FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2074840148> ?p ?o ?g. }

• W2074840148 endingPage "16968" @default.
• W2074840148 startingPage "16959" @default.
• W2074840148 abstract "Prostaglandin E2 (PGE2), a major product of cyclooxygenase, exerts its functions by binding to four G protein-coupled receptors (EP1–4) and has been implicated in modulating angiogenesis. The present study examined the role of the EP4 receptor in regulating endothelial cell proliferation, migration, and tubulogenesis. Primary pulmonary microvascular endothelial cells were isolated from EP4flox/flox mice and were rendered null for the EP4 receptor with adenoCre virus. Whereas treatment with PGE2 or the EP4 selective agonists PGE1-OH and ONO-AE1–329 induced migration, tubulogenesis, ERK activation and cAMP production in control adenovirus-transduced endothelial EP4flox/flox cells, no effects were seen in adenoCre-transduced EP4flox/flox cells. The EP4 agonist-induced endothelial cell migration was inhibited by ERK, but not PKA inhibitors, defining a functional link between PGE2-induced endothelial cell migration and EP4-mediated ERK signaling. Finally, PGE2, as well as PGE1-OH and ONO-AE1–329, also promoted angiogenesis in an in vivo sponge assay providing evidence that the EP4 receptor mediates de novo vascularization in vivo. Prostaglandin E2 (PGE2), a major product of cyclooxygenase, exerts its functions by binding to four G protein-coupled receptors (EP1–4) and has been implicated in modulating angiogenesis. The present study examined the role of the EP4 receptor in regulating endothelial cell proliferation, migration, and tubulogenesis. Primary pulmonary microvascular endothelial cells were isolated from EP4flox/flox mice and were rendered null for the EP4 receptor with adenoCre virus. Whereas treatment with PGE2 or the EP4 selective agonists PGE1-OH and ONO-AE1–329 induced migration, tubulogenesis, ERK activation and cAMP production in control adenovirus-transduced endothelial EP4flox/flox cells, no effects were seen in adenoCre-transduced EP4flox/flox cells. The EP4 agonist-induced endothelial cell migration was inhibited by ERK, but not PKA inhibitors, defining a functional link between PGE2-induced endothelial cell migration and EP4-mediated ERK signaling. Finally, PGE2, as well as PGE1-OH and ONO-AE1–329, also promoted angiogenesis in an in vivo sponge assay providing evidence that the EP4 receptor mediates de novo vascularization in vivo. Angiogenesis, the process of new blood vessel formation from pre-existing vessels, is a multistep event that requires endothelial cell proliferation, migration, and tube formation. Angiogenesis is controlled by diverse factors, including cytokines, growth factors, as well as cyclooxygenase-2-derived eicosanoids (1Gately S. Cancer Metastasis Rev. 2000; 19: 19-27Crossref PubMed Scopus (340) Google Scholar, 2Gately S. Li W.W. Semin. Oncol. 2004; 31: 2-11Crossref PubMed Google Scholar). The pro-angiogenic effects of cyclooxygenase-2 are mediated primarily by three products of arachidonic acid metabolism: thromboxane A2, prostaglandin E2 (PGE2), 2The abbreviations used are: PG, prostaglandin; EP, E-prostanoid receptor; MAPK, mitogen-activated protein kinase; PKA, cAMP-dependent protein kinase; PI3K, phosphatidylinositol 3-kinase; PBS, phosphate-buffered saline; RT, reverse transcription; FCS, fetal calf serum; ERK, extracellular signal-regulated kinase; MAPK, mitogen-activated protein kinase. 2The abbreviations used are: PG, prostaglandin; EP, E-prostanoid receptor; MAPK, mitogen-activated protein kinase; PKA, cAMP-dependent protein kinase; PI3K, phosphatidylinositol 3-kinase; PBS, phosphate-buffered saline; RT, reverse transcription; FCS, fetal calf serum; ERK, extracellular signal-regulated kinase; MAPK, mitogen-activated protein kinase. and prostaglandin I2. These pro-angiogenic eicosanoids directly stimulate the synthesis of angiogenic factors, promote vascular sprouting, migration, tube formation, as well as enhance endothelial cell survival (1Gately S. Cancer Metastasis Rev. 2000; 19: 19-27Crossref PubMed Scopus (340) Google Scholar, 2Gately S. Li W.W. Semin. Oncol. 2004; 31: 2-11Crossref PubMed Google Scholar). PGE2 exerts its cellular effects by binding to four distinct E-prostanoid receptors (EP1–4) that belong to the family of seven transmembrane G protein-coupled rhodopsin-type receptors (3Breyer R.M. Bagdassarian C.K. Myers S.A. Breyer M.D. Annu. Rev. Pharmacol. Toxicol. 