FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2077514227> ?p ?o ?g. }

• W2077514227 endingPage "21383" @default.
• W2077514227 startingPage "21376" @default.
• W2077514227 abstract "Previous studies implicate cyclin-dependent kinase 5 in cell adhesion and migration of epithelial cells of the cornea and lens. To explore molecular interactions underlying these functions, we performed yeast two-hybrid screening of an embryonic rat lens library for proteins that interact with cyclin-dependent kinase 5 and its regulators, p35 and p39. This screen identified a specific interaction between p39 and muskelin, an intracellular protein known to affect cytoskeletal organization in adherent cells. Immunohistochemistry detected muskelin in the developing lens and in other tissues, including brain and muscle. Glutathione S-transferase pull-down experiments and co-immunoprecipitations confirmed the specificity of the p39-muskelin interaction. Deletion analysis of p39 showed that muskelin binds to the p39 C terminus, which contains a short insertion (amino acids 329–366) absent from p35. Similar analysis of muskelin mapped the interaction with p39 to the fifth kelch repeat. Co-expression of p39 and muskelin in COS1 cells or lens epithelial cells altered the intracellular localization of muskelin, recruiting it to the cell periphery. These findings demonstrate a novel interaction between muskelin and the cyclin-dependent kinase 5 activator p39 and suggest that p39 may regulate the subcellular localization of muskelin. Previous studies implicate cyclin-dependent kinase 5 in cell adhesion and migration of epithelial cells of the cornea and lens. To explore molecular interactions underlying these functions, we performed yeast two-hybrid screening of an embryonic rat lens library for proteins that interact with cyclin-dependent kinase 5 and its regulators, p35 and p39. This screen identified a specific interaction between p39 and muskelin, an intracellular protein known to affect cytoskeletal organization in adherent cells. Immunohistochemistry detected muskelin in the developing lens and in other tissues, including brain and muscle. Glutathione S-transferase pull-down experiments and co-immunoprecipitations confirmed the specificity of the p39-muskelin interaction. Deletion analysis of p39 showed that muskelin binds to the p39 C terminus, which contains a short insertion (amino acids 329–366) absent from p35. Similar analysis of muskelin mapped the interaction with p39 to the fifth kelch repeat. Co-expression of p39 and muskelin in COS1 cells or lens epithelial cells altered the intracellular localization of muskelin, recruiting it to the cell periphery. These findings demonstrate a novel interaction between muskelin and the cyclin-dependent kinase 5 activator p39 and suggest that p39 may regulate the subcellular localization of muskelin. Cyclin-dependent kinase 5 (Cdk5) 1The abbreviations used are: Cdk, cyclin-dependent kinase; EGFP (ECFP, EYFP), enhanced green (cyan, yellow) fluorescent protein; RT, reverse transcription; KREP, kelch repeat; GST, glutathione S-transferase; PBS, phosphate-buffered saline; LisH, Lissencephaly homology; CTLH, C-terminal to Lissencephaly homology; E18, embryonic day 18; BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol.1The abbreviations used are: Cdk, cyclin-dependent kinase; EGFP (ECFP, EYFP), enhanced green (cyan, yellow) fluorescent protein; RT, reverse transcription; KREP, kelch