FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2077099521> ?p ?o ?g. }

• W2077099521 endingPage "24134" @default.
• W2077099521 startingPage "24128" @default.
• W2077099521 abstract "The universally conserved 3′-terminal CCA sequence of tRNA interacts with large ribosomal subunit RNA during translation. The functional importance of the interaction between the 3′-terminal nucleotide of tRNA and the ribosome was studied in vitro using mutant in vitro transcribed tRNAVal A76G. Val-tRNACCG does not support polypeptide synthesis on poly(GUA) as a message. However, in a co-translation system, where Val-tRNACCG represented only a small fraction of total Val-tRNA, the mutant tRNA is able to transfer valine into a polypeptide chain, albeit at a reduced level. The A76G mutation does not affect binding of Val- or NAcVal-tRNACCGto the A- or P-sites as shown by efficient peptide bond formation, although the donor activity of the mutant NAcVal-tRNACCG in the peptidyl transfer reaction is slightly reduced compared with wild-type NAcVal-tRNA. Translocation of 3′-CCG-tRNA from the P- to the E-site is not significantly influenced. However, the A76G mutation drastically inhibits translocation of peptidyl-tRNA G76 from the ribosomal A-site to the P-site, which apparently explains its failure to support cell-free protein synthesis. Our results indicate that the identity of the 3′-terminal nucleotide of tRNA is critical for tRNA movement in the ribosome. The universally conserved 3′-terminal CCA sequence of tRNA interacts with large ribosomal subunit RNA during translation. The functional importance of the interaction between the 3′-terminal nucleotide of tRNA and the ribosome was studied in vitro using mutant in vitro transcribed tRNAVal A76G. Val-tRNACCG does not support polypeptide synthesis on poly(GUA) as a message. However, in a co-translation system, where Val-tRNACCG represented only a small fraction of total Val-tRNA, the mutant tRNA is able to transfer valine into a polypeptide chain, albeit at a reduced level. The A76G mutation does not affect binding of Val- or NAcVal-tRNACCGto the A- or P-sites as shown by efficient peptide bond formation, although the donor activity of the mutant NAcVal-tRNACCG in the peptidyl transfer reaction is slightly reduced compared with wild-type NAcVal-tRNA. Translocation of 3′-CCG-tRNA from the P- to the E-site is not significantly influenced. However, the A76G mutation drastically inhibits translocation of peptidyl-tRNA G76 from the ribosomal A-site to the P-site, which apparently explains its failure to support cell-free protein synthesis. Our results indicate that the identity of the 3′-terminal nucleotide of tRNA is critical for tRNA movement in the ribosome. The 3′-CCA sequence of tRNA is a universal ligand for protein biosynthesis; it is recognized by aminoacyl-tRNA synthetases, EF-Tu, and 23 S rRNA (1Chladek S. Sprinzl M. Angew. Chem. Int. Ed. Eng. 1985; 24: 371-391Crossref Scopus (62) Google Scholar, 2Green R. Noller H.F. Annu. Rev. Biochem. 1997; 66: 679-716Crossref PubMed Scopus (420) Google Scholar). Experiments using in vitro transcribed tRNAVal variants demonstrated the importance of the 3′-CCA sequence for aminoacylation (3Liu M. Horowitz J. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 10389-10393Crossref PubMed Scopus (17) Google Scholar, 4Tamura K. Nobukazu N. Tsunemi H. Shimizu M. Himeno H. J. Biol. Chem. 1994; 269: 22173-22177Abstract Full Text PDF PubMed Google Scholar) and its significance in formation of the ternary complex between Val-tRNA, EF-Tu, and GTP (5Liu J. Liu M. Horowitz J. RNA. 1998; 4: 639-646Crossref PubMed Scopus (18) Google Scholar). On ribosomes, the CCA end of tRNA interacts with 23 S rRNA at all ribosomal tRNA binding sites (6Wower J. Kirillov S.V. Wower I.K. Guven S. Hixon S.S. Zimmermann R.A. J. Biol. Chem. 2000; 275: 37887-37894Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar). The importance of the CCA end in ribosome-catalyzed peptide bond formation is well established (1Chladek S. Sprinzl M. Angew. Chem. Int. Ed. Eng. 1985; 24: 371-391Crossref Scopus (62) Google Scholar, 7Nissen P. Hansen J. Ban N. Moore P.B. Steitz T.A. Science. 2000; 289: 920-930Crossref PubMed Scopus (1736) Google Scholar). Chemically synthesized aminoacyl oligonucleotides were used to demonstrate the significance of the 3′-CCA sequence as a peptide acceptor during peptide bond formation on ribosomes (8Tezuka M. Chladek S. Biochemistry. 