantitation of Northern blots was performed on a Molecular Dynamics PhosphorImager (Sunnyvale, CA) using ImageQuant software (version 3.3). Procedures for obtaining nuclear extracts from cells (grown in 1-2 flasks (162 cm2) at about 60% confluency for each time point) and EMSA conditions were essentially performed as described previously(40Yen P.M. Darling D.S. Carter R.L. Forgione M. Umeda P.K. Chin W.W. J. Biol. Chem. 1992; 267: 3565-3568Abstract Full Text PDF PubMed Google Scholar); typically, 1.5-3 εg of nuclear extract was used. Incubation with gel-purified 32P-end-labeled oligonucleotides was performed in the presence of 1 εg of salmon sperm DNA. The reaction mix minus probe was incubated for 15 min at room temperature; probe (50,000 cpm, ∼5 fmol) was added and incubated for another 30 min, and then put on ice for 10 min before electrophoresis on 4% polyacrylamide gel. For antibody supershifts, 1 εl of antiserum was added at this point and incubated at 4°C for another 2 h before electrophoresis. The specificity and characterization of the RXR antibodies will be described elsewhere(54Sugawara A. Yen P.M. Qi Y. Lechan R.M. Chin W.W. Endocrinology. 1995; 136: 1766-1774Crossref PubMed Scopus (65) Google Scholar). The RARβ antibody does not cross-react with RARα or RARγ. The RARc antibody reacts about equally well with RARα and RARβ, less well with RARγ in immunoprecipitations, and about equally well with all three RAR-isoforms in EMSA (data not shown).2 2B. Neel, personal communication. The following oligonucleotides were used: βRARE (−61/-29), AGCTTCCGGGAAGGGTTCACCGAAAGTTCACTCGCATAAGGCCCTTCCCAAGTGGCTTTCAAGTGAGCGTATTCGA; TK minimal promoter (−46/+1), AGCGGTCCGAGGTCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACCAGGCTCCAGGTGAAGCGTATAATTCCACTGCGCACACCGGAGCTTCGA; CTF binding site from TK promoter (−96/-62), TCGACAGCGTCTTGTCATTGGCGAATTCGAACACGCAGATGGTCGCAGAACAGTAACCGCTTAAGCTTGTGCGTCTACAGCT; DR1, AGCTAGTTACTTATTGAGGTCAGAGGTCAAGTTACGTCAATGAATAACTCCAGTCTCCTGTTCAATGCTCGA. 10 εg of nuclear extract was loaded on a 10% SDS slab gel and analyzed by SDS-polyacrylamide gel electrophoresis. A 1:1000 dilution of primary antibody was used, followed by a 1:2000 dilution of a peroxidase-coupled goat-anti-rabbit secondary antibody. Visualization of bands was done by using an ECL detection kit (Amersham Corp.) Exposure time was about 30 s on x-ray film. S91 cells (ATTC CCL 53.1) were grown in Dulbecco's modified Eagle's medium with 10% fetal bovine serum at 37°C in 5% CO2 in humidified air. Solutions of RA and 9-cis-RA were made fresh every 24 h in ethanol. Plates that did not receive ligand received ethanol instead. Working concentrations were 10−6 or 10−5M, and plates were kept in the dark as much as possible. The oligonucleotide with the βRARE was cloned in the HindIII site of pBluescript and confirmed by dideoxy sequencing. The coding strand was labeled by cutting the plasmid with XhoI followed by Klenow-fill-in in the presence of [α-32P]dCTP, dTTP, and dGTP. The plasmid was then cut with SpeI. Similarly, the noncoding strand was labeled by digesting the plasmid with SpeI and Klenow-fill-in in the presence of [α-32P]dCTP and dTTP followed by digestion with XhoI. Both probes were gel-purified and chemically modified by dimethyl sulfate or KMnO4, essentially as described previously(41Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Short Protocols in Molecular Biology. John Wiley & Sons, New York, NY1992Google Scholar, 55Ikeda M. Rhee M. Chin W.W. Endocrinology. 1995; 135: 1628-1638Crossref Scopus (45) Google Scholar). EMSA was performed in 6% polyacrylamide gel with 6 εg and 3 εg of the nuclear extracts at the 0 (Complex I) and 48 (Complex II) h time points, respectively. Free and bound probe was eluted, digested as described(41Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Short Protocols in Molecular Biology. John Wiley & Sons, New York, NY1992Google Scholar, 55Ikeda M. Rhee M. Chin W.W. Endocrinology. 