repeat; GST, glutathione S-transferase; PBS, phosphate-buffered saline; LisH, Lissencephaly homology; CTLH, C-terminal to Lissencephaly homology; E18, embryonic day 18; BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol. is a unique member of the cyclin-dependent kinase family. Unlike other cyclin-dependent kinases, its cellular functions are not related to the regulation of cell cycle progression (1Lew J. Beaudette K. Litwin C.M. Wang J.H. J. Biol. Chem. 1992; 267: 13383-13390Abstract Full Text PDF PubMed Google Scholar), and its activation requires a regulatory protein (either p35 or p39) that is not a member of the cyclin family. Cdk5 expression is widespread, but its kinase activity is found predominantly in the central nervous system where its activators, p35 and p39, are most abundant (2Dhavan R. Tsai L.H. Nat. Rev. Mol. Cell. Biol. 2001; 2: 749-759Crossref PubMed Scopus (938) Google Scholar). Nonetheless expression of these activating proteins and low levels of Cdk5 kinase activity have been demonstrated in a wide variety of other cell types, including lens (3Gao C.Y. Zakeri Z. Zhu Y. He H.Y. Zelenka P.S. Dev. Genet. 1997; 20: 267-275Crossref PubMed Scopus (68) Google Scholar), embryonic limb buds (4Zhang Q. Ahuja H.S. Zakeri Z.F. Wolgemuth D.J. Dev. Biol. 1997; 183: 222-233Crossref PubMed Scopus (90) Google Scholar), monocytes (5Chen F. Studzinski G.P. Blood. 2001; 97: 3763-3767Crossref PubMed Scopus (40) Google Scholar), and osteosarcomas and breast carcinomas (6Alexander K. Yang H.S. Hinds P.W. Mol. Cell. Biol. 2004; 24: 2808-2819Crossref PubMed Scopus (55) Google Scholar). A number of observations suggest that cytoskeletal regulation may be a major function of Cdk5 in both neuronal and non-neuronal cells. For example, p39 is known to associate with the actin cytoskeleton (7Humbert S. Dhavan R. Tsai L. J. Cell Sci. 2000; 113: 975-983Crossref PubMed Google Scholar). The known substrates of Cdk5/p35 include cytoskeletal proteins such as neurofilament proteins (8Lew J. Winkfein R.J. Paudel H.K. Wang J.H. J. Biol. Chem. 1992; 267: 25922-25926Abstract Full Text PDF PubMed Google Scholar) and the microtubule-associated protein tau (9Ishiguro K.S. Kobayashi S. Omore A. Takamatsu S. Yonekura K. Anzai K. Imahori K. Uchida T. FEBS Lett. 1994; 342: 203-208Crossref PubMed Scopus (148) Google Scholar) as well as enzymes that regulate cytoskeletal organization such as Pak-1 (10Rashid T. Banerjee M. Nikolic M. J. Biol. Chem. 2001; 276: 49043-49052Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar, 11Nikolic M. Chou M.M. Lu W. Mayer B.J. Tsai L.H. Nature. 1998; 395: 194-198Crossref PubMed Scopus (350) Google Scholar) and c-Src (12Kato G. Maeda S. J. Biochem. (Tokyo). 1999; 126: 957-961Crossref PubMed Scopus (35) Google Scholar). In addition, the Cdk5 activators p35 and p39 have been shown to interact with α-actinin and Ca2+/calmodulin-dependent protein kinase II (13Dhavan R. Greer P.L. Morabito M.A. Orlando L.R. Tsai L.H. J. Neurosci. 2002; 22: 7879-7891Crossref PubMed Google Scholar), both of which have important roles in cytoskeletal organization. Finally several studies have reported that changes in Cdk5 activity affect cytoskeletal functions such as cell motility and adhesion. For example, loss of Cdk5 activity inhibits neurite extension (14Nikolic M. Dudek H. Kwon Y.T. Ramos Y.F. Tsai L.-H. Genes Dev. 1996; 10: 816-825Crossref PubMed Scopus (529) Google Scholar) and blocks neuronal migration during embryogenesis (15Ohshima T. Ward J.M. Huh C.G. Longenecker G. Veeranna Pant H.C. Brady R.O. Martin L.J. Kulkarni A.B. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 11173-11178Crossref PubMed Scopus (806) Google Scholar, 16Chae T. Kwon Y.T. Bronson R.T. Dikkes P. Li E. Tsai L.H. Neuron. 1997; 18: 29-42Abstract Full Text Full Text PDF PubMed Scopus (662) Google Scholar, 17Gilmore E.C. Ohshima T. Goffinet A.M. Kulkarni A.B. Herrup K. J. Neurosci. 1998; 18: 6370-6377Crossref PubMed Google Scholar, 18Tanaka T. Verranna Ohshima T. Rajan P. Amin N.D. Cho A. Sreenath T. Pant H.C. Brady R.O. Kulkarni A.B. J. Neurosci. 2001; 21: 550-558Crossref PubMed Google Scholar), whereas increases in Cdk5 activity increase substrate adhesion and retard migration in the epithelial cells of the cornea (19Gao C. Negash S. Guo H.T. Ledee D. Wang H.S. Zelenka P.S. Mol. Cancer Res. 2002; 1: 12-24PubMed Google Scholar, 20Gao C.Y. Stepp M.A. Fariss R. Zelenka P.S. J. Cell Sci. 2004; 117: 4089-4098Crossref PubMed Scopus (41) Google Scholar) and lens (21Negash S. Wang H.S. Gao C. Ledee D. Zelenka P. J. Cell Sci. 2002; 115: 2109-2117Crossref PubMed Google Scholar). It is not clear at present whether the same molecular mechanisms are responsible for the effects of Cdk5 in neuronal and non-neuronal cells. The wide variety of Cdk5 substrates and the likelihood that different subsets are expressed in different cell types raises the possibility that Cdk5 may exert its effects on adhesion and movement in various ways. To explore this possibility, we searched for novel interacting partners of Cdk5, p35, and/or p39 by yeast two-hybrid screening of an embryonic rat lens library. The results demonstrated that p39 interacts specifically with the kelch domain protein muskelin. Kelch domains are structural repeats first observed in the Drosophila actin cross-linking protein Kelch that permit proteins to fold into a cylindrical, “β-propeller structure” (22Adams J. Kelso R. Cooley L. Trends Cell Biol. 2000; 10: 17-24Abstract Full Text Full Text PDF PubMed Scopus (477) Google Scholar). Although several kelch domain proteins are also actin-binding proteins (22Adams J. Kelso R. Cooley L. Trends Cell Biol. 2000; 10: 17-24Abstract Full Text Full Text PDF PubMed Scopus (477) Google Scholar), muskelin does not bind directly to either actin or tubulin (23Prag S. Collett G.D.M. Adams J.C. Biochem. J. 2004; 381: 547-559Crossref PubMed Scopus (19) Google Scholar). It is, however, associated with the actin cytoskeleton and has multiple effects on cell adhesion and cytoskeletal structure in adherent cells (24Adams J.C. Seed B. Lawler J. EMBO J. 1998; 17: 4964-4974Crossref PubMed Scopus (73) Google Scholar). Yeast Two-hybrid Bait and Library Construction—The entire p39 cDNA was cloned into pBD-GAL4 Cam phagemid vector (Stratagene, La Jolla, CA). The embryonic (E18) rat lens cDNA library was constructed using 5 μg of poly(A)+ RNA cloned into hybriZAP-2.1 vector following the manufacturer's instruction (HybriZAP-2.1 XR library construction kit and HybriZAP-2.1 XR cDNA synthesis kit; Stratagene). The primary library contained 2 × 107 plaque-forming units with an average insert length of 1 kb. Excision and amplification of the library was performed as detailed by Stratagene. Yeast Two-hybrid Screening—YRG2 competent yeast cells were transfected with p39 bait to create a stable cell line. The YRG2/p39 yeast cells were transfected with 40 μg of library cDNA, and selection was performed on