2001; 41: 661-690Crossref PubMed Scopus (847) Google Scholar). Even though there is similar signaling mechanisms among these receptors, it is clear that each receptor has different and often opposing biological effects (4Regan J.W. Life Sci. 2003; 74: 143-153Crossref PubMed Scopus (374) Google Scholar). For example, although the EP2 and EP4 receptors are both Gs coupled receptors and up-regulate intracellular cAMP levels, they mediate differential phosphorylation of cAMP response element-binding proteins (5Fujino H. Salvi S. Regan J.W. Mol. Pharmacol. 2005; 68: 251-259Crossref PubMed Scopus (136) Google Scholar). In addition, following activation, these two receptors exert different downstream effects on important intracellular mediators, including the PI3K and ERK pathways (6Fujino H. Xu W. Regan J.W. J. Biol. Chem. 2003; 278: 12151-12156Abstract Full Text Full Text PDF PubMed Scopus (260) Google Scholar, 7Pozzi A. Yan X. Macias-Perez I. Wei S. Hata A.N. Breyer R.M. Morrow J.D. Capdevila J.H. J. Biol. Chem. 2004; 279: 29797-29804Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar). Moreover, the EP3 receptor usually counteracts EP2- and EP4-mediated up-regulation of cAMP by preferentially coupling to Gi proteins (3Breyer R.M. Bagdassarian C.K. Myers S.A. Breyer M.D. Annu. Rev. Pharmacol. Toxicol. 2001; 41: 661-690Crossref PubMed Scopus (847) Google Scholar). Some information regarding the role of PGE2 in angiogenesis has been obtained using cancer models in mice where the receptors have been deleted by homologous recombination. In this context, mice lacking the EP2 receptor produce significantly fewer and less vascularized tumors than wild type mice in a two-stage skin carcinogenesis protocol (8Sung Y.M. He G. Fischer S.M. Cancer Res. 2005; 65: 9304-9311Crossref PubMed Scopus (94) Google Scholar), and the EP2 receptor was demonstrated to directly contribute to endothelial cell migration and survival (9Kamiyama M. Pozzi A. Yang L. Debusk L.M. Breyer R.M. Lin P.C. Oncogene. 2006; 25: 7019-7028Crossref PubMed Scopus (102) Google Scholar). Similarly, EP3-null mice exhibit decreased tumor growth and tumor-associated angiogenesis compared with wild type mice following injection of sarcoma or lung carcinoma cells (10Amano H. Hayashi I. Endo H. Kitasato H. Yamashina S. Maruyama T. Kobayashi M. Satoh K. Narita M. Sugimoto Y. Murata T. Yoshimura H. Narumiya S. Majima M. J. Exp. Med. 2003; 197: 221-232Crossref PubMed Scopus (278) Google Scholar). In contrast, the EP1 receptor does not appear to play a role in tumor-associated angiogenesis (11Axelsson H. Lonnroth C. Wang W. Svanberg E. Lundholm K. Angiogenesis. 2005; 8: 339-348Crossref PubMed Scopus (17) Google Scholar) and, with the exception of one in vivo study (12Kuwano T. Nakao S. Yamamoto H. Tsuneyoshi M. Yamamoto T. Kuwano M. Ono M. FASEB J. 2004; 18: 300-310Crossref PubMed Scopus (242) Google Scholar), there is scant information on the direct role of EP4 receptor in angiogenesis and endothelial cell function. To characterize the contribution of the EP4 receptor in endothelial cell biology, we have undertaken studies utilizing primary pulmonary microvascular endothelial cells isolated from EP4flox/flox mice (13Schneider A. Guan Y. Zhang Y. Magnuson M.A. Pettepher C. Loftin C.D. Langenbach R. Breyer R.M. Breyer M.D. Genesis. 2004; 40: 7-14Crossref PubMed Scopus (73) Google Scholar), which were rendered null for the EP4 receptor by in vitro treatment with adenoCre virus. The present study provides evidence that 1) primary endothelial cells express the EP4 receptor; 2) this receptor directly controls endothelial cell migration and tubulogenesis but not proliferation in vitro; 3) activation of ERK is necessary to promote the EP4-mediated endothelial cell migration; and 4) activation of the EP4 receptor by selective agonists promotes angiogenesis in vivo. Thus, the EP4 receptor not only plays a direct role in endothelial cell functions in vitro, but it also mediates angiogenesis in vivo. Generation of EP4-null Endothelial Cells—Primary murine endothelial cells were isolated from EP4flox/flox mice (13Schneider A. Guan Y. Zhang Y. Magnuson M.A. Pettepher C. Loftin C.D. Langenbach R. Breyer R.M. Breyer M.D. Genesis. 