FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2076575552> ?p ?o ?g. }

• W2076575552 endingPage "31647" @default.
• W2076575552 startingPage "31641" @default.
• W2076575552 abstract "The disruption of the two thioredoxin genes inSaccharomyces cerevisiae leads to a complex phenotype, including the inability to use methionine sulfoxide as sulfur source, modified cell cycle parameters, reduced H2O2tolerance, and inability to use sulfate as sulfur source. Expression of one of the multiple Arabidopsis thaliana thioredoxins h in this mutant complements only some aspects of the phenotype, depending on the expressed thioredoxin: AtTRX2 or AtTRX3 induce methionine sulfoxide assimilation and restore a normal cell cycle. In addition AtTRX2 also confers growth on sulfate but no H2O2 tolerance. In contrast, AtTRX3 does not confer growth on sulfate but induces H2O2tolerance. We have constructed hybrid proteins between these two thioredoxins and show that all information necessary for sulfate assimilation is present in the C-terminal part of AtTRX2, whereas some information needed for H2O2 tolerance is located in the N-terminal part of AtTRX3. In addition, mutation of the atypical redox active site WCPPC to the classical site WCGPC restores some growth on sulfate. All these data suggest that the multipleArabidopsis thioredoxins h originate from a totipotent ancestor with all the determinants necessary for interaction with the different thioredoxin target proteins. After duplications each member evolved by losing or masking some of the determinants. The disruption of the two thioredoxin genes inSaccharomyces cerevisiae leads to a complex phenotype, including the inability to use methionine sulfoxide as sulfur source, modified cell cycle parameters, reduced H2O2tolerance, and inability to use sulfate as sulfur source. Expression of one of the multiple Arabidopsis thaliana thioredoxins h in this mutant complements only some aspects of the phenotype, depending on the expressed thioredoxin: AtTRX2 or AtTRX3 induce methionine sulfoxide assimilation and restore a normal cell cycle. In addition AtTRX2 also confers growth on sulfate but no H2O2 tolerance. In contrast, AtTRX3 does not confer growth on sulfate but induces H2O2tolerance. We have constructed hybrid proteins between these two thioredoxins and show that all information necessary for sulfate assimilation is present in the C-terminal part of AtTRX2, whereas some information needed for H2O2 tolerance is located in the N-terminal part of AtTRX3. In addition, mutation of the atypical redox active site WCPPC to the classical site WCGPC restores some growth on sulfate. All these data suggest that the multipleArabidopsis thioredoxins h originate from a totipotent ancestor with all the determinants necessary for interaction with the different thioredoxin target proteins. After duplications each member evolved by losing or masking some of the determinants. polymerase chain reaction adenosine 3′-phosphate 5′-phosphosulfate Thioredoxins are small ubiquitous proteins (12 kDa) that reduce disulfide bonds due to their redox active site with the conserved amino acid sequence WCGPC (1Holmgren A. Ann. Rev. Biochem. 1985; 54: 237-271Crossref PubMed Google Scholar). The structure of thioredoxins has been determined by x-ray crystallography and NMR from various organisms, including pro- and eukaryotes. All have a conserved succession of secondary structures β1, α1, β2, α2, β3, α3, β4, β5, and α4, forming a central core of strands of β sheets surrounded by four α helices. The redox active center is located between the β2 sheet and the α2 helix in a protruding motif. Higher plants present three thioredoxin types, all encoded by the nuclear genome. Thioredoxins f and m are chloroplastic proteins, whereas thioredoxins h are cytosolic. In Arabidopsis thaliana each type is represented by a small gene family. Five thioredoxins h have been detected in this plant, three of which have the unusual active site sequence WCPPC (2Rivera-Madrid R. Mestres D. Marinho P. Jacquot J.P. Decottignies P. Miginiac-Maslow M. Meyer Y. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 5620-5624Crossref PubMed Scopus (113) Google Scholar). The presence of multiple thioredoxins in the same compartment poses the problem of their functional redundancy or specificity (3Jacquot J.P. Lancelin J.M. Meyer Y. New Phytol. 1997; 136: 543-570Crossref PubMed Scopus (157) Google Scholar, 4Meyer Y. Verdoucq L. Vignols F. Trends Plant Sci. 1999; 4: 388-394Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar).Saccharomyces cerevisiae possesses two genes encoding cytosolic thioredoxins with redundant functions: the single mutants have the same characteristics as the wild type, but the simultaneous disruption of the two genes, yTRX1 and yTRX2, leads to a complex set of phenotypic effects, including modifications of the cell cycle, inability to assimilate sulfate, perturbation in methionine sulfoxide reduction, and increased sensitivity to hydrogen peroxide (5Muller E.G. J. Biol. Chem. 1991; 266: 9194-9202Abstract Full Text PDF PubMed Google Scholar). The expression of each Arabidopsis thioredoxin h in the yeast double mutant leads to a normal cell cycle and the ability to reduce methionine sulfoxide, but only the expression of AtTRX2 allows the yeast mutant to grow in the absence of organic sulfur, whereas expression of AtTRX3 (or AtTRX4 to a lesser extend) induces a higher H2O2 tolerance (6Mouaheb N. Thomas D. Verdoucq L. Monfort P. Meyer Y. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 3312-3317Crossref PubMed Scopus (107) Google Scholar). This specificity of complementation suggests that structural domains of thioredoxins are responsible for interactions with several targets. To locate the determinants of specificity, we have constructed hybrid proteins between AtTRX2 and AtTRX3 and tested their ability to complement the different phenotypes of the delta yTRX1 deltayTRX2 yeast mutant. In addition, whereas AtTRX2 presents a classical active site WCGPC, AtTRX3 has the unusual site WCPPC. It has been reported that the nature of the two amino acids between the two cysteines plays a major role in the redox potential of the active site of thioredoxins and related proteins (7Chivers P.T. Raines R.T. Biochemistry. 1997; 36: 15810-15816Crossref PubMed Scopus (96) Google Scholar). Thus we have tested the possible involvement of this unusual active site WCPPC in the functional specificity of AtTRX3. The yeast S. cerevisiae strainEMY63 used in this study was derived from a previous study (8Muller E.G. Yeast. 1992; 8: 117-120Crossref PubMed Scopus (21) Google Scholar). EMY63 is the standard thioredoxin double mutant (MATa, trx1::TRP1,trx2::LEU2, ade2-1,ade3-100, trp1-1, leu2-3,lys2::HIS3, ura3-1, his3-11,can1-100). The strains of Escherichia coli used are DH5α for cloning and BL21(DE3) for production of recombinant proteins. Standard and minimum media were prepared as described by Sherman et al. (9Sherman F. Fink G.R. Hicks J.B. Methods in Yeast Genetics: Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1979Google Scholar). The B medium is sulfate free and was made according to Cherest and Surdin-Kerjan (10Cherest H. Surdin-Kerjan Y. Genetics. 1992; 130: 51-58Crossref PubMed Google Scholar), with addition of 0.3 mm adenine, 7 mm lysine, 1.3 mmhistidine, and 0.1 mm methionine or methionine sulfoxide. YNB-R and YNB-RG are YNB-Difco media with addition of adenine, lysine, and histidine at the same concentration as B medium, 0.1 mmmethionine and 2% raffinose (YNB-R) or 1% raffinose and 2% galactose (YNB-RG). EMY63 cells-expressing yeast yTRX1, A. thaliana AtTRX2, and AtTRX3 proteins were obtained from Mouahebet al. (6Mouaheb N. Thomas D. Verdoucq L. Monfort P. Meyer Y. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 3312-3317Crossref PubMed Scopus (107) Google Scholar). The mutated thioredoxins were obtained by site-directed mutagenesis by overlap extension using PCR1 (11Ho S.N. Hunt H.D. Horton R.M. Pullen J.K. Pease L.R. Gene. 1989; 77: 51-59Crossref PubMed Scopus (6768) Google Scholar), cloned into the pGEMT plasmid (Promega). The oligonucleotides used in this work are listed in Table I. Oligonucleotides Attrx3f 5→3, Attrx2f 3→5, Attrx3Mlu, and Attrx2Bam (Attrx2f 5→3, Attrx3f 3→5, Attrx2Mlu, and Attrx3Bam) were used to obtained the construct Attrx3/2(Attrx2/3), which is a fusion of the 5′-side ofAtTRX3 (AtTRX2) from the start codon to the excluded active center, and the 3′-side of AtTRX2(AtTRX3), from the included active center to the stop codon.Attrx2/3 is the opposite hybrid.Table IOligonucleotides used for mutagenesis of thioredoxin open reading framesNameSequence (5′→3)T m 1-aT m, melting temperature.°CAttrx3MluGCACGCGTATGGCCGCAGAAGGAG80Attrx3BamTTTGGATCCTCAAGCAGCACG64Attrx3NdeAAGCATATGGCCGCAGAAGGAGAAG76Attrx2MluGCACGCGTATGGAGGAGCTTTATC74Attrx2BamAACGGATCCTTATGCTCTGAG62Attrx2NdeCGCATATGGGAGGAGCTTTAT62trx2PP5→3GCTTCATGGTGTCCACCATGTCG62trx2PP3→5CGACATGGTGGACACCATGAAGC62trx2GP5→3GCTTCATGGTGTGGACCATGTCG62trx2GP3→5CGACATGGTCCACACCATGAAGC62trx3GP5→3GCTTCATGGTGTGGACCATGTCGTTTCATTGCACCCG114trx3GP3→5GGTCCACACCATGAAGCAGTGAAGTCTATCAC96trx3PP5→3GCTTCATGGTGTCCACCATGTCGTTTCATTGCACCCG114trx3PP3→5GGTGGACACCATGAAGCAGTGAAGTCTATCAC96Attrx3f5→3TGGTGCCCACCTTGCCG58Attrx3f3→5TGGTCCGCACCATGTTGCAGTG70Attrx2f5→3TGGTGCGGACCATGTAGG58Attrx2f3→5CGGCAAGGTGGGCACCATGAGGCCGA881-a T m, melting temperature. Open table in a new tab To obtain thioredoxins mutated in their active site, we used oligonucleotides trx2GP 5→3, trx2GP 3→5, trx2PP 5→3, and trx2PP 3→5 for AtTRX2 and trx3GP 5→3, trx3GP 3→5, trx3PP 5→3, and trx3PP 3→5 for AtTRX3 designed to hybridize on the active center. Attrx3Mlu or Attrx3Nde, Attrx3Bam, Attrx2Mlu or Attrx2Nde, and Attrx2Bam were used to introduce MluI or NdeI, and BamHI restriction sequences at both extremities of constructs. PCR products were cloned in pGEM-T plasmid (Promega), subcloned in pET16b plasmid (Novagen) with NdeI andBamHI restriction sequences to produce proteins in E. coli, and in Ycp2, with MluI and BamHI restriction sequences for expression in yeast under GAL1promoter control. The autonomously replicating sequence centromeric plasmid Ycp2 (12Cole G.M. Stone D.E. Reed S.I. Mol. Cell. Biol. 1990; 10: 510-517Crossref PubMed Scopus (108) Google Scholar) contains the URA3 gene as a selectable marker and the GAL1 promoter for conditional expression of thioredoxin (6Mouaheb N. Thomas D. Verdoucq L. Monfort P. Meyer Y. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 3312-3317Crossref PubMed Scopus (107) Google Scholar). Each construction was entirely sequenced, and PCR was carried out to check for correct transformation. To overproduce hybrid thioredoxins in E. coli, BL21(DE3) strains were cotransformed with pSBET (13Schenk P.M. Baumann S. Mattes R. Steinbib H.H. BioTechniques. 1995; 19: 196-198PubMed Google Scholar) and pET16b containing constructs, grown in 100 ml of liquid B medium up toA 600 nm = 0.5, when production was induced by addition of 0.4 mmisopropyl-1-thio-β-d-galactopyranoside for 3 h at 37 °C. Cells were then pelleted and stored at −80 °C. S. cerevisiae was transformed after a lithium chloride treatment as described by Ito et al. (14Ito H. Fukuda Y. Murata K. Kimura A. J. Bacteriol. 1983; 153: 163-168Crossref PubMed Google Scholar). Thioredoxins were expressed in yeast as described by Mouaheb et al. (6Mouaheb N. Thomas D. Verdoucq L. Monfort P. Meyer Y. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 3312-3317Crossref PubMed Scopus (107) Google Scholar). The transformed cells were first grown in YNB-R medium and then in YNB-RG medium to induce the transcription of the thioredoxin gene under the control of the GAL1 promoter. Exponentially growing cells were pelleted and stored at −80 °C. Total protein extractions from yeast as well as from bacteria were performed using a hydraulic press (Carver, model 3968) as described by Verdoucq et al. (15Verdoucq L. Vignols F. Jacquot J.P. Chartier Y. Meyer Y. J. Biol. Chem. 1999; 274: 19714-19722Abstract Full Text Full Text PDF PubMed Scopus (195) Google Scholar). For immunodetection, about 1 μg of total bacterial proteins and 60 μg of total yeast proteins from each extract were used. The procedure was as described by Mouaheb et al. (6Mouaheb N. Thomas D. Verdoucq L. Monfort P. Meyer Y. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 3312-3317Crossref PubMed Scopus (107) Google Scholar). Antibodies were visualized with ECL+ Western blotting detection reagents (Amersham Pharmacia Biotech). Anti-thioredoxin antibodies were produced as described by Mouaheb et al. (6Mouaheb N. Thomas D. Verdoucq L. Monfort P. Meyer Y. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 3312-3317Crossref PubMed Scopus (107) Google Scholar). To test methionine sulfoxide assimilation, the transformed cells were grown on liquid B medium with methionine sulfoxide (0.1 mm) as sole sulfur source, and absorbance was measured at 600 nm. To test sulfate assimilation or H2O2 tolerance, cells were first grown in YNB-RG medium to a density of about 107 cells per ml and then diluted in the same medium to four differentA 600 nm ranging from 0.2 to 2 × 10−4. 15 μl of each dilution was plated on YNB-RG agar medium with or without 0.1 mm methionine. H2O2 tolerance was tested in the medium containing 0.1 mm methionine and different H2O2 concentrations as indicated in the text. Plates were then incubated 3–4 days at 29 °C. Flow cytometry was used as described by Mouaheb et al. (6Mouaheb N. Thomas D. Verdoucq L. Monfort P. Meyer Y. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 3312-3317Crossref PubMed Scopus (107) Google Scholar) for determination of the cell cycle parameters, except that the medium was YNB-RG. AtTRX2 and AtTRX3 were modeled using Swiss-PdbViewer v3.5 (16Guex N. Peitsch M.C. Electrophoresis. 1997; 15: 2714-2723Crossref Scopus (9389) Google Scholar) with the closest structure to the average of the NMR ensemble (1tof.pdb; 17) as a template structure. Forty model structures of Chlamydomonas reinhardtii thioredoxin h containing a proline instead of a glycine in the redox active site (WCPPC instead of WCGPC) were obtained using version 4.0 of the MODELLER program (18Sali A. Blundell T.L. J. Mol. Biol. 1993; 234: 779-815Crossref PubMed Scopus (10277) Google Scholar) using the same template structure. As shown in Fig. 1 the N-terminal parts of plant and yeast thioredoxins are very divergent, whereas the C-terminal parts show high similarities. To localize the structural determinants responsible for the functional specificity of AtTRX2 and AtTRX3 in yeast, we first built hybrid proteins between AtTRX2 and AtTRX3 and then produced both proteins inE. coli to test the usefulness of the anti-AtTRX2 and anti-AtTRX3 sera for the detection of the hybrid proteins. The hybrid constructions were introduced into the shuttle vector Ycp2 and the yeast thioredoxin double mutant transformed with these vectors. The presence of the hybrid proteins and the effects on the four aspects of the phenotype were tested in the recombinant yeast. In a second set of experiments, we have estimated the possible role of the atypical active site WCPPC on the specificity of these thioredoxins by introducing G33P or P33G mutations in AtTRX2 and AtTRX3, respectively. A sketch of the different thioredoxin constructs is included in Fig.2. The amino acids are numbered according to their position in