1990; 29: 667-670Crossref PubMed Scopus (10) Google Scholar). E. colitRNAVal with mutations in the 3′-CCA sequence inhibits the peptidyltransferase activity of the ribosome (9Tamura K. FEBS Lett. 1994; 353: 173-176Crossref PubMed Scopus (14) Google Scholar). These findings were rationalized by showing functional base pairing of C74 with G2252 of 23 S rRNA at the donor site of the ribosomal peptidyltransferase center (10Samaha R.R. Green R. Noller H.F. Nature. 1995; 377: 309-314Crossref PubMed Scopus (203) Google Scholar) and of C75 with G2553 at the acceptor site (11Green R. Switzer C. Noller H.F. Science. 1998; 280: 286-289Crossref PubMed Scopus (74) Google Scholar, 12Kim D.F. Green R. Mol Cell. 1999; 4: 859-864Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar, 13Khaitovich P. Mankin A. Garrett R.A. Douthwaite S.R. Liljas A. Matheson A.T. Moore P.B. Noller H.F. The Ribosome: Structure, Function, Antibiotics, and Cellular Interaction. American Society for Microbiology Press, Washington, D. C.2000: 229-244Google Scholar).Mutation of C74 to U74 in tRNAHisderepresses the histidine biosynthetic operon of Salmonella typhimurium (14O'Connor M. Willis N.M. Bossi L. Gesteland R.F. Atkins J.F. EMBO J. 1993; 12: 2559-2566Crossref PubMed Scopus (46) Google Scholar). Mutants of Escherichia coli tRNA1Val with 3′-GCA or 3′-ACA promote −1 frameshifting and suppress a wide variety of nonsense mutants (14O'Connor M. Willis N.M. Bossi L. Gesteland R.F. Atkins J.F. EMBO J. 1993; 12: 2559-2566Crossref PubMed Scopus (46) Google Scholar). It has also been proposed that substitution of the A76 of tRNA affects binding of deacylated tRNA to the ribosomal E-site (15Lill R. Robertson J.M. Wintermeyer W. EMBO J. 1989; 8: 3933-3938Crossref PubMed Scopus (108) Google Scholar). These findings show the importance of the 3′-CCA end of tRNA in maintaining the reading frame during translation and suggest that the 3′-CCA end is involved in ribosomal translocation.In this paper, we analyze the functional importance of the 3′-terminal A of tRNA for ribosomal translation. The results show that substitution of the 3′ A of tRNAVal with G blocks translocation of peptidyl-tRNA from the ribosomal A-site to the P-site and inhibits the peptidyl transfer reaction at the ribosomal donor (P) site.MATERIALS AND METHODSPreparation of tRNAs, Poly(GUA), and EnzymesTransfer RNAVal (anticodon UAC) was synthesizedin vitro by T7 RNA polymerase-catalyzed run-off transcription from the phagemid pFVAL119 linearized by FokI (A76) or from pFVALG76 linearized by MspI (16Liu M. Horowitz J. BioTechniques. 1993; 15: 264-266PubMed Google Scholar). This method was shown to produce the expected nucleotide at the 3′-terminus (17Chu W.-C. Horowitz J. Nucleic Acids Res. 1989; 17: 7241-7252Crossref PubMed Scopus (62) Google Scholar). tRNAVal variants were purified by size exclusion chromatography on Sephadex G-50 and gel electrophoresis in 7% urea-PAGE. Total E. coli tRNA was from Roche Molecular Biochemicals. tRNAs are designated as follows: tRNACCA(in vitro transcribed wild-type tRNAVal), tRNACCG (in vitro transcribed tRNAVal with the mutation A76G), tRNAbulk(total (unfractionated) E. coli tRNA), and tRNAVal (purified isoacceptors of valine-specific E. coli tRNA). 1 μg of tRNAVal was taken as equal to 40 pmol.DNA encoding the sequence poly(GTA)44 was the kind gift of Dr. T. Tenson (University of Tartu). The poly(GTA)44 was amplified by PCR and cloned under the control of the T7 late promoter in pLITMUS38 between the ApaI and EcoRV sites. The plasmid was cleaved by BspTI, and poly(GUA)44 was prepared by in vitrotranscription with T7 RNA polymerase. Poly(GUA) mRNA has the sequence 5′-GGCCCGUAGA(GUA)44. Transcripts were purified by gel filtration chromatography on Sephadex G-50. 