2004; 40: 7-14Crossref PubMed Scopus (73) Google Scholar) as described previously (14Pozzi A. Moberg P.E. Miles L.A. Wagner S. Soloway P. Gardner H.A. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 2202-2207Crossref PubMed Scopus (346) Google Scholar). Briefly, the lung vasculature was perfused with PBS, 2.5 mm EDTA followed by 0.25% trypsin, 2.5 mm EDTA via the right ventricle. Lungs were removed and incubated at 37 °C for 20 min. The visceral pleura was subsequently trimmed and the perfusion was repeated. Primary endothelial cells were recovered and grown on tissue culture plastic in EGM-2-MV containing 5% FCS (Clonetics). Cells at passages 2–4 were used for experiments. For the generation of EP4-null endothelial cells, EP4flox/flox cells were seeded in 6-well plates (105 cells/well) and incubated with 0.5 ml serum-free medium containing 1 × 1012 multiplicity of infection AdenoCre (AdCre) or β-galactosidase (β-AdGal) adenovirus. After 8 h, 1.5 ml of complete medium was added to the wells. After 3 days the cells were transduced again with AdCre or β-AdGal adenovirus as indicated above with a total of three independent treatments. This procedure led to a ∼80–90% reduction of EP4 mRNA and protein expression in AdCre-treated cells (see Fig. 2 for details). RT- and Real-time RT-PCR—RNA was isolated from EP4flox/flox endothelial cells transduced with β-AdGal or AdCre as indicated above using TRIzol reagents. RNA samples were reverse-transcribed using a SuperScript II™ kit and oligo(dT) (12–18 bp) and 100 ng of first strand cDNA was used for real-time PCR. EP4 and 18 S primers as well as fluorescent probes were purchased from Applied Biosystems (Foster City, CA; 18 S catalogue number 4319413E and EP4 catalogue number Mm00436053_m1). The EP4 and 18S probes were labeled at the 5′-end with the reporter fluorophores FAM and VIC respectively and at the 3′-end with a non-fluorescent quencher. Quantitative PCR was performed in a real-time format on the 7700 ABI Prism Sequence Detector (Applied Biosystems). The cycling conditions were as follows: 2 min at 50 °C followed by 40 cycles at 95 °C for 15 s (denaturation step) and 58 °C for 60 s (annealing and extention). Data were analyzed using the comparative Ct method, as described in Applied Biosystems User Bulletin and detailed by Livak and Schmittgen (15Livak K.J. Schmittgen T.D. Methods. 2001; 25: 402-408Crossref PubMed Scopus (116613) Google Scholar). Data were analyzed with Student's t test, and a level of p < 0.05 was considered statistically significant. For the RT-PCR assay, 100 ng of total RNA and utilized to amplify EP1, EP2, EP3, EP4, and β-actin fragments using Supermix PCR kit (Invitrogen). PCR conditions are as follows: 94 °C 30 min (1 cycle); 94 °C 30 min, 58 °C 40 min, 72 °C 40 min (35 cycles); 72 °C, 7 min, 4 °C. The primers used were as previously described (7Pozzi A. Yan X. Macias-Perez I. Wei S. Hata A.N. Breyer R.M. Morrow J.D. Capdevila J.H. J. Biol. Chem. 2004; 279: 29797-29804Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar): EP1, CACCCAGGCTCCCCAATACATCTG (sense) and GGAGGGTGGCTGTGGCTGAAG (antisense); EP2, CCGGGGTTCTGGGGAATC (sense) and GTGCATGCGAATGAGGTTGAG (antisense); EP3, CGCCGTCTCGGCAGTC (sense) and TGTGTCGTCTTGCCCCCG (antisense); EP4, TCTCTGGTGGTGCTCATCTG (sense) and CTGCTGATCTCCTTTAACTCCC (antisense); β-actin, TCCTGTGGCATCCACGAAACT (sense) and GAAGCATTTGCGGTGGACGAT (antisense). Proliferation Assay—EP4flox/flox endothelial cells, transduced with β-AdGal or AdCre as described above, were plated in complete medium onto 96-well plates (104 cells/well). After 12 h the cells were incubated with serum-free medium for further 24 h and subsequently incubated with serum free medium containing [3H]thymidine (10 μCi/ml) with or without 1 μm PGE2, PGE1-OH, Butaprost, 17-phenyl-ω-trinor-PGE2 (Cayman Chemicals, Ann Arbor, MI), ONO-AE1–329 (from Dr. T. Maruyama, ONO Pharmaceuticals, Osaka, Japan), MB-28767 (Rhone-Poulanc Rorer). Twenty-four hours later, the cells were collected and the amount of incorporated [3H]thymidine analyzed as described previously (14Pozzi A. Moberg P.E. Miles L.A. Wagner S. Soloway P. Gardner H.A. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 2202-2207Crossref PubMed Scopus (346) Google Scholar). Four independent experiments with quadruplicate samples were performed. Migration Assay—Cell migration was assayed using transwell plates fitted with 8-μm membrane filters (Corning Ware). Lower wells were incubated with matrigel (5 μg/ml) at 4 °C for 12 h and then incubated at 37 °C for 1 h with 1% bovine serum albumin in PBS to inhibit nonspecific cell migration. Serumfree medium with or without PGE2, PGE1-OH, ONO-AE1–329, MB-28767, Butaprost, 17-phenyl-ω-trinor-PGE2 (1 or 10 μm each), or 10% FCS was then added to the lower wells, while β-AdGal- or AdCre-treated endothelial cells (5 × 104 cells in 300 μl of serum-free medium) were added to the upper wells. To determine the contribution of ERK, PKA, or PI3K to prostanoid-induced migration, serum-starved endothelial cells (to minimize ERK and Akt activation, as well as cAMP production) were allowed to migrate as indicated above in the presence or absence of the ERK inhibitor PD98059 (Sigma, 10 μm), the PKA inhibitor H89 (Calbiochem, 10 μm), or the PI3K inhibitor LY294002 (Calbiochem, 5 μm). After 6 h at 37°C, cells on the top of the filter were removed by wiping, and the filters were then fixed in 4% formaldehyde in PBS. Migrating cells were stained with 1% crystal violet, and five randomly chosen fields from duplicate wells were counted at 400× magnification. Three independent experiments were performed in duplicate. Matrigel-based Capillary Formation Assay—Capillary-like formation was analyzed as described (16Pozzi A. Macias-Perez I. Abair T. Wei S. Su Y. Zent R. Falck J.R. Capdevila J.H. J. Biol. Chem. 2005; 280: 27138-27146Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar). Briefly, 96-well plates were coated with 50 μl of Matrigel and incubated 30 min at 37 °C. Serum-starved β-AdGal- or AdCre-treated endothelial cells (1 × 104) were plated on solidified Matrigel in 200 μl of serum-free medium with or without PGE2, PGE1-OH, ONO-AE1–329, MB-28767, Butaprost (1 or 10 μm each), or 10% FCS. Capillary-like structures were recorded (three images per gel per treatment) hourly for a period of 10 h and representative images taken 6 h after plating are shown. To quantify capillary-like network formation, cellular nodes were defined as junctions linking at least three cells, and they were counted from digital images. Three independent experiments were performed in duplicate with a total of 18 images analyzed per treatment. Measurement of cAMP—EP4flox/flox endothelial cells untreated or transduced with AdCre were plated in complete medium onto 96-well plates (5 × 103 cells/well) for 24 h after which the cells were incubated in serum-free medium containing the phosphodiesterase inhibitor isobutylmethylxanthine (250 μm). After 12 h the cells were incubated in PBS containing 250 μm isobutylmethylxanthine with or without PGE2, PGE1-OH, ONO-AE1–329, MB-28767, Butaprost (1 μm each), or forskolin (10 μm, positive control). After 30 min the intracellular levels of cAMP were determined via commercial enzyme-linked immunosorbent assay assays (Discoverx) and expressed in nmol/liter. Three independent experiments were performed in triplicate. Untreated EP4flox/flox cells were used for the experiment instead of β-AdGal-transduced EP4flox/flox cells as this enzyme-linked immunosorbent assay kit is based on a β-galactosidase-dependent assay. Western Blot Analysis—To determine the expression of EP4 protein, membrane fractions were isolated from β-AdGal- and AdCre-treated endothelial cells as follows. Cells were lysed in lysis buffer (15 mm HEPES, pH 7.6, 5 mm EDTA, 5 mm EGTA, and 2 mm phenylmethylsulfonyl fluoride) and passaged through a 21-gauge needle. The cell lysates were subsequently layered on a 60% sucrose cushion and centrifuged at 150,000 × g for 1 h at 4°C. The enriched membrane fraction at the top of the sucrose cushion was collected and passed through a 26-gauge needle. Equal amount of membranes were resolved by SDS-PAGE (10% gels, 50 μg membrane/lane) and transferred to Immobilon-P membranes (Millipore). Membranes were incubated with a rabbit anti-human EP4 (C-terminal amino acids 459–488, Cayman) able to cross-react with mouse EP4 (17Yang L. Huang Y. Porta R. Yanagisawa K. Gonzalez A. Segi E. Johnson D.H. Narumiya S. Carbone D.P. Cancer Res. 2006; 66: 9665-9672Crossref PubMed Scopus (92) Google Scholar) and anti-N-cadherin antibody (1:1,000; Santa Cruz Biotechnology) to verify the purity and equal loading of the subcellular fractionation products. To evaluate