His-/Leu-/Trp- medium. All positive clones were further analyzed via filter lift assay screening for lacZ expression. Filter lift assays were performed by transferring colonies growing on His-/Leu-/Trp- SD plates (2.67% Difco™ yeast nitrogen base without amino acids (BD Biosciences, Franklin Lakes, NJ), 1 m sorbitol, 2% agar) to nitrocellulose filters, lysing cells by repetitive freeze-thaw cycles, and incubating with the β-galactosidase substrate, 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-gal) according to the manufacturer's protocol (Stratagene). Plasmids from positive yeast colonies were isolated by mechanical lysis. Briefly a single yeast colony was grown overnight in 2 ml of YAPD medium (2% Difco™ peptone (BD Biosciences), 1% yeast extract, 2% agar, 0.1 mm adenine sulfate, pH 5.8) at 30 °C. The yeast was centrifuged and lysed in 0.2 ml of yeast lysis buffer (2% Triton X-100, 1% SDS, 0.1 m NaCl, 10 mm Tris-HCl (pH 8.0), 1 mm EDTA), 0.2 ml phenolchloroform-isoamyl alcohol, and 0.3 g of acid-washed glass beads. The plasmid was precipitated with sodium acetate and ethanol and transformed into XLI-Blue MRF′ competent cells. Target or bait plasmids were selected on LB-ampicillin or LB-chloramphenicol agar plates, respectively. The resulting bacterial clones were screened by restriction digest analysis and sequencing. Sequencing was performed using the CEQ dye terminator cycle sequencing (DTCS) quick start kit (Beckman Coulter). Cell Culture and Transfection—The rabbit lens epithelial cell line (N/N1003A) and COS1 monkey kidney epithelial cells were cultured at 37 °C in a humidified atmosphere of 95% air and 5% CO2 in Dulbecco's minimum essential medium (Invitrogen) supplemented with 8% rabbit serum, 50 μg/m gentamicin for N/N1003 cells or 10% fetal calf serum (Invitrogen), 100 mg/ml penicillin/streptomycin (Invitrogen) for COS1 cells. N/N1003 cells were transiently transfected with Myc-muskelin and EGFP-p39 using Lipofectamine (Invitrogen); COS1 cells were transiently transfected with ECFP-muskelin and EYFP-p39 using FuGENE 6 (Roche Diagnostics). Both cell lines were harvested 72 h following transfection. Stable lines of COS1 cells overexpressing p35 or p39 were obtained by calcium phosphate precipitation (25Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Chanda V.B. Current Protocols in Molecular Biology. 2. John Wiley & Sons, Inc., New York1998: 9.1.1-9.1.6Google Scholar) using 10 μg of pcDNA3.1/HisCp39 or pcDNA3.1/HisCp35 plasmid DNA followed by selection for neomycin resistance with G418 at a concentration of 600 mg/ml after 3 days. cDNA Constructs—A full-length muskelin cDNA was generated by PCR with primers designed to reintroduce the ATG and six additional nucleotides using the pAD-GAL4–2.1-muskelin plasmid as template. The PCR products were then cloned into pGEX-4T-1 (Amersham Biosciences), pET-28a (Novagen), and pECFP-C1 and pCMV-Myc (Clontech Laboratories, Inc.) at the EcoRI and XhoI sites. The GST-muskelin truncation clones were generated by PCR using pET28a-muskelin as the template followed by cloning of the PCR products into pGEX-4T-1 at the EcoRI and XhoI sites. The oligonucleotides used to generate the truncations were: Δ6 KREP, 5′-GGCGCC(CTCGAG)TCAAACCTTGTGTAATTCATCATA-3′ (nucleotides 1771–1791); Δ5–6 KREP, 5′-GGCGCC(CTCGAG)TCATTCATTCAGTTCTGGATCAA-3 (nucleotides 1558–1578); Δ4–6 KREP, 5′-GGCGCC(CTCGAG)TCAACAACGGTTTTTCGAGTGGAACAG-3′ (nucleotides 1384–1407); Δ3–6 KREP, 