respect to E. coli sequence. Hybrid constructs were obtained by interchanging the N-side and the C-side of AtTRX2 and AtTRX3, taking the splitting point at the tryptophan Trp-31 of the conserved active site. Thus, Attrx2/3 is constituted by the N-side of AtTRX2, the active center of AtTRX3 and its C-side. Attrx3/2 is the complementary construct. The constructs were first cloned in the plasmid pET16b allowing overexpression in E. coli. Both hybrids are abundantly expressed in E. coli and are easily detected by staining. Attrx3/2 is detected mainly in the supernatant, whereas most Attrx2/3 is still present in the pellet (not shown). The serum raised against AtTRX3 detects Attrx2/3 and with a lower efficiency Attrx3/2. However, the serum raised against AtTRX2 revealed only Attrx3/2 (not shown). Hybrid constructs were then cloned in the shuttle vector Ycp2 under the control of the promoter GAL1 and were introduced in the yeast double mutant Δtrx1,Δtrx2. Immunoblot analyses against yeast total protein extracts were carried out using antibody raised against AtTRX3, to check for the presence of hybrid proteins in yeast. As shown in Fig.3, Attrx3/2 was detected by antibody raised against AtTRX2, whereas Attrx2/3 was undetected, suggesting that this hybrid protein is not synthesized or is unstable in yeast. Four phenotypic aspects were analyzed in theΔtrx1,Δtrx2 double disrupted EMY63 yeast cells transformed by the hybrid constructs: methionine sulfoxide assimilation, cell cycle parameters, H2O2tolerance, and sulfate assimilation (5Muller E.G. J. Biol. Chem. 1991; 266: 9194-9202Abstract Full Text PDF PubMed Google Scholar, 19Muller E.G. Mol. Biol. Cell. 1996; 7: 1805-1813Crossref PubMed Scopus (163) Google Scholar). As shown previously (6Mouaheb N. Thomas D. Verdoucq L. Monfort P. Meyer Y. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 3312-3317Crossref PubMed Scopus (107) Google Scholar) expression of each Arabidopsisthioredoxin h is able to restore a normal cell cycle in the presence of methionine and rapid growth on methionine sulfoxide as sole sulfur source. The hybrid construct Attrx2/3 was inefficient for both aspects. Therefore, considering the absence of detection by antibodies, we concluded that the hybrid Attrx2/3 protein was not produced at an adequate level or in a correct structural conformation in yeast to be active. Because of this, we focused on phenotypic aspects of the yeast thioredoxin mutant expressing the Attrx3/2 hybrid. Yeasts expressing Attrx3/2 were capable of growing on methionine sulfoxide in the particular synthetic medium (B medium) that is completely devoid of other sulfur source. Double mutant cells transformed with the empty Ycp2 showed only residual growth on methionine sulfoxide, whereas cells expressing Attrx3/2 grew with a mean generation time equivalent to that of cells expressing yTRX1, AtTRX2, or AtTRX3 (Table II). The cell cycle of the thioredoxin double mutant yeast growing in the presence of methionine is abnormal, with a lengthened S phase and no G1phase (5Muller E.G. J. Biol. Chem. 1991; 266: 9194-9202Abstract Full Text PDF PubMed Google Scholar). Cells expressing any of the A. thalianathioredoxin h genes displayed a normal cell cycle (6Mouaheb N. Thomas D. Verdoucq L. Monfort P. Meyer Y. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 3312-3317Crossref PubMed Scopus (107) Google Scholar). The DNA content of the transformed yeast was then analyzed by flow cytometry, and the results are reported in Fig. 4. The cell cycle of yeast mutant expressing Attrx3/2 was almost normal showing a clear G1 phase. These results demonstrate that the hybrid protein Attrx3/2 is able to confer to the EMY63 mutant growth properties conferred by other thioredoxins h.Table IIMean generation times (G.T.) of the Δtrx1, Δtrx2 yeast EMY63 transformed by the empty plasmid Ycp2 or by different thioredoxin constructs in this plasmidEMY63Ycp2yTRX1AtTRX3AtTRX2Attrx3/2hG.T233344Cells were grown on B medium with methionine sulfoxide (0.1 mm) as sole sulfur source. Absorbance was measured at 600 nm in a Uvikon 930 spectrophotometer. Open table in a new tab Cells were grown on B medium with methionine sulfoxide (0.1 mm) as sole sulfur source. Absorbance was measured at 600 nm in a Uvikon 930 spectrophotometer. The mutant EMY63 was unable to grow on sulfate, whereas expression of AtTRX2 in the yeast mutant cells restored sulfate assimilation. Expression of AtTRX3 did not. Cells expressing Attrx3/2 were able to grow in the absence of organic sulfur (Fig.5) showing that all information conferring sulfate assimilation is present in the C-terminal part of the molecule. Another aspect of the yeast thioredoxin mutant phenotype is its increased sensitivity to oxidants such as H2O2. Indeed, the yeast thioredoxin mutant could not grow in the presence of H2O2 at concentrations higher than 0.5 mm (not shown). To verify the capacity of transformed cells to tolerate hydrogen peroxide, the yeast cells were plated on media containing different concentrations of H2O2, ranging from 0.5 to 1.5 mm. As previously shown (6Mouaheb N. Thomas D. Verdoucq L. Monfort P. Meyer Y. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 3312-3317Crossref PubMed Scopus (107) Google Scholar), expression of AtTRX3 allowed yeast cells to grow in the presence of 1 mm H2O2, whereas yeast expressing AtTRX2 had the same tolerance to H2O2 as the mutant (0.5 mm). Cells expressing Attrx3/2 were able to tolerate concentration of H2O2 of 0.7–0.8 mm, which is higher than that tolerated by cells expressing AtTRX2 (not shown). Therefore, this hybrid protein is associated with the preventive process of hydrogen peroxide damages suggesting that the N-terminal part of AtTRX3 contains some of the information necessary to induce H2O2 tolerance, or alternatively, that the N-terminal part of AtTRX2 masks determinants already present in the C-terminal part of AtTRX2. The 40 calculated models of C. reinhardtiithioredoxin h with a WCPPC active site indicate that a Pro residue can most probably occupy a single conformation that does not disrupt any of the fine geometry of the thioredoxin active site (17Mittard V. Blackledge M.J. Stein M. Jacquot J.P. Marion D. Lancelin J.M. Eur. J. Biochem. 1997; 243: 374-383Crossref PubMed Scopus (48) Google Scholar). The Gly→Pro mutation would simply expose the side chain of Pro to the solvent making the direct environment of the reactive cysteine 32 more hydrophobic while the active sulfur of the same Cys becomes more sterically hindered (Fig. 6). The possibility of hydrogen bond formation between the solvent-exposed amide proton of the Gly in the redox site of WCGPC-type thioredoxins and their substrates also disappeared in WCPPC-type thioredoxins. A. thaliana thioredoxin AtTRX3 has an unusual active site sequence WCPPC. The presence of a proline instead of the usual glycine has an influence on the redox potential, as described by Chivers et al. (7Chivers P.T. Raines R.T. Biochemistry. 1997; 36: 15810-15816Crossref PubMed Scopus (96) Google Scholar), and may change the accessibility to the cysteines of the redox active site. This may play a role in the functional specificity of the cytoplasmic thioredoxins. This prompted us to test the ability of AtTRX2 or AtTRX3 variants with a mutated active site to complement the yeast thioredoxin mutant for the four phenotypic aspects described above. We chose to proceed in two steps, obtaining first variants of AtTRX2 and AtTRX3with almost identical nucleotide sequences around the active site differing only by the two nucleotides of the proline (CCa) and glycine (GGa) codons. These variants will be useful in further studies and are used in this study to control the effect of changing some codon use. Two pairs of primers were designed encoding the protein sequences: primer 1, ASWCGPCR and primer 2, ASWCPPCR (Table I). The use of primer 1 to modifyAtTRX2 produced a variant named Attrx2GP, differing from AtTRX2 by two nucleotides but encoding exactly the same protein. The use of primer 2 to modifyAtTRX3 produced the variant Attrx3PP with four nucleotide changes, encoding a T30S mutated protein. The desired P33G or G33P mutations were obtained in a second step by using primer 1 to modify AtTRX3 producing Attrx3GP and by using primer 2 to modify AtTRX2 producing Attrx2PP. The four constructs were inserted into the Ycp2 plasmid then introduced into the yeast double thioredoxin mutant, and the phenotype was tested. We verified the expression and stability of the new proteins Attrx2GP, Attrx2PP, Attrx3GP, and Attrx3PP by immunoblot analysis (not shown). Each protein was detected by the appropriated antibody, but the quantities of mutated proteins present in yeast cells were lower than quantities of AtTRX2 or AtTRX3, probably because of an unfavorable codon usage. Concerning the reduction of methionine sulfoxide and cell cycle parameters, the efficiency of AtTRX2 and AtTRX3 seemed unchanged. Indeed, the mean generation time of cells expressing Attrx2GP, Attrx2PP, Attrx3GP, or Attrx3PP growing on methionine sulfoxide medium was slightly longer than that of cells expressing AtTRX2 or AtTRX3 (Table III). Cell cycles of yeast transformed with mutated thioredoxins were almost normal, showing a G1 phase (Fig. 7). The lower number of cells in G1 compared with the cells transformed by plasmids expressing the wild type thioredoxins may be directly related to the lower levels of proteins present in the cells. Cells expressing Attrx3-GP or Attrx3-PP could tolerate concentrations of H2O2 up to 0.8 mm (not shown), whereas yeast transformed by Attrx2GP or Attrx2PPwere unable to grow in the presence of H2O2 at concentrations higher than 0.5 mm, as observed for cells expressing AtTRX2 or no thioredoxin. The concentrations tolerated by cells expressing Attrx3GP or Attrx3PP are slightly lower than those tolerated by cells expressing AtTRX3, the differences being directly related to the lower levels of proteins present in cells.Table IIIMean generation times (G.T.) of the Δtrx1, Δtrx2 yeast EMY63 transformed by the empty plasmid Ycp2 or by different thioredoxin constructs in this plasmidEMY63Ycp2YTRX1AtTRX3AtTRX2Attrx3PPAttrx3GPAttrx2GPAttrx2PPhG.T.233344455Cells were grown on B medium with methionine sulfoxide (0.1 mM) as sole