the effects of prostanoids on ERK, p38, and Akt phosphorylation semiconfluent β-AdGal- and AdCre-treated endothelial cells were serumstarved for 24 h and then treated with the PGE2, PGE1-OH, ONO-AE1–329, MB-28767, Butaprost (1 μm or 10 μm each), or 10% FCS for 0 and 15 min. The cells were washed with PBS and lysed in 50 mm HEPES, pH 7.5, 150 mm NaCl, 1% Triton X-100 and centrifuged for 10 min at 14,000 rpm. Cell lysates were resolved by SDS-PAGE (10% gels; 30 μg of total protein/lane) and transferred to Immobilon-P membranes. Membranes were incubated with a rabbit anti-phospho-ERK, anti-phospho-p38, or anti-phospho-Akt antibody (all from Cell Signaling Technology) followed by the appropriate horseradish peroxidase-conjugated secondary antibodies. Immunoreactive proteins were visualized using an ECL kit (Pierce). Total ERK, p38, and Akt content were verified by stripping the membranes in 50 mm Tris-HCl, pH 6.5, containing 2% SDS and 0.4% β-mercaptoethanol for 1 h at 55°C and re-probing with a rabbit anti-Akt antibody (Cell Signaling Technology). In Vivo Angiogenesis—The subcutaneous sponge model was used to determine the effects of prostanoids on in vivo angiogenesis (16Pozzi A. Macias-Perez I. Abair T. Wei S. Su Y. Zent R. Falck J.R. Capdevila J.H. J. Biol. Chem. 2005; 280: 27138-27146Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar). Sterile polyvinyl acetal CF-50 round sponges (8 × 3 mm, a gift from Dr. J. M. Davidson, Vanderbilt University) were implanted under the dorsal skin of C57 Black6 female mice (6 weeks of age, 20 g of body weight, n = 4/treatment). The sponges were then injected every second day for 14 days with 50 μl of either vehicle (corn oil) or PGE2, PGE1-OH, ONO-AE1–329, MB-28767, Butaprost, or 17-phenyl-ω-trinor-PGE2 (10 μm). Ten minutes before sacrifice, mice were injected intravenously with 50 μl of rhodamine-dextran (Mr 65, 2% in PBS, Sigma) to label blood vessels (16Pozzi A. Macias-Perez I. Abair T. Wei S. Su Y. Zent R. Falck J.R. Capdevila J.H. J. Biol. Chem. 2005; 280: 27138-27146Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar), and the sponges were subsequently collected and analyzed under an epifluorescence microscope. Rhodamine-dextran-positive structures were imaged, the color images converted to black and white pictures using Photoshop (Adobe) and processed as described (16Pozzi A. Macias-Perez I. Abair T. Wei S. Su Y. Zent R. Falck J.R. Capdevila J.H. J. Biol. Chem. 2005; 280: 27138-27146Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar). Vascularity within sponges was expressed as a percentage of area occupied by rhodamine-dextran-positive structures per microscopic field. Three images/sponge with a total of 12 images per treatment were used for analysis. Statistical Analysis—The Student's t test was used for comparisons between two groups, and analysis of variance using Sigma-Stat software was used for statistical differences between multiple groups. p < 0.05 was considered statistically significant. The EP4 Receptor Is Pro-angiogenic in Vivo—To test the contribution of the EP receptors to in vivo angiogenesis, we utilized a subcutaneous sponge model (16Pozzi A. Macias-Perez I. Abair T. Wei S. Su Y. Zent R. Falck J.R. Capdevila J.H. J. Biol. Chem. 2005; 280: 27138-27146Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar). Inert sponges, implanted subcutaneously in the back of adult mice, were injected every other day with either vehicle (oil), PGE2, the selective EP4 agonists PGE1-OH and ONO-AE1–329; the EP3-selective agonist MB-28767; the EP2 agonist Butaprost; or the EP1 agonist 17-phenyl-ω-trinor-PGE2 (10 μm each). After 14 days, the sponges were isolated and vascular density determined by direct observation and analysis of vessel-associated rhodaminedextran fluorescence. With the exception of MB-28767 and 17-phenyl-ω-trinor-PGE2, all the prostanoids tested were able to induce in vivo angiogenesis (Fig. 1, A–C). Significantly greater vascularization was observed in sponges injected with either PGE2 or the EP4 active agonists PGE1-OH or ONO-AE1–329 compared with sponges injected with the EP2 agonist Butaprost (Fig. 1, A–C). These results indicate that although both EP2 and EP4 receptors are able to promote de novo blood vessel formation, EP4 is the most potent pro-angiogenic receptor (Fig. 1, A–C). Primary Murine Endothelial Cells