1995; 135: 1628-1638Crossref Scopus (45) Google Scholar), and run on a 8% DNA sequence gel. Quantitation of individual bands was performed by PhosphorImager scanning analysis, and normalized for loading differences. As a first step in the analysis of the βRARE, we decided to complete the retinoid receptor inventory in S91 cells by analyzing the nature of the expressed RXR species. Poly(A)+ RNA was isolated from cells that were untreated (0 h) or treated with 1 εM RA for the indicated time period (Fig. 1) and analyzed by Northern blotting. As a positive control, we probed the blot with RARβ cDNA. In agreement with published reports(32Clifford J.L. Petkovich M. Chambon P. Lotan R. Mol. Endocrinol. 1990; 4: 1546-1555Crossref PubMed Scopus (73) Google Scholar, 34Redfern C.P.F. Daly A.K. Latham J.A.E. Todd C. FEBS Lett. 1990; 273: 19-22Crossref PubMed Scopus (30) Google Scholar), levels of RARβ mRNA increase from barely detectable in untreated cells, to readily observable after only 2 h of treatment. Levels continue to increase largely over the first 24 h, after which maximum levels appear to have been reached (10-12-fold over untreated cells). The band in Fig. 1 denoted as RARβ represents the product of the RARβ2 gene, because a polymerase chain reaction-generated probe containing the RARβ2-specific N-terminal sequence hybridizes with the same band (not shown). Interestingly, the RXRα probe detects three transcripts in treated and untreated cells that are weakly up-regulated (about 2-fold) by RA. Of these, only the smallest transcript (∼5 kb) appears to have the size reported by Mangelsdorf et al.(14Mangelsdorf D.J. Borgmeyer U. Heyman R.A. Zhou J.Y. Ong E.S. Oro A.E. Kakizuka A. Evans R.M. Genes & Dev. 1992; 6: 329-344Crossref PubMed Scopus (1067) Google Scholar) for RXRα. The larger transcripts may be due to deregulated expression and/or chromosomal rearrangements in these cells. RXRβ expression is also observed in untreated cells and likewise is only slightly up-regulated by RA. The size of the (single) transcript is as expected (14Mangelsdorf D.J. Borgmeyer U. Heyman R.A. Zhou J.Y. Ong E.S. Oro A.E. Kakizuka A. Evans R.M. Genes & Dev. 1992; 6: 329-344Crossref PubMed Scopus (1067) Google Scholar). In contrast, RXRγ could not be detected (data not shown). Thus, in the absence of high doses of RA, S91 cells contain mRNAs for RARα, RARγ(32Clifford J.L. Petkovich M. Chambon P. Lotan R. Mol. Endocrinol. 1990; 4: 1546-1555Crossref PubMed Scopus (73) Google Scholar, 34Redfern C.P.F. Daly A.K. Latham J.A.E. Todd C. FEBS Lett. 1990; 273: 19-22Crossref PubMed Scopus (30) Google Scholar), RXRα, RXRβ, and very low levels of RARβ. As shown in Fig. 1, all receptors are constitutively expressed except for RARβ, which is induced by RA. Next, we wished to determine the nature of the nuclear proteins that mediate RA-regulation of RARβ gene transcription. For this purpose, we examined the binding of proteins, present in nuclear extracts obtained from cells undergoing the same treatment as described above, to a labeled DNA probe containing the minimal βRARE (see Fig. 5B) in EMSA. The results are shown in Fig. 2. In untreated cells, a single retarded complex is observed (Complex I), which essentially remains unchanged over the first 24 h of RA treatment, although there appears to be more binding at the 8 h time point. However, after 48 h of RA-treatment, Complex I has completely disappeared. Interestingly, a new complex (Complex II) with a higher mobility becomes apparent at the 24 h time point, and after 48 h it has greatly increased in intensity and is the only remaining complex. Binding of both these complexes is specific, as illustrated by the DNA competition studies with the 24 h time point sample (both Complexes I and II are present in this extract). Fig. 2 shows that both complexes can be effectively competed by a 50-fold excess of cold βRARE but not by two unrelated oligonucleotides representing the CCAAT-box transcription factor binding site and the minimal promoter region of the Herpes simplex virus thymidine kinase gene. Interestingly, DR1, which can bind RAR•RXR and RXR•RXR dimers, also competes. These results indicate that the βRARE could be occupied by a different set of retinoid receptors in untreated cells (Complex I) than in RA-treated cells (Complex II). In agreement with this, we find that addition of 9-cis-RA and RA slightly enhances the mobility of Complex I and II, respectively, without significantly affecting the binding efficiency (not shown). These possibilities are explored in the next section.Figure 2:Two different protein complexes bind specifically, but with different kinetics, to the βRARE. Nuclear extracts were prepared from cells treated with 10−5M RA for the time points indicated above the gel and analyzed by EMSA, using the βRARE as probe. Cold competitor DNA, as indicated below the gel, was added in 50-fold excess (see text). Arrows indicate the presence of Complexes I and II. P, probe alone.