1 μg of poly(GUA)44 was taken as equal to 25 pmol.T7 RNA polymerase was purified as described by Davanloo et al. (18Davanloo P. Rosenberg A.H. Dunn J.J. Studier F.W. Proc. Natl. Acad. Sci. U. S. A. 1984; 81: 2035-20399Crossref PubMed Scopus (724) Google Scholar) from E. coli strain BL21(DE-3)/pAR1219 (kindly provided by W. Studier, Brookhaven National Laboratory, Upton, NY). To prepare ValRS(His)6, the ValRS gene was PCR-amplified from Thermus aquaticus genomic DNA using primers GCCATATGGACCTGCCCAAGGCCTAC and CGGCGGCCGCCCCTATTTGGCTGAGGG. Amplified DNA was digested with NdeI and NotI and cloned into pET24A (Novagen) to produce pET24A-VTA. ValRS(His)6 was expressed in BL21/(DE3) and purified using a Ni2+-nitrilotriacetic acid column (QiaExpressionist). The enzyme was stored at −80 °C in buffer containing 20 mmTris·HCl (pH 7.5), 100 mm KCl, 2 mmMgCl2, 6 mm 2-mercaptoethanol, and 50% glycerol.Plasmid encoding E. coli elongation factor EF-Tu-His (pKECA) was kindly provided by Dr. B. Kraal (19Boon K. Vijgenboom E. Madsen L.V. Talens A. Kraal B. Bosch L. Eur. J. Biochem. 1992; 210: 177-183Crossref PubMed Scopus (54) Google Scholar). EF-G-His expression plasmid (pRSET) was a kind gift from Dr. M. Rodnina (20Semenkov Y.P. Rodnina M.V. Wintermeyer W. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 12183-12188Crossref PubMed Scopus (70) Google Scholar). The elongation factors were expressed and purified as described (19Boon K. Vijgenboom E. Madsen L.V. Talens A. Kraal B. Bosch L. Eur. J. Biochem. 1992; 210: 177-183Crossref PubMed Scopus (54) Google Scholar).AminoacylationTransfer RNAs were aminoacylated by T. aquaticusValRS as described by Liu and Horowitz (3Liu M. Horowitz J. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 10389-10393Crossref PubMed Scopus (17) Google Scholar), using [3H]Val or [14C]Val (Amersham Biosciences) with specific activities of 30,000 and 500 dpm/pmol, respectively. Charging levels were 20–25 pmol of Val/μg of tRNA for in vitrotranscribed tRNA variants and 1.5 pmol of Val/μg of total E. coli tRNA. N-Acetylation of Val-tRNA variants was according to Haenni and Chapeville (21Haenni A.L. Chapeville F. Biochim. Biophys. Acta. 1966; 114: 135-148Crossref PubMed Scopus (222) Google Scholar).In Vitro Poly(GUA)-directed TranslationRibosomes were isolated according to Rodnina and Wintermeyer (22Rodnina M.V. Wintermeyer W. Natl. Acad. Sci. U. S. A. 1995; 92: 1945-1949Crossref PubMed Scopus (161) Google Scholar). In vitro translation assays were carried out in buffer A (20 mm Tris·HCl, pH 7.6, 160 mmNH4Cl, 12 mm MgCl2, 5 mm 2-mercaptoethanol), essentially as described by Gavrilova et al. (23Gavrilova L.P. Kostiashkina O.E. Koteliansky V.E. Rutkevitch N.M Spirin A.S. J. Mol. Biol. 1976; 101: 537-552Crossref PubMed Scopus (194) Google Scholar). Translation initiation complexes (mix R) were prepared by mixing 25 pmol of poly(GUA)44, as mRNA, with 10 pmol of 70 S ribosomes in 15 μl of buffer A and incubating at 37 °C for 10 min. Mix T, which contained (in 20 μl of buffer A) 0–40 pmol of Val-tRNA variant, 10 μg of EF-Tu, 2 μg of EF-G, and 2.5 mm GTP, was incubated for 5 min at 30 °C. In co-translation experiments, mix R contained 0–8 pmol of ribosomes, 1 pmol of [3H]Val-tRNA variant, and 25 pmol of poly(GUA); mix T contained 20 pmol of E. colitRNAbulk, charged with [14C]Val, elongation factors, and GTP as above. If NAcVal-tRNA variants were used to initiate translation, mix R contained 20 pmol of NAc[3H]Val-tRNACCA or NAc[3H]Val-tRNACCG, 10 pmol of ribosomes, and 25 pmol of poly(GUA); mix T contained 0–40 pmol of [14C]Val-tRNA variant, elongation factors, and GTP. Both elongation factors were at saturating concentrations to avoid factor-dependent effects.In all translation experiments, reactions were started by combining mix R with mix T. After a 20-min incubation at 37 °C, the reactions were stopped by the addition of 1.5 ml of 5% trichloroacetic acid, and the samples were heated at 95 °C for 20 min. Precipitates were collected on glass fiber filters, which were dried and counted in a scintillation spectrometer.Dipeptide Synthesis AssayAcceptor and donor activities of Val-tRNA in ribosomal peptide bond formation were analyzed by measuring dipeptide synthesis (in the absence of EF-G) using in vitro transcribed Val-tRNA and NAcVal-tRNA variants. Two mixes were prepared. Mix R, containing (per 30 μl) 25 pmol of poly(GUA)44, 5 pmol of 70 S ribosomes, and 10 pmol of NAc[3H]Val-tRNA in buffer A, was preincubated for 10 min at 37 °C. Mix T, containing (per 20 μl) 0–8 pmol of [14C]Val-tRNA, 220 pmol of EF-Tu, 2.5 mm GTP, 2.5 mm PEP, and 10 units of PEP kinase in buffer A, was preincubated 5 min at 30 °C. Dipeptide bond formation was initiated by combining mix R and mix T. After incubating for 10 min at 37 °C, the reaction was stopped by the addition of NaOH to a