Express the EP4 Receptor, Which Promotes Cell Migration but Not Proliferation—To determine whether the in vivo EP4 agonist-induced angiogenesis was due to a direct effect of these ligands on endothelial cell function, we analyzed which EP receptors are expressed in cultured endothelial cells by performing RT-PCR analysis on primary EP4flox/flox endothelial cells transduced with control β-AdGal. As shown in Fig. 2A, β-AdGal-transduced endothelial cells expressed mRNA for EP1, EP2 and EP4 subtypes, while EP3 mRNA was not detected. As the pro-angiogenic receptor EP4 is expressed on endothelial cells, we determined its role in mediating endothelial cell proliferation, migration and tubulogenesis by comparing endothelial cells derived from EP4flox/flox mice transduced with either β-AdGal or AdCre virus. As shown in Fig. 2A, we first demonstrated that the levels of EP4 mRNA, but not EP1 or EP2 were significantly decreased in AdCre-transduced endothelial cells. Real-time PCR confirmed that the levels of EP4 mRNA in β-AdGal-treated endothelial cells were ∼10-fold higher than those detected in AdCre-treated cells (Fig. 2B). Decreased expression of the EP4 receptor in AdCre-treated endothelial cells was also confirmed by Western blot analysis of membrane enriched fractions (Fig. 2C). Thus, endothelial cells express the EP4 receptor and treatment of EP4flox/flox endothelial cells with AdCre selectively down-regulates the expression of this receptor without affecting the levels of the other PGE2 binding receptors. As activation of the EP4 receptor promotes angiogenesis in vivo (Fig. 1) and this receptor controls cell growth and survival in different cell types (7Pozzi A. Yan X. Macias-Perez I. Wei S. Hata A.N. Breyer R.M. Morrow J.D. Capdevila J.H. J. Biol. Chem. 2004; 279: 29797-29804Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar, 18Aoudjit L. Potapov A. Takano T. Am. J. Physiol. 2006; 290: F1534-F1542Crossref PubMed Scopus (47) Google Scholar), we examined whether the EP4 receptor contributes to PGE2-mediated endothelial cell proliferation. For this reason, endothelial cells were treated with PGE2, PGE1-OH, ONO-AE1–329, Butaprost, MB-28767, or 17 phenyl-ω-trinor PGE2 (1 μm each). Unlike serum-treatment, none of the specific agonists induced cell proliferation in either β-AdGal- or AdCre-transduced endothelial cells (Fig. 3A). This result suggests that PGE2-induced activation of the EP receptors is not sufficient to promote endothelial cell proliferation. In contrast, PGE2, PGE1-OH and ONO-AE1–329 used at 1 μm significantly stimulated migration of β-AdGal-, but not AdCre-transduced endothelial cells, suggesting that low doses of PGE2 promotes endothelial cell migration via activation of the EP4 receptor (Fig. 3B). The EP3 agonist MB-28767 did not promote endothelial cell migration (Fig. 3B). Moreover, no significant differences in basal or serum-induced cell migration were observed between β-AdGal- and AdCre-treated cells (Fig. 3B). Interestingly, 17-phenyl-ω-trinor PGE2 used at both low (1 μm) and high (10 μm) doses did not promote endothelial cell migration (Fig. 3B), suggesting that, although endothelial cells express EP1 mRNA (Fig. 2A), this receptor does not play a direct role in endothelial cell migration. Finally, activation of the EP2 receptor with high (10 μm) but not low (1 μm) doses of Butaprost promoted migration of either β-AdGal- or AdCre-treated endothelial cells (Fig. 3B), confirming the data that high doses of EP2 ligands are able to promote endothelial cell migration (9Kamiyama M. Pozzi A. Yang L. Debusk L.M. Breyer R.M. Lin P.C. Oncogene. 2006; 25: 7019-7028Crossref PubMed Scopus (102) Google Scholar). We were unable to determine whether high doses of PGE2 (i.e. 10 μm) could lead to migration in both β-AdGal- and AdCre-treated cells, as this dose was cytotoxic for endothelial cells of both genotypes. The EP4 Receptor Promotes Capillary-like Structure Formation—The role of EP4 receptor activation in the formation of capillary-like structures was assessed by plating endothelial cells on solidified Matrigel in the absence of serum. Within 6 h, β-AdGal-treated cells formed capillary-like structures more efficiently than AdCre-treated cells at base line, suggesting that the EP4 receptor plays a role in endothelial branching (Fig. 4, A and B). PGE2, PGE1-OH, and ONO-AE1–329 (1 μm