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To establish the identity of complexes I and II, we made use of a battery of RAR- and RXR-specific antibodies. When used in the EMSA with in vitro translated receptors, these antibodies can “supershift” retarded complexes if the epitope is accessible and specifically change their mobility in the gel to a position with lower mobility (data not shown). For simplicity, we focused our attention on the 0 and 48 h time points, inasmuch as they each contain just one complex (either I or II, respectively). For a fair comparison of the proteins in Complexes I and II in this experiment, we used 3 εg of the 0 h time point and 1.5 εg of the 48 h time point nuclear extract, respectively, because these amounts give equal levels of shifted probe in both complexes. First, we used two different RAR antibodies: RARc, which cross-reacts with the three major RAR isoforms, and a RARβ-specific antibody (RARβ). The results are shown in Fig. 3A. Contrary to our expectations, none of the RAR antibodies affected the mobility of Complex I in the untreated extract, indicating that they either do not contain RARs or that the epitope is inaccessible. In contrast, both RAR antibodies completely supershifted Complex II at the 48 h timepoint, whereas preimmune serum and a nonrelevant antibody had no effect. This shows that Complex II contains at least RARβ. Next, we used a battery of RXR antibodies, consisting of two different RXRα antibodies (designated H and N, that recognize epitopes in the hinge region, or in the N terminus, respectively), as well as RXRβ and RXRγ antibodies (all raised against N-terminal epitopes). Fig. 3B shows the following results. Complex I can be partially supershifted by both RXRα antibodies and slightly less well by the RXRβ antibody. Addition of more antibodies did not increase the amount of shifted probe (data not shown). However, the combination of both RXRα (type H) and RXRβ antibodies quantitatively supershifts the entire complex, whereas no shift is observed with two different preimmune sera or the RXRγ antibody. (Note that all our non-IgG-purified antisera give rise to a nonspecific, serum-dependent shifted band that migrates with a lower mobility than the antibody-specific supershifted complex. It is nonspecific because nonrelated antisera give the same result, they cannot be competed with the immunizing peptide, and there is no concomitant reduction in the intensity of the complexes of interest.) This suggests that Complex I consists of, at least, RXRα and RXRβ. Fig. 3C shows that Complex II, on the other hand, can only be partially supershifted with the hinge region-epitope RXRα antibody (RXRα H) but not at all by the RXRα antibody raised against the N-terminal epitope (RXRα N). Neither one of the other RXR antibodies, or preimmune sera, affected the mobility of the complex. This not only suggests that Complex II contains RXRα, but also that the N-terminal epitope of RXRα is now inaccessible, unlike the epitope in Complex I. Again, addition of more antisera did not change the amount of retarded probe, suggesting that these effects are not due to limiting amounts of antibodies (not shown), but may be due to different intra-dimer protein-protein interactions between the RXR dimers and the RXR•RAR heterodimers. However, we cannot exclude the possibility that there are also other unknown nuclear protein(s) present in both complexes, although antibodies against thyroid hormone receptors α and β, chick ovalbumin upstream activator transcription