sulfur source. Absorbance was measured at 600 nm in a Uvikon 930 spectrometer. Open table in a new tab Cells were grown on B medium with methionine sulfoxide (0.1 mM) as sole sulfur source. Absorbance was measured at 600 nm in a Uvikon 930 spectrometer. Growth of cells expressing the mutated Attrx2GP or Attrx2PP proteins on organic sulfur free medium was equivalent to that of cells expressing AtTRX2 (Fig. 8). Cells expressing AtTRX3 or Attrx3-PP did not grow on medium devoid of organic sulfur source. In contrast, the expression of Attrx3-GP allowed cells to grow on this medium (Fig. 8). Thus the mutation P33G conferred a gain of function to AtTRX3, enabling this protein to participate in sulfate assimilation. The complementation spectra of the different hybrid and mutant proteins are summarized in Table IV.Table IVComplementation spectra of yeast EMY63 expressing the different hybrids and mutated thioredoxinsCells in GTGrowth on MetSOH2O2toleranceGrowth on SO42−%mmAtTRX227+++0.5++Attrx2GP10++0.5++Attrx2PP14++0.5++Attrx3/220++0.75++Attrx3GP10++0.8+Attrx3PP12++0.80AtTRX326+++1.00Empty Ycp21.400.50 Open table in a new tab Thioredoxins have a particularly stable three-dimensional structure with a central core of five strands of β-sheets enclosed by four α-helices and two hydrophobic zones. This stable conformation is conserved among all thioredoxin structures from prokaryotes, mammals, and eukaryotic algae that have been determined so far (1Holmgren A. Ann. Rev. Biochem. 1985; 54: 237-271Crossref PubMed Google Scholar, 17Mittard V. Blackledge M.J. Stein M. Jacquot J.P. Marion D. Lancelin J.M. Eur. J. Biochem. 1997; 243: 374-383Crossref PubMed Scopus (48) Google Scholar, 20Forman-Kay J.D. Clore G.M. Stahl S.J. Gronenborn A.M. J. Biomol. NMR. 1992; 2: 431-445Crossref PubMed Scopus (24) Google Scholar, 21Eklund H. Gleason F. Holmgren A. Proteins. 1991; 11: 13-28Crossref PubMed Scopus (323) Google Scholar). However, expression in the yeast double mutant has shown thatArabidopsis thioredoxins h are able to complement only a limited and in part different set of functions than those that are controlled in the wild type by the two redundant endogenous yeast thioredoxins. In other words, both yeast thioredoxins interact with several targets implicated in different independent processes, whereas the cytoplasmic A. thaliana thioredoxins are active only on some of the yeast thioredoxin targets. An explanation for this specificity cannot be found in the conserved global structure of thioredoxins but rather in residues on the protein surface. On the basis of the sequences, a simple hypothesis consisted in suspecting the less conserved N-terminal part of plant thioredoxins (Fig. 1) to play an important role in the specificity. Thus, we decided to build two chimerical thioredoxins between AtTRX2 and AtTRX3, interchanging the N and C sides of both thioredoxins, by taking the splitting point at the tryptophan, which precedes the first cysteine of the active center. The construct Attrx2/3 appears to encode a protein that is not able to take a normal conformation in E. coli resulting in insolubility and which is not synthesized or not stable inSaccharomyces. Lopez-Jaramillo et al. (22Lopez-Jaramillo J. Chueca A. Sahrawy M. Lopez-Gorge J. Plant J. 1998; 15: 155-163Crossref PubMed Scopus (5) Google Scholar) reported similar results for hybrid proteins constructed between different types of chloroplastic thioredoxins. In both cases computer modeling indicated that these sequences are compatible with a normal stable thioredoxin folding. Most probably, they are blocked at an intermediate step during the folding process and consequently do not reach the final folding stage. In contrast, the hybrid protein Attrx3/2 is fully soluble in E. coli and accumulates in Saccharomyces, thus allowing further studies. The first result from the complementation of EMY63 by the Attrx3/2 is that our assumption on the role of the N-terminal part as determinant of the specificity was wrong, because all determinants for sulfate assimilation are present in the C-terminal part of AtTRX2. Nevertheless an anti-oxidant activity is associated with the N-terminal part of AtTRX3. This suggests that the domains necessary for the interaction with different target proteins are not located at the same place on the thioredoxin molecules. Qin et al. (23Qin J. Clore G.M. Kennedy W.M. Huth J.R. Gronenborn A.M. Structure. 1995; 3: 289-297Abstract Full Text Full Text PDF PubMed Scopus (208) Google Scholar, 24Qin J. Clore G.M. Kennedy W.P. Kuszewski J. Gronenborn A.M. Structure. 1996; 15: 613-620Abstract Full Text Full Text PDF Scopus (144) Google Scholar) have shown that NFκB and Ref-1, two targets of the human thioredoxin, are associated with thioredoxin in a reverse position, supporting the same conclusion. A particularity of some plant thioredoxins h is the presence of the atypical site WCPPC. It has been demonstrated that the redox activity of the active center depends on amino acid residues situated between the two cysteines (7Chivers P.T. Raines R.T. Biochemistry. 