each) significantly increased the formation of capillary-like structures only in β-AdGal-transduced cells (Fig. 4, A and B), thus confirming that at low doses PGE2 seems to support tubulogenesis primarily via activation of the EP4 receptor. In contrast, no significant changes were observed with MB-28767 (used as negative control). Finally, whereas Butaprost at 1 μm failed to stimulate endothelial cell tubulogenesis, at 10 μm it stimulated capillary-like structure formation in both EP4 expressing and EP4 non-expressing endothelial cells (Fig. 4, A and B). These results indicate that although both EP2 and EP4 receptors can mediate capillary-like structure formation, engagement of EP2 receptor requires high doses of ligand. Activation of the EP4 Receptor Leads to Increased Intracellular cAMP Levels and ERK Activation—Activation of either EP2 and EP4 receptors, which are both expressed in primary endothelial cells (Fig. 2A), stimulates the production of intracellular cAMP in a cell specific manner (3Breyer R.M. Bagdassarian C.K. Myers S.A. Breyer M.D. Annu. Rev. Pharmacol. Toxicol. 2001; 41: 661-690Crossref PubMed Scopus (847) Google Scholar). Moreover, PGE2 promotes angiogenesis by increasing levels of cAMP in human endothelial cells (19Namkoong S. Lee S.J. Kim C.K. Kim Y.M. Chung H.T. Lee H. Han J.A. Ha K.S. Kwon Y.G. Kim Y.M. Exp. Mol. Med. 2005; 37: 588-600Crossref PubMed Scopus (99) Google Scholar), although the receptor that mediates these effects is unknown. For these reasons, we analyzed whether the EP2 and EP4 receptors can stimulate intracellular cAMP levels in microvascular endothelial cells and which of these two receptors exerts this function. As shown in Fig. 5A, treatment with PGE2 and the EP2 agonist Butaprost (both at 1 μm) increased intracellular levels of cAMP in both Ep4flox/flox and AdCre-transduced Ep4flox/flox endothelial cells. In contrast, treatment with the EP3 agonist MB-28767 (negative control) failed to stimulate cAMP production in either cell type. Conversely, treatment with the EP4 agonists PGE1-OH or ONO-AE1–329 stimulated cAMP production only in EP4flox/flox endothelial cells. Thus, this finding suggests that activation of EP2 and EP4 receptors by low doses of ligands induce cAMP production in endothelial cells. Based on observations that stimulation of the EP4 receptor leads to phosphorylation of ERK and Akt (6Fujino H. Xu W. Regan J.W. J. Biol. Chem. 2003; 278: 12151-12156Abstract Full Text Full Text PDF PubMed Scopus (260) Google Scholar, 7Pozzi A. Yan X. Macias-Perez I. Wei S. Hata A.N. Breyer R.M. Morrow J.D. Capdevila J.H. J. Biol. Chem. 2004; 279: 29797-29804Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar) and PGE2 promotes p38 MAPK activation (20Rosch S. Ramer R. Brune K. Hinz B. Biochem. Biophys. Res. Commun. 2005; 338: 1171-1178Crossref PubMed Scopus (38) Google Scholar), we determined the contribution of the EP4 receptor to the activation of these protein kinases in primary endothelial cells. Incubation of β-AdGal- and AdCre-transduced EP4flox/flox cells with PGE2, PGE1-OH, or ONO-AE1–329 (1 μm each) resulted in a marked increase in ERK phosphorylation, and to a lesser extent Akt and p38 MAPK activation, only in endothelial cells expressing the EP4 receptor (Fig. 5B). In contrast, treatment with 1 μm MB-28767 (negative control) or 1 μm Butaprost did not promote phosphorylation of these three kinases (Fig. 5B) in either β-AdGal- or AdCre-transduced cells. Interestingly, when used at 10 μm Butaprost stimulated ERK activation in both cell types (Fig. 5B), thus paralleling the finding that high doses of EP2 ligand can promote both migration (Fig. 3B) and capillary-like structure formation (Fig. 4). Thus, this data indicates that activation of EP4 receptor by low doses of ligand results in both cAMP production and ERK activation. In contrast, activation of EP2 b" @default.
• W2074840148 created "2016-06-24" @default.
• W2074840148 creator A5018965795 @default.
• W2074840148 creator A5029763432 @default.
• W2074840148 creator A5034584787 @default.
• W2074840148 creator A5048018294 @default.
• W2074840148 creator A5060851233 @default.
• W2074840148 creator A5071722069 @default.
• W2074840148 creator A5078723552 @default.
• W2074840148 creator A5080935506 @default.
• W2074840148 date "2007-06-01" @default.
• W2074840148 modified "2023-10-15" @default.