final concentration of 0.6 m. Samples were further incubated for 20 min at 37 °C to hydrolyze aminoacyl- and peptidyl-tRNA and 200 μl of 5 n H2SO4 were then added to lower the pH to <1. Finally, 1 ml of ethyl acetate was added with vigorous mixing. At the low pH, free NAc[3H]Val and the dipeptide NAc[3H]Val-[14C]Val are extracted into the organic phase, whereas [14C]Val remains in the water phase. Therefore, [14C] counts in the ethyl acetate phase are a measure of the NAc[3H]Val-[14C]Val formed. Under conditions of the experiment, no trichloroacetic acid-precipitable peptides were found, indicating that longer peptide chains are not formed.TranslocationEF-G-dependent translocation was analyzed according to Watanabe (24Watanabe S. J. Mol. Biol. 1972; 67: 443-547Crossref PubMed Scopus (90) Google Scholar).A- to P-site TranslocationTo assay the effect of G76 on the translocation of tRNA from the ribosomal A-site to the P-site, the ribosomal P- and E-sites were filled with deacylated tRNACCA in the presence of poly(GUA) by incubating 20 μl of mix R, containing 5 pmol of 70 S ribosomes, 25 pmol of poly(GUA)44, 20 pmol of tRNACCA in buffer A (final Mg2+ concentration, 12 mm) at 37 °C. After 10 min, 10 pmol of either NAc[3H]Val-tRNACCA or NAc[3H]Val-tRNACCG, were added and allowed to bind to the ribosomal A-site by incubation at 37 °C for 20 min. The amount of NAc[3H]Val-tRNACCA bound was determined by nitrocellulose filter assay (25Spahn C.M.T. Remme J. Schäfer M. Nierhaus K.H. J. Biol. Chem. 1996; 271: 32849-32856Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). Translocation was promoted by the addition of variable amounts of EF-G (0–2.5 pmol) and 1 mm GTP (final concentration) and incubating for either 10 min at 37 °C or 2 h on ice (final volume, 35 μl). At the end of the incubation period, all tubes were placed on ice. Similar results were obtained when the experiment was performed at 15 or 20 mm Mg2+.The amount of translocation was determined by measuring P-site bound NAc[3H]-Val-tRNACCA or NAc[3H]-Val-tRNACCG with the puromycin reaction. Mixes were incubated in the presence of 1 mmpuromycin at 0 °C for 30 min. The reaction was stopped by the addition of sodium hydroxide (0.6 m final concentration) and incubated 15 min at 37 °C to hydrolyze any remaining aminoacyl-tRNA. After neutralization with 0.2 ml of 1 mpotassium phosphate (pH 7.6) NAc[3H]Val-puromycin was extracted with 1 ml of ethyl acetate. The amount of NAc[3H]Val-puromycin formed was determined by scintillation counting of the ethyl acetate phase.P- to E-site TranslocationThis assay is similar to that of the A- to P-site translocation assay except that the ribosomal P- and E-sites were occupied with either deacylated tRNACCA or deacylated tRNACCG in the presence of poly(GUA) by preincubating 25 μl of mix R (5 pmol of 70 S ribosomes, 25 pmol of poly(GUA)44, 20 pmol of tRNACCA or tRNACCG in buffer A) at 37 °C for 10 min. Subsequently, 10 pmol of NAc[3H]Val-tRNACCA were added and allowed to bind to the ribosomal A-site at 37 °C for 20 min. Translocation was initiated as described for the A- to P-site translocation assay, and the amount of NAc[3H]Val-tRNACCA translocated to the P-site was measured by the puromycin reaction. The A-site tRNA can only go to the P-site after P to E translocation has occurred; thus, if tRNACCG blocks this movement, then A to P translocation cannot occur.DISCUSSIONIn this study, we have examined the functional role of the 3′-terminal nucleotide of tRNAVal in ribosomal translation by comparing the activity of in vitro transcribed wild-type tRNAVal (A76) with that of the G76 mutant in translation of the cognate (GUA) codon and in individual steps of the polypeptide elongation cycle. Our results show that the G76 Val-tRNAVal mutant is completely inactive in poly(GUA)-directed translation when present alone (Fig. 1), suggesting that the A76G mutation affects a step in polypeptide synthesis on the ribosome. Co-translation experiments, carried out in the presence of excess native (A76) tRNAVal, demonstrate that the mutant tRNACCG can function in poly(GUA)-directed translation although with reduced efficiency (Fig. 2 A).To identify the step affected by the G76 mutation, each phase of the polypeptide elongation cycle was individually investigated. Studies of the activity of tRNACCG in dipeptide synthesis show that the G76 mutation does not significantly affect the acceptor activity of Val-tRNA in the peptidyltransferase reaction (Fig. 4 A). Substitutions in the CCA sequence have also been shown to have only small effects on the acceptor activity of aminoacyl-oligonucleotides in the peptidyl transfer reaction (8Tezuka M. Chladek S. Biochemistry. 