1997; 36: 15810-15816Crossref PubMed Scopus (96) Google Scholar). For example, the disulfide isomerase DsbA fromE. coli belongs to the thioredoxin family. Its structure is similar to that of thioredoxin (25Martin J.L. Bardwell J.C. Kuriyan J. Nature. 1993; 365: 464-468Crossref PubMed Scopus (348) Google Scholar), but its active center CPHC is oxidant, whereas that of thioredoxin, CGPC, is reductive (26Gane P.J. Freedman R.B. Warwicker A. J. Mol. Biol. 1995; 249: 376-387Crossref PubMed Scopus (64) Google Scholar). In AtTRX3, the single mutation P33G allows the molecule to support sulfate assimilation, suggesting that the presence of the proline hinders interaction with the protein target(s) implicated in sulfate assimilation. The vicinity of the reactive cysteine 32, which is more hydrophobic and less accessible in WCPPC relative to WCGPC-type thioredoxin, could significantly change the Cys reactivity, its apparent pK a, and possibly the redox potential (7Chivers P.T. Raines R.T. Biochemistry. 1997; 36: 15810-15816Crossref PubMed Scopus (96) Google Scholar). Nevertheless, the presence of the proline at position 33 in AtTRX2 is not the only characteristic that hinders sulfate assimilation. Indeed, the mutation P33G only allows a slow growth rate on sulfate medium. In addition the G33P mutation in AtTRX2 does not modify its ability to induce sulfate assimilation. Scrutiny of AtTRX2 and AtTRX3 three-dimensional models reveals that the closest differences in the vicinity of the active site are located in the helix II of thioredoxins about 7 to 15 Å away from the reactive sulfur: in AtTRX2, positions +4 and +8 relative to the last cysteine of the active site (WCXPC) are Glu and His. In AtTRX3 these positions are occupied by two alanines (Fig.6). These positions are partially exposed to the solvent and could therefore be involved in the transitory thioredoxin-substrate complexes. Overall, AtTRX3 appears less charged and less hydrophobic, whereas AtTRX2 has the most polar active site neighborhood, which may explain the differences of activity of the mutated active centers. Presently, the thioredoxin targets responsible for H2O2 tolerance and sulfate assimilation are not definitely established. Nevertheless, peroxiredoxins are likely to be implicated in the thioredoxin-dependent tolerance to H2O2. The three yeast peroxiredoxins TSA, YDR453C, and YLR109 accumulate at a higher level in H2O2-treated yeasts (29Godon C. Lagniel G. Lee J. Buhler J.M. Kieffer S. Perrot M. Boucherie H. Toledano M.B. Labarre J. J. Biol. Chem. 1999; 273: 22480-22489Abstract Full Text Full Text PDF Scopus (496) Google Scholar), and genetic (30Lee J. Spector D. Godon C. Labarre J. Toledano M.B. J. Biol. Chem. 1999; 274: 4537-4544Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar) and biochemical (31Jeong J.S. Kwon S.J. Kang S.W. Rhee S.G. Kim K. Biochemistry. 1999; 38: 776-783Crossref PubMed Scopus (107) Google Scholar) evidence shows that YLR109 is not reduced by glutathione or glutaredoxin whereas TSA and YDR453C are. In addition we have previously isolated a disulfide-bridged complex between AtTRX3 and YLR109 (15Verdoucq L. Vignols F. Jacquot J.P. Chartier Y. Meyer Y. J. Biol. Chem. 1999; 274: 19714-19722Abstract Full Text Full Text PDF PubMed Scopus (195) Google Scholar). Thus the hypersensitivity of EMY63, which lacks thioredoxins but still has glutathione and glutaredoxin, is most likely due to the failure to reduce YLR109. The complete absence of growth on sulfate may be due to the absence of reduction of the adenosine 3′-phosphate 5′-phosphosulfate (PAPS) by PAPS reductase, the sole enzyme of sulfate assimilation that is directly dependent on a disulfide reduction for activity. Nevertheless, in E. coliglutaredoxins and thioredoxins act as electron donors to PAPS reductase (32Lillig C.H. Prior A. Schwenn J.D. Aslund F. Ritz D. Vlamis-Gardikas A. Holmgren A. J. Biol. Chem. 1999; 274: 7695-7698Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar). The S. cerevisiae PAPS reductase may be more specifically reduced by thioredoxin, or alternatively, the inability of EMY63 to assimilate sulfate may be an indirect consequence of the redox state of these cells. From an evolutionary point of view, the clearest result (Table IV) is that, starting with thioredoxins with restricted activity spectra, we have produced thioredoxins with a larger activity spectrum by two independent methods: Attrx3/2 has full activity for sulfate assimilation and gains some antioxidant activity; Attrx3GP has full antioxidant activity and gains some ability to induce sulfate assimilation. These results are consistent with the hypothesis of a common origin of plant thioredoxins h from a totipotent ancestor. After gene duplications, mutations appeared that masked some determinants necessary for the interaction with particular targets and resulting in a specialization of the plant thioredoxins h. We thank Dr. Richard Cooke (Perpignan) for reading and improving the text and Dr. Patrick Monfort (Montpellier) for performing the flow cytometry analysis." @default.
• W2076575552 created "2016-06-24" @default.
• W2076575552 creator A5028030915 @default.
• W2076575552 creator A5036247960 @default.