5′-GGCGCC(CTCGAG)TCACATATGCTTTTCTGAGTCCA-3′ (nucleotides 1181–1200); Δ2–6 KREP, 5′-GGCGCC(CTCGAG)TCAGATTTGTCTCCGCTGAATATC-3′ (nucleotides 999–1020); Δ1–6 KREP, 5′-GGCGCC(CTCGAG)TCAAGTCTCTGTCTGAACATCAA-3′ (nucleotides 833–852); ΔLis. 5′-CCCGGG(GAATTC)CATCCAATGTTGACAGATATG-3′ (nucleotides 616–636). Numbers in parentheses are nucleotide positions taken from the GenBank entry for rat muskelin (NM_031359). To generate the construct containing two kelch 6 regions we substituted the intrablade loop between the β2 and β3 blades of the fifth kelch repeat with the intrablade loop of the sixth kelch repeat as predicted by the kelch repeat folding pattern (22Adams J. Kelso R. Cooley L. Trends Cell Biol. 2000; 10: 17-24Abstract Full Text Full Text PDF PubMed Scopus (477) Google Scholar, 26Prag S. Adams J.C. BMC Bioinformatics. 2003; 4: 42Crossref PubMed Scopus (130) Google Scholar). The oligonucleotides used were: KREP5–6 (upstream), 5′-AGAGCAAGACTTTCCTGGATTTCCGGATAAAACATGTATTTCATT-3′; KREP5–6 (downstream), 5′-CCAAAGATGAGACTAGATGACTTCTGGATTTATGACATTGTGAGG-3′. The construct was made using the ExSite PCR-based site-directed mutagenesis kit (Stratagene) according to the manufacturer's instructions. To make the histidine-tagged p39, the p39 reading frame (XhoI/XbaI) fragment was PCR-amplified from a p39 clone (27Xiong W. Pestell R. Rosner M.R. Mol. Cell. Biol. 1997; 17: 6585-6597Crossref PubMed Scopus (61) Google Scholar). PCR primers were: upstream, 5′-ACGCGTCTCGAGGGCACAGTGCTGTCTCTTTCGCCTGCCTCC-3′; downstream, 5′-AGCATTTCTAGACCCCTGGGTATCCCTAGCGGTCCAGGTTCATAGTCC-3′. The p39 PCR fragment and pcDNA3.1/His (C) vector (Invitrogen) were then digested with XhoI and XbaI. The digested p39 fragment was ligated into the pcDNA3.1/His (C) vector C-terminal to the histidine tag and in the reading frame (confirmed by PCR sequencing). The p39 truncated clone was cloned into pET15b at the NdeI and XhoI sites. The primers used were 5′-ATTCCCGGG(CATATG)GGCACAGTGCTGTCTCTTTCGCCTGCCTCC-3′ and 5′-CCGGCC(CTCGAG)CATCTCGTTCTTGAGGTCTTGAAAG-3′. To generate EGFP-p39 and EYFP-p39 fusion proteins, the full-length p39 cDNA was cloned into EcoRI/SalI sites of the pEGFP-C1 or pEYFP-C1 vectors starting at the second codon of p39 using the pCDNA3.1-p39 clone as the template. The primers used were: upstream, GGCTTC(GAATTC)TGGCACAGTGCTGTCTCTTTCGCCTGCCTCC (EcoRI); downstream, CGGCGG(GTCGAC)CCCCTGGGTATCCCTAGCGGTCCAGGTTCA (SalI). Antibodies—Peptides corresponding to the C terminus of muskelin (GNLVDLITL) and the N terminus of p39 (KGRRPGGLPEE) were used for polyclonal antibody production in rabbits (Harlan). The IgG fraction was purified from the resulting antisera using protein A-agarose beads (Pierce), and the p39 antibody was further purified by affinity chromatography against the antigenic peptide covalently coupled to agarose beads as a secondary amine using the AminoLink™ kit and AminoLink coupling gel (Pierce). Anti-Cdk5 polyclonal antibody and agarose-conjugated anti-histidine monoclonal antibody were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-Myc polyclonal antibody was purchased from Cell Signaling Technology (Beverly, MA). Immunoprecipitation and Immunoblotting—For analysis of endogenous expression of muskelin protein cells were lysed in PBSTDS buffer (1× PBS, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS) containing 1 mm dithiothreitol, 1 mm phenylmethylsulfonyl fluoride, and one Complete™ protease inhibitor mixture tablet/50 ml of buffer (Roche Diagnostics). For