factor, estrogen receptor, glucocorticoid receptor, and even a monoclonal antibody against RARα did not affect the mobility of either complex (data not shown). However, there is no support in the literature for higher order RXR•RAR complexes on the βRARE. It is also possible that the receptors could undergo posttranslational modification(s) upon treatment with RA, which could cause epitope masking, or as yet uncharacterized isoforms could be induced, but again, we unaware of any studies giving credence to these hypotheses. Together, these data indicate that, with respect to retinoid receptors, Complex I consists mainly, if not completely, of RXRα and RXRβ, whereas Complex II at least contains RXRα•RARβ heterodimers. Our data may also explain the disappearance of Complex I because the RXRs in that complex may be recruited into a heterodimer complex with the induced RARβ in Complex II, which should bind with higher affinity. At the 48 h time point, there may be enough RARβ protein produced that all RXRs are titrated, such that Complex II completely replaces Complex I. This interpretation is further strengthened by the results of the Western blot shown in Fig. 4. Proteins from 10 εg of nuclear extract of cells treated with RA for a period for up to 48 h were separated by SDS-polyacrylamide gel electrophoresis, blotted onto nitrocellulose membrane, and probed with a RARβ antiserum. A specific band, migrating at about the expected mobility for RARβ, is induced between 8 and 24 h of treatment. The kinetics of appearance of the RARβ protein, therefore, match the observed DNA-binding activity by RARβ in Complex II in the EMSA. Interestingly, as shown before, the mRNA for RARβ can already be detected within 2 h of treatment. Thus, according to our detection methods, translation of RARβ mRNA lags at least 6 h behind transcription of the gene. The βRARE is an element with dyad symmetry, and RARs•RXRs are known to bind as (homo/hetero)dimers. Our results suggest that RXRα•RXRα and RXRβ•RXRβ homodimers, perhaps in combination with RXRα•RXRβ heterodimers, are the receptors that occupy the βRARE in untreated cells. This is surprising, since this element is only very weakly bound by RXRs in vitro(21Leid M. Kastner P. Lyons R. Nakshatri H. Saunders M. Zacharewski T. Chen J.-Y. Staub A. Garnier J.-M. Mader S. Chambon P. Cell. 1992; 68: 377-395Abstract Full Text PDF PubMed Scopus (1023) Google Scholar, 27Mangelsdorf D.J. Umesono K. Kliewer S.A. Borgmeyer U. Ong E.S. Evans R.M. Cell. 1991; 66: 555-561Abstract Full Text PDF PubMed Scopus (525) Google Scholar, 28Zhang X.-K. Lehmann J. Hoffmann B. Dawson M.I. Cameron J. Graupner G. Hermann T. Tran P. Pfahl M. Nature. 1992; 358: 587-591Crossref PubMed Scopus (521) Google Scholar, 42Mader S. Leroy P. Chen J.-Y. Chambon P. J. Biol. Chem. 1993; 268: 591-600Abstract Full Text PDF PubMed Google Scholar, 43Schrader M. Wyss A. Sturzenbecker L.J. Grippo J.F. LeMotte P. Carlberg C. Nucleic Acids Res. 1993; 21: 1231-1237Crossref PubMed Scopus (49) Google Scholar), in contrast to RAR•RXR heterodimers(17Yu V.C. Delsert C. Andersen B. Holloway J.M. Devary O.V. Naar A.M. Kim S.Y. Boutin J.-M. Glass C.K. Rosenfeld M.G. Cell. 1991; 67: 1251-1266Abstract Full Text PDF PubMed Scopus (10" @default.
• W2073836693 created "2016-06-24" @default.
• W2073836693 creator A5010885224 @default.
• W2073836693 creator A5020615740 @default.
• W2073836693 creator A5022380523 @default.
• W2073836693 creator A5056779739 @default.
• W2073836693 date "1995-07-01" @default.
• W2073836693 modified "2023-10-17" @default.
• W2073836693 title "Evidence that Retinoid X Receptors Mediate Retinoid-dependent Transcriptional Activation of the Retinoic Acid Receptor β Gene in S91 Melanoma Cells" @default.
• W2073836693 cites W1487719143 @default.
• W2073836693 cites W1493100105 @default.
• W2073836693 cites W1542669094 @default.
• W2073836693 cites W1554640292 @default.
• W2073836693 cites W1578055894 @default.
• W2073836693 cites W1595664534 @default.
• W2073836693 cites W1607714362 @default.
• W2073836693 cites W1814235153 @default.
• W2073836693 cites W1868208269 @default.
• W2073836693 cites W1896511711 @default.