• W2076575552 creator A5070457691 @default.
• W2076575552 creator A5073341292 @default.
• W2076575552 creator A5088292184 @default.
• W2076575552 date "2000-10-01" @default.
• W2076575552 modified "2023-09-27" @default.
• W2076575552 title "Characterization of Determinants for the Specificity ofArabidopsis Thioredoxins h in Yeast Complementation" @default.
• W2076575552 cites W1560585760 @default.
• W2076575552 cites W1929569478 @default.
• W2076575552 cites W1941431053 @default.
• W2076575552 cites W1973782344 @default.
• W2076575552 cites W1975459052 @default.
• W2076575552 cites W1980470751 @default.
• W2076575552 cites W1991017436 @default.
• W2076575552 cites W1994114319 @default.
• W2076575552 cites W1997720526 @default.
• W2076575552 cites W2002195659 @default.
• W2076575552 cites W2009002413 @default.
• W2076575552 cites W2012948497 @default.
• W2076575552 cites W2015642465 @default.
• W2076575552 cites W2017810508 @default.
• W2076575552 cites W2023046517 @default.
• W2076575552 cites W2036357948 @default.
• W2076575552 cites W2046385725 @default.
• W2076575552 cites W2051723842 @default.
• W2076575552 cites W2055212449 @default.
• W2076575552 cites W2060913542 @default.
• W2076575552 cites W2065283382 @default.
• W2076575552 cites W2074799601 @default.
• W2076575552 cites W2089062179 @default.
• W2076575552 cites W2100841967 @default.
• W2076575552 cites W2123130100 @default.
• W2076575552 cites W2132863919 @default.
• W2076575552 cites W2135805856 @default.
• W2076575552 cites W2149608502 @default.
• W2076575552 cites W4247896860 @default.
• W2076575552 doi "https://doi.org/10.1074/jbc.m002916200" @default.
• W2076575552 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10906327" @default.
• W2076575552 hasPublicationYear "2000" @default.
• W2076575552 type Work @default.
• W2076575552 sameAs 2076575552 @default.
• W2076575552 citedByCount "49" @default.
• W2076575552 countsByYear W20765755522013 @default.
• W2076575552 countsByYear W20765755522014 @default.
• W2076575552 countsByYear W20765755522015 @default.
• W2076575552 countsByYear W20765755522016 @default.
• W2076575552 countsByYear W20765755522018 @default.
• W2076575552 countsByYear W20765755522019 @default.
• W2076575552 countsByYear W20765755522021 @default.
• W2076575552 countsByYear W20765755522022 @default.
• W2076575552 countsByYear W20765755522023 @default.
• W2076575552 crossrefType "journal-article" @default.
• W2076575552 hasAuthorship W2076575552A5028030915 @default.
• W2076575552 hasAuthorship W2076575552A5036247960 @default.
• W2076575552 hasAuthorship W2076575552A5070457691 @default.
• W2076575552 hasAuthorship W2076575552A5073341292 @default.
• W2076575552 hasAuthorship W2076575552A5088292184 @default.
• W2076575552 hasBestOaLocation W20765755521 @default.
• W2076575552 hasConcept C104317684 @default.
• W2076575552 hasConcept C115867849 @default.
• W2076575552 hasConcept C127716648 @default.
• W2076575552 hasConcept C171250308 @default.
• W2076575552 hasConcept C185592680 @default.
• W2076575552 hasConcept C188082640 @default.
• W2076575552 hasConcept C192562407 @default.
• W2076575552 hasConcept C2779222958 @default.
• W2076575552 hasConcept C2780841128 @default.
• W2076575552 hasConcept C55493867 @default.
• W2076575552 hasConcept C86803240 @default.
• W2076575552 hasConcept C89423630 @default.
• W2076575552 hasConceptScore W2076575552C104317684 @default.
• W2076575552 hasConceptScore W2076575552C115867849 @default.
• W2076575552 hasConceptScore W2076575552C127716648 @default.
• W2076575552 hasConceptScore W2076575552C171250308 @default.
• W2076575552 hasConceptScore W2076575552C185592680 @default.
• W2076575552 hasConceptScore W2076575552C188082640 @default.
• W2076575552 hasConceptScore W2076575552C192562407 @default.
• W2076575552 hasConceptScore W2076575552C2779222958 @default.
• W2076575552 hasConceptScore W2076575552C2780841128 @default.
• W2076575552 hasConceptScore W2076575552C55493867 @default.
• W2076575552 hasConceptScore W2076575552C86803240 @default.
• W2076575552 hasConceptScore W2076575552C89423630 @default.
• W2076575552 hasIssue "41" @default.
• W2076575552 hasLocation W20765755521 @default.
• W2076575552 hasLocation W20765755522 @default.
• W2076575552 hasLocation W20765755523 @default.
• W2076575552 hasLocation W20765755524 @default.
• W2076575552 hasOpenAccess W2076575552 @default.
• W2076575552 hasPrimaryLocation W20765755521 @default.
• W2076575552 hasRelatedWork W1820197401 @default.
• W2076575552 hasRelatedWork W2066882282 @default.
• W2076575552 hasRelatedWork W2130229792 @default.
• W2076575552 hasRelatedWork W2382073097 @default.
• W2076575552 hasRelatedWork W2513978528 @default.
• W2076575552 hasRelatedWork W2999829375 @default.

• next