1990; 29: 667-670Crossref PubMed Scopus (10) Google Scholar).In contrast, the donor activity of NAcVal-tRNACCG is reduced by 20–30% compared with that of NAcVal-tRNACCA in both poly(GUA)-directed translation (Fig. 3) and in the dipeptide synthesis assay (Fig. 4 B). Evidently, the identity of the 3′-nucleotide of tRNA is more important at the donor site and less important at the acceptor site of the ribosomal peptidyltransferase center. Crystallographic data of aminoacyl- and peptidyl-tRNA analogs bound to Haloarcula marismortui 50 S ribosomes (7Nissen P. Hansen J. Ban N. Moore P.B. Steitz T.A. Science. 2000; 289: 920-930Crossref PubMed Scopus (1736) Google Scholar) indicate that N-1 of A76 of the tRNA at the donor site acts as a hydrogen bond acceptor from the 2′-OH of A2450 of the 23 S rRNA and the base stacks on the ribose of A2451. A guanine at position 76 of tRNA can still stack efficiently on the ribose of A2451 but will have difficulty forming the appropriate hydrogen bonds with the 2′-OH group of A2450because its N-1 is protonated, unlike that of A76. This may account for the reduced donor activity of the G76 variant of tRNAVal at the peptidyl transfer center.It has been proposed that binding of tRNA to the E-site promotes movement of the tRNA-mRNA complex with respect to the ribosome (15Lill R. Robertson J.M. Wintermeyer W. EMBO J. 1989; 8: 3933-3938Crossref PubMed Scopus (108) Google Scholar). The removal or substitution of A76 decreases the affinity of the ribosomal E-site for tRNA at least 100-fold (15Lill R. Robertson J.M. Wintermeyer W. EMBO J. 1989; 8: 3933-3938Crossref PubMed Scopus (108) Google Scholar, 32Grajevskaja R.A. Ivanov Y.V. Saminski E.M. Eur. J. Biochem. 1982; 128: 47-52Crossref PubMed Scopus (83) Google Scholar,35Boccheta M. Xiong L. Shah S. Mankin A.S. RNA. 2001; 7: 54-63Crossref PubMed Scopus (19) Google Scholar). Failure of the G76 mutant of tRNAVal to translate poly(GUA) may be due to the inability of the G76mutant to bind correctly to the E-site, thus blocking movement of tRNA from the P- to the E-site. Our results, however, reveal that the A76G mutation does not interfere with the translocation of tRNA from the P-site to the E-site (Fig. 6 B). In this connection, it is interesting to note that the 3′-end of deacylated tRNA that is formed after transpeptidation does not immediately progress to the E-site but remains temporarily at the peptidyltransferase center, as shown by recent cross-linking experiments (6Wower J. Kirillov S.V. Wower I.K. Guven S. Hixon S.S. Zimmermann R.A. J. Biol. Chem. 2000; 275: 37887-37894Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar). It is possible that the G76 tRNAVal mutant can dissociate from ribosomal P-site without stably binding to the E-site.The most striking result of the A76 to G76substitution in tRNAVal is the nearly complete inhibition of A- to P-site tRNA translocation. The experiments presented in Fig. 5clearly demonstrate that translocation of the peptidyl-tRNA analog, NAc[3H]Val-tRNA, from the A- to the P-site is severely inhibited by the A76G mutation, thus accounting for the inability of the G76 mutant of tRNAVal to translate poly(GUA). This result is in contrast to the ability of the G76 mutant of tRNAVal to bind to both the A- and the P-sites, as inferred from its activity both as an acceptor and a donor in peptide bond formation (Fig. 4). According to the hybrid state model, the 3′-end of tRNA moves concomitantly with peptide bond formation from the acceptor to the donor site leading to the P/A hybrid state (36Moazed D. Noller H.F. Nature. 1989; 342: 142-148Crossref PubMed Scopus (606) Google Scholar). This movement and the related conformational changes (37Yusupov M.M. Yusupova G.Zh. Baucom A. Lieberman K. Earnest T.N. Cate J.H.D. Noller H.F. Science. 