• W2074840148 title "Prostaglandin E2-EP4 Receptor Promotes Endothelial Cell Migration via ERK Activation and Angiogenesis in Vivo" @default.
• W2074840148 cites W1511649432 @default.
• W2074840148 cites W1966052610 @default.
• W2074840148 cites W1972168890 @default.
• W2074840148 cites W1975777695 @default.
• W2074840148 cites W1987484997 @default.
• W2074840148 cites W1987530541 @default.
• W2074840148 cites W1991453413 @default.
• W2074840148 cites W1993913999 @default.
• W2074840148 cites W1996839988 @default.
• W2074840148 cites W2004193154 @default.
• W2074840148 cites W2032197623 @default.
• W2074840148 cites W2036481695 @default.
• W2074840148 cites W2038963002 @default.
• W2074840148 cites W2040196938 @default.
• W2074840148 cites W2042333083 @default.
• W2074840148 cites W2048209624 @default.
• W2074840148 cites W2050658186 @default.
• W2074840148 cites W2053425043 @default.
• W2074840148 cites W2054281372 @default.
• W2074840148 cites W2055851568 @default.
• W2074840148 cites W2058034672 @default.
• W2074840148 cites W2075612906 @default.
• W2074840148 cites W2076219140 @default.
• W2074840148 cites W2078422697 @default.
• W2074840148 cites W2087753442 @default.
• W2074840148 cites W2099386452 @default.
• W2074840148 cites W2100201127 @default.
• W2074840148 cites W2107277218 @default.
• W2074840148 cites W2127611014 @default.
• W2074840148 cites W2129105000 @default.
• W2074840148 cites W2129746956 @default.
• W2074840148 cites W2133623974 @default.
• W2074840148 cites W2135166720 @default.
• W2074840148 cites W2137867018 @default.
• W2074840148 cites W2138231208 @default.
• W2074840148 cites W2148674446 @default.
• W2074840148 cites W2153992286 @default.
• W2074840148 cites W2168051211 @default.
• W2074840148 doi "https://doi.org/10.1074/jbc.m701214200" @default.
• W2074840148 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17401137" @default.
• W2074840148 hasPublicationYear "2007" @default.
• W2074840148 type Work @default.
• W2074840148 sameAs 2074840148 @default.
• W2074840148 citedByCount "124" @default.
• W2074840148 countsByYear W20748401482012 @default.
• W2074840148 countsByYear W20748401482013 @default.
• W2074840148 countsByYear W20748401482014 @default.
• W2074840148 countsByYear W20748401482015 @default.
• W2074840148 countsByYear W20748401482016 @default.
• W2074840148 countsByYear W20748401482017 @default.
• W2074840148 countsByYear W20748401482018 @default.
• W2074840148 countsByYear W20748401482019 @default.
• W2074840148 countsByYear W20748401482020 @default.
• W2074840148 countsByYear W20748401482021 @default.
• W2074840148 countsByYear W20748401482022 @default.
• W2074840148 countsByYear W20748401482023 @default.
• W2074840148 crossrefType "journal-article" @default.
• W2074840148 hasAuthorship W2074840148A5018965795 @default.
• W2074840148 hasAuthorship W2074840148A5029763432 @default.
• W2074840148 hasAuthorship W2074840148A5034584787 @default.
• W2074840148 hasAuthorship W2074840148A5048018294 @default.
• W2074840148 hasAuthorship W2074840148A5060851233 @default.
• W2074840148 hasAuthorship W2074840148A5071722069 @default.
• W2074840148 hasAuthorship W2074840148A5078723552 @default.
• W2074840148 hasAuthorship W2074840148A5080935506 @default.
• W2074840148 hasBestOaLocation W20748401481 @default.
• W2074840148 hasConcept C134018914 @default.
• W2074840148 hasConcept C150903083 @default.
• W2074840148 hasConcept C170493617 @default.
• W2074840148 hasConcept C178592051 @default.
• W2074840148 hasConcept C185592680 @default.
• W2074840148 hasConcept C207001950 @default.
• W2074840148 hasConcept C2777956040 @default.
• W2074840148 hasConcept C2778938600 @default.
• W2074840148 hasConcept C2780394083 @default.
• W2074840148 hasConcept C2780664492 @default.
• W2074840148 hasConcept C502942594 @default.
• W2074840148 hasConcept C55493867 @default.
• W2074840148 hasConcept C57074206 @default.
• W2074840148 hasConcept C62478195 @default.
• W2074840148 hasConcept C86803240 @default.
• W2074840148 hasConcept C95444343 @default.
• W2074840148 hasConceptScore W2074840148C134018914 @default.
• W2074840148 hasConceptScore W2074840148C150903083 @default.
• W2074840148 hasConceptScore W2074840148C170493617 @default.

• next