• W2073836693 cites W1909555660 @default.
• W2073836693 cites W1973209839 @default.
• W2073836693 cites W1981305073 @default.
• W2073836693 cites W1983134152 @default.
• W2073836693 cites W1984509210 @default.
• W2073836693 cites W1987040411 @default.
• W2073836693 cites W1987269203 @default.
• W2073836693 cites W1987779399 @default.
• W2073836693 cites W1995931656 @default.
• W2073836693 cites W2002529271 @default.
• W2073836693 cites W2007084552 @default.
• W2073836693 cites W2011467252 @default.
• W2073836693 cites W2012761399 @default.
• W2073836693 cites W2014035689 @default.
• W2073836693 cites W2017719948 @default.
• W2073836693 cites W2023593713 @default.
• W2073836693 cites W2032096382 @default.
• W2073836693 cites W2041270901 @default.
• W2073836693 cites W2045894871 @default.
• W2073836693 cites W2051663421 @default.
• W2073836693 cites W2053131171 @default.
• W2073836693 cites W2060275385 @default.
• W2073836693 cites W2060333964 @default.
• W2073836693 cites W2060903877 @default.
• W2073836693 cites W2074786828 @default.
• W2073836693 cites W2075232957 @default.
• W2073836693 cites W2085124463 @default.
• W2073836693 cites W2090416569 @default.
• W2073836693 cites W2102082802 @default.
• W2073836693 cites W2105268520 @default.
• W2073836693 cites W2112823160 @default.
• W2073836693 cites W2115494923 @default.
• W2073836693 cites W2120176836 @default.
• W2073836693 cites W2135176879 @default.
• W2073836693 cites W2138434278 @default.
• W2073836693 cites W2145087519 @default.
• W2073836693 cites W2148719100 @default.
• W2073836693 cites W2291668409 @default.
• W2073836693 doi "https://doi.org/10.1074/jbc.270.29.17429" @default.
• W2073836693 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/7615548" @default.
• W2073836693 hasPublicationYear "1995" @default.
• W2073836693 type Work @default.
• W2073836693 sameAs 2073836693 @default.
• W2073836693 citedByCount "16" @default.
• W2073836693 countsByYear W20738366932013 @default.
• W2073836693 crossrefType "journal-article" @default.
• W2073836693 hasAuthorship W2073836693A5010885224 @default.
• W2073836693 hasAuthorship W2073836693A5020615740 @default.
• W2073836693 hasAuthorship W2073836693A5022380523 @default.
• W2073836693 hasAuthorship W2073836693A5056779739 @default.
• W2073836693 hasBestOaLocation W20738366931 @default.
• W2073836693 hasConcept C104317684 @default.
• W2073836693 hasConcept C119775778 @default.
• W2073836693 hasConcept C120197328 @default.
• W2073836693 hasConcept C128821507 @default.
• W2073836693 hasConcept C162253465 @default.
• W2073836693 hasConcept C170493617 @default.
• W2073836693 hasConcept C185592680 @default.
• W2073836693 hasConcept C2775954498 @default.
• W2073836693 hasConcept C2777658100 @default.
• W2073836693 hasConcept C2781121885 @default.
• W2073836693 hasConcept C502942594 @default.
• W2073836693 hasConcept C55493867 @default.
• W2073836693 hasConcept C63932345 @default.
• W2073836693 hasConcept C68484354 @default.
• W2073836693 hasConcept C758759 @default.
• W2073836693 hasConcept C86339819 @default.
• W2073836693 hasConcept C86803240 @default.
• W2073836693 hasConcept C89364313 @default.
• W2073836693 hasConcept C95444343 @default.
• W2073836693 hasConceptScore W2073836693C104317684 @default.
• W2073836693 hasConceptScore W2073836693C119775778 @default.
• W2073836693 hasConceptScore W2073836693C120197328 @default.
• W2073836693 hasConceptScore W2073836693C128821507 @default.
• W2073836693 hasConceptScore W2073836693C162253465 @default.
• W2073836693 hasConceptScore W2073836693C170493617 @default.
• W2073836693 hasConceptScore W2073836693C185592680 @default.
• W2073836693 hasConceptScore W2073836693C2775954498 @default.
• W2073836693 hasConceptScore W2073836693C2777658100 @default.

• next