2001; 292: 883-896Crossref PubMed Scopus (1649) Google Scholar) are expected to depend on correct interaction between the CCA end of tRNA and 23 S rRNA. The affinity of aminoacyl-oligonucleotides for the ribosomal donor site is higher by 1 order of magnitude compared with the acceptor site (38Streltsov S. Kosenjuk A. Kukhanova M. Krayevsky A. Gottikh B. FEBS Lett. 1979; 104: 279-283Crossref PubMed Scopus (5) Google Scholar, 39Bourd S.B. Kukhanova M.K. Gottikh B.P. Krayevsky A.A. Eur. J. Biochem. 1983; 135: 465-470Crossref PubMed Scopus (12) Google Scholar). This affinity gradient can be essential for movement of the CCA end of peptidyl-tRNA during translocation (40Leder P. Adv. Protein Chem. 1973; 27: 213-242Crossref PubMed Scopus (39) Google Scholar). If the G76 variant of peptidyl-tRNA does not bind correctly to the ribosomal donor site, as implied by its reduced donor activity (Figs. 3 and 4 B), it can affect movement of the CCA end of tRNA and thereby inhibit translocation. On the other hand, it is possible that A76 of peptidyl-tRNA is specifically recognized by 23 S rRNA or a ribosomal protein during the translocation reaction. One candidate for such recognition is nucleotide A2602, which is disordered in the empty 50 S subunit and becomes positioned between the CCA bound at the A-site and the CCA bound at the P-site after tRNA binding (7Nissen P. Hansen J. Ban N. Moore P.B. Steitz T.A. Science. 2000; 289: 920-930Crossref PubMed Scopus (1736) Google Scholar). A second candidate is ribosomal protein L27, which can be cross-linked to A76 at both the A- and the P-sites (41Wower J. Wower I.K. Kirillov S. Rosen K. Hixon S.S. Zimmermann R.A. Biochem. Cell Biol. 1995; 73: 1041-1047Crossref PubMed Scopus (32) Google Scholar).Feinberg and Joseph have recently identified two 2′-OH groups, at positions 71 and 76, which are required for tRNA translocation from the P- to the E-site (42Feinberg J.S. Joseph S. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 11120-11125Crossref PubMed Scopus (81) Google Scholar). This result is in agreement with the finding that 2′-deoxy-A76-substituted tRNA inhibits ribosomal translocation (43Wagner T. Sprinzl M. Biochemistry. 1983; 22: 94-98Crossref PubMed Scopus (24) Google Scholar). We have shown that the adenosine at position 76 of tRNA is essential for translocation from the A- to the P-site (Fig. 5). The importance of specific functional groups of tRNA for movement from the A-site to the P-site and from the P-site to the E-site suggests an active ribosomal mechanism for translocation, with essential transient interactions between tRNA and the ribosome. The 3′-CCA sequence of tRNA is a universal ligand for protein biosynthesis; it is recognized by aminoacyl-tRNA synthetases, EF-Tu, and 23 S rRNA (1Chladek S. Sprinzl M. Angew. Chem. Int. Ed. Eng. 1985; 24: 371-391Crossref Scopus (62) Google Scholar, 2Green R. Noller H.F. Annu. Rev. Biochem. 1997; 66: 679-716Crossref PubMed Scopus (420) Google Scholar). Experiments using in vitro transcribed tRNAVal variants demonstrated the importance of the 3′-CCA sequence for aminoacylation (3Liu M. Horowitz J. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 10389-10393Crossref PubMed Scopus (17) Google Scholar, 4Tamura K. Nobukazu N. Tsunemi H. Shimizu M. Himeno H. J. Biol. Chem. 1994; 269: 22173-22177Abstract Full Text PDF PubMed Google Scholar) and its significance in formation of the ternary complex between Val-tRNA, EF-Tu, and GTP (5Liu J. Liu M. Horowitz J. RNA. 1998; 4: 639-646Crossref PubMed Scopus (18) Google Scholar). On ribosomes, the CCA end of tRNA interacts with 23 S rRNA at all ribosomal tRNA binding sites (6Wower J. Kirillov S.V. Wower I.K. Guven S. Hixon S.S. Zimmermann R.A. J. Biol. Chem. 2000; 275: 37887-37894Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar). The importance of the CCA end in ribosome-catalyzed peptide bond formation is well established (1Chladek S. Sprinzl M. Angew. Chem. Int. Ed. Eng. 1985; 24: 371-391Crossref Scopus (62) Google Scholar, 7Nissen P. Hansen J. Ban N. Moore P.B. Steitz T.A. Science. 2000; 289: 920-930Crossref PubMed Scopus (1736) Google Scholar). Chemically synthesized aminoacyl oligonucleotides were used to demonstrate the significance of the 3′-CCA sequence as a peptide acceptor during peptide bond formation on ribosomes (8Tezuka M. Chladek S. Biochemistry. 1990; 29: 667-670Crossref PubMed Scopus (10) Google Scholar). E. colitRNAVal with mutations in the 3′-CCA sequence inhibits the peptidyltransferase activity of the ribosome (9Tamura K. FEBS Lett. 1994; 353: 173-176Crossref PubMed Scopus (14) Google Scholar). These findings were rationalized by showing functional base pairing of C74 with G2252 of 23 S rRNA at the donor site of the ribosomal peptidyltransferase center (10Samaha R.R. Green R. Noller H.F. Nature. 1995; 377: 309-314Crossref PubMed Scopus (203) Google Scholar) and of C75 with G2553 at the acceptor site (11Green R. Switzer C. Noller H.F. Science. 1998; 280: 286-289Crossref PubMed Scopus (74) Google Scholar, 12Kim D.F. Green R. Mol Cell. 1999; 4: 859-864Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar, 13Khaitovich P. Mankin A. Garrett R.A. Douthwaite S.R. Liljas A. Matheson A.T. Moore P.B. Noller H.F. The Ribosome: Structure, Function, Antibiotics, and Cellular Interaction. American Society for Microbiology Press, Washington, D. C.2000: 229-244Google Scholar). Mutation of C74 to U74 in tRNAHisderepresses the histidine biosynthetic operon of Salmonella typhimurium (14O'Connor M. Willis N.M. Bossi L. Gesteland R.F. Atkins J.F. EMBO J. 1993; 12: 2559-2566Crossref PubMed Scopus (46) Google Scholar). Mutants of Escherichia coli tRNA1Val with 3′-GCA or 3′-ACA promote −1 frameshifting and suppress a wide variety of nonsense mutants (14O'Connor M. Willis N.M. Bossi L. Gesteland R.F. Atkins J.F. EMBO J. 1993; 12: 2559-2566Crossref PubMed Scopus (46) Google Scholar). It has also been proposed that substitution of the A76 of tRNA affects binding of deacylated tRNA to the ribosomal E-site (15Lill R. Robertson J.M. Wintermeyer W. EMBO J. 1989; 8: 3933-3938Crossref PubMed Scopus (108) Google Scholar). These findings show the importance of the 3′-CCA end of tRNA in maintaining the reading frame during translation and suggest that the 3′-CCA end is involved in ribosomal translocation. In this paper, we analyze the functional importance of the 3′-terminal A of tRNA for ribosomal translation. The results show that substitution of the 3′ A of tRNAVal with G blocks translocation of peptidyl-tRNA from the ribosomal A-site to the P-site and inhibits the peptidyl transfer reaction at the ribosomal donor (P) site. MATERIALS AND METHODSPreparation of tRNAs, Poly(GUA), and EnzymesTransfer RNAVal (anticodon UAC) was synthesizedin vitro by T7 RNA polymerase-catalyzed run-off transcription from the phagemid pFVAL119 linearized by FokI (A76) or from pFVALG76 linearized by MspI (16Liu M. Horowitz J. BioTechniques. 1993; 15: 264-266PubMed Google Scholar). This method was shown to produce the expected nucleotide at the 3′-terminus (17Chu W.-C. Horowitz J. Nucleic Acids Res. 1989; 17: 7241-7252Crossref PubMed Scopus (62) Google Scholar). tRNAVal variants were purified by size exclusion chromatography on Sephadex G-50 and gel electrophoresis in 7% urea-PAGE. Total E. coli tRNA was from Roche Molecular Biochemicals. tRNAs are designated as follows: tRNACCA(in vitro transcribed wild-type tRNAVal), tRNACCG (in vitro transcribed tRNAVal with the mutation A76G), tRNAbulk(total (unfractionated) E. coli tRNA), and tRNAVal (purified isoacceptors of valine-specific E. coli tRNA). 1 μg of tRNAVal was taken as equal to 40 pmol.DNA encoding the sequence poly(GTA)44 was the kind gift of Dr. T. Tenson (University of Tartu). The poly(GTA)44 was amplified by PCR and cloned under the control of the T7 late promoter in pLITMUS38 between the ApaI and EcoRV sites. The plasmid was cleaved by BspTI, and poly(GUA)44 was prepared by in vitrotranscription with T7 RNA polymerase. Poly(GUA) mRNA has the sequence 5′-GGCCCGUAGA(GUA)44. Transcripts were purified by gel filtration chromatography on Sephadex G-50. 1 μg of poly(GUA)44 was taken as equal to 25 pmol.T7 RNA polymerase was purified as described by Davanloo et al. (18Davanloo P. Rosenberg A.H. Dunn J.J. Studier F.W. Proc. Natl. Acad. Sci. U. S. A. 1984; 81: 2035-20399Crossref PubMed Scopus (724) Google Scholar) from E. coli strain BL21(DE-3)/pAR1219 (kindly provided by W. Studier, Brookhaven National Laboratory, U" @default.
• W2077099521 created "2016-06-24" @default.
• W2077099521 creator A5001333873 @default.
• W2077099521 creator A5014180740 @default.
• W2077099521 creator A5041640855 @default.
• W2077099521 creator A5085064376 @default.
• W2077099521 date "2002-07-01" @default.
• W2077099521 modified "2023-09-30" @default.
• W2077099521 title "Functional Importance of the 3′-Terminal Adenosine of tRNA in Ribosomal Translation" @default.
• W2077099521 cites W14529041 @default.
• W2077099521 cites W1488258975 @default.
• W2077099521 cites W1493141363 @default.
• W2077099521 cites W1970107043 @default.
• W2077099521 cites W1973069142 @default.
• W2077099521 cites W1975455557 @default.
• W2077099521 cites W1976328208 @default.
• W2077099521 cites W1977540769 @default.
• W2077099521 cites W1980365471 @default.
• W2077099521 cites W1983700089 @default.
• W2077099521 cites W1984316935 @default.
• W2077099521 cites W1994663143 @default.
• W2077099521 cites W1995370135 @default.
• W2077099521 cites W2009393529 @default.
• W2077099521 cites W201174390 @default.
• W2077099521 cites W2013303604 @default.
• W2077099521 cites W2021012126 @default.
• W2077099521 cites W2034195538 @default.
• W2077099521 cites W2035935848 @default.
• W2077099521 cites W2049193281 @default.
• W2077099521 cites W2052163027 @default.
• W2077099521 cites W2053502733 @default.
• W2077099521 cites W2053524548 @default.
• W2077099521 cites W2062714158 @default.
• W2077099521 cites W2064521337 @default.
• W2077099521 cites W2069805299 @default.
• W2077099521 cites W2076608975 @default.
• W2077099521 cites W2078884107 @default.
• W2077099521 cites W2089457247 @default.
• W2077099521 cites W2092718501 @default.
• W2077099521 cites W2093091879 @default.
• W2077099521 cites W2093471887 @default.
• W2077099521 cites W2097654784 @default.
• W2077099521 cites W2113599367 @default.
• W2077099521 cites W2113761741 @default.
• W2077099521 cites W2127112464 @default.
• W2077099521 cites W2198612891 @default.
• W2077099521 cites W2237577072 @default.
• W2077099521 cites W4211217678 @default.
• W2077099521 cites W4212901177 @default.
• W2077099521 doi "https://doi.org/10.1074/jbc.m200393200" @default.
• W2077099521 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11967262" @default.
• W2077099521 hasPublicationYear "2002" @default.
• W2077099521 type Work @default.
• W2077099521 sameAs 2077099521 @default.
• W2077099521 citedByCount "12" @default.
• W2077099521 countsByYear W20770995212013 @default.
• W2077099521 countsByYear W20770995212017 @default.
• W2077099521 crossrefType "journal-article" @default.
• W2077099521 hasAuthorship W2077099521A5001333873 @default.
• W2077099521 hasAuthorship W2077099521A5014180740 @default.
• W2077099521 hasAuthorship W2077099521A5041640855 @default.
• W2077099521 hasAuthorship W2077099521A5085064376 @default.
• W2077099521 hasBestOaLocation W20770995211 @default.
• W2077099521 hasConcept C104317684 @default.
• W2077099521 hasConcept C105580179 @default.
• W2077099521 hasConcept C149364088 @default.
• W2077099521 hasConcept C153957851 @default.
• W2077099521 hasConcept C185592680 @default.
• W2077099521 hasConcept C2776991684 @default.
• W2077099521 hasConcept C2779664074 @default.
• W2077099521 hasConcept C41008148 @default.
• W2077099521 hasConcept C55493867 @default.
• W2077099521 hasConcept C67705224 @default.
• W2077099521 hasConcept C67905577 @default.
• W2077099521 hasConcept C76155785 @default.
• W2077099521 hasConcept C86803240 @default.
• W2077099521 hasConcept C88478588 @default.
• W2077099521 hasConceptScore W2077099521C104317684 @default.
• W2077099521 hasConceptScore W2077099521C105580179 @default.
• W2077099521 hasConceptScore W2077099521C149364088 @default.
• W2077099521 hasConceptScore W2077099521C153957851 @default.
• W2077099521 hasConceptScore W2077099521C185592680 @default.
• W2077099521 hasConceptScore W2077099521C2776991684 @default.
• W2077099521 hasConceptScore W2077099521C2779664074 @default.
• W2077099521 hasConceptScore W2077099521C41008148 @default.
• W2077099521 hasConceptScore W2077099521C55493867 @default.
• W2077099521 hasConceptScore W2077099521C67705224 @default.
• W2077099521 hasConceptScore W2077099521C67905577 @default.
• W2077099521 hasConceptScore W2077099521C76155785 @default.
• W2077099521 hasConceptScore W2077099521C86803240 @default.
• W2077099521 hasConceptScore W2077099521C88478588 @default.
• W2077099521 hasIssue "27" @default.
• W2077099521 hasLocation W20770995211 @default.
• W2077099521 hasOpenAccess W2077099521 @default.
• W2077099521 hasPrimaryLocation W20770995211 @default.
• W2077099521 hasRelatedWork W1498843405 @default.
• W2077099521 hasRelatedWork W1531511568 @default.
• W2077099521 hasRelatedWork W172930038 @default.

• next