the detection of p39, the cells were lysed in co-immunoprecipitation buffer (50 mm Tris (pH 7.5), 15 mm EGTA, 100 mm NaCl, 0.1% Triton X-100, 1 mm dithiothreitol, 1 mm phenylmethylsulfonyl fluoride, and Complete™ protease inhibitor), and the remaining pellet, the insoluble fraction, was resuspended in PBSTDS. Both fractions were immunoprecipitated using the Cdk5 monoclonal antibody (J-3, Santa Cruz Biotechnology). Intracellular interactions were shown by transiently transfecting Myc-muskelin into COS1 cells or COS1 cells that stably expressed Cdk5, p39, or p35. Seventy-two hours post-transfection cells were lysed with immunoprecipitation buffer (50 mm Tris (pH 7.5), 15 mm EGTA, 100 mm NaCl, 0.1% Triton X-100, 1 mm dithiothreitol, 1 mm phenylmethylsulfonyl fluoride) plus Complete™ protease inhibitor. The lysates were immunoprecipitated with agarose-conjugated anti-histidine monoclonal antibody (Santa Cruz Biotechnology) and resolved on a NuPage 4–12% BisTris gel (Novex). Immunoblotting was performed as described previously (3Gao C.Y. Zakeri Z. Zhu Y. He H.Y. Zelenka P.S. Dev. Genet. 1997; 20: 267-275Crossref PubMed Scopus (68) Google Scholar). For co-immunoprecipitation of endogenous p39 and muskelin, lens and brain tissues were lysed in PBSTDS containing Complete™ protease inhibitor. 200 μg of each cell lysate were incubated with anti-p39 antibody (1:25 dilution) for 30 min at room temperature, and then 20 μl of protein G-agarose beads were added and incubated overnight at 4 °C. Control samples were treated identically except that anti-p39 antibody was omitted. Beads were recovered by centrifugation and washed extensively in PBSTDS, and co-immunoprecipitated proteins were eluted by boiling 5 min in 1× SDS sample buffer containing 10% (v/v) 2-mercaptoethanol. Eluted proteins were resolved on a NuPage 4–12% BisTris gel and immunoblotted with anti-muskelin antibody as described previously (3Gao C.Y. Zakeri Z. Zhu Y. He H.Y. Zelenka P.S. Dev. Genet. 1997; 20: 267-275Crossref PubMed Scopus (68) Google Scholar). GST Fusion Proteins and Affinity Purification Pull-down Assay—To express the various pGEX-4T-1 muskelin clones a 100-ml culture was inoculated and incubated at 30 °C overnight. The following day the culture was induced with 0.4 mm isopropyl β-d-thiogalactopyranoside for 3 h and centrifuged at 5000 rpm. The pellet was resuspended in 3 ml of 1× PBS plus protease inhibitors and lysozyme to 0.1 volume. Samples were kept on ice for 30 min, adjusted to 5 mm dithiothreitol, and sonicated. The sonicate was adjusted to 1% Triton X-100, incubated at room temperature on a rotary wheel for 30 min, and centrifuged at 12,000 rpm. The supernatant was added to glutathione-coupled beads and processed according to the manufacture's protocol (Amersham Biosciences). 1 μg of GST-muskelin was used per experiment. To generate 35S-labeled p39, p35, Cdk5, and muskelin, the corresponding cDNAs were cloned into pcDNA3.1 (for p39, p35, and Cdk5) (Invitrogen) or pET28a (for muskelin) (Novagen, San Diego, CA) and translated in vitro using the TnT quick coupled transcription/translation system (Promega, Madison, WI). The GST-muskelin and 35S-labeled proteins were incubated overnight in the immunoprecipitation buffer (above) containing 1 mg of BL21 soluble protein extract. The following day the beads were washed extensively in immunoprecipitation buffer. The proteins were eluted with SDS loading buffer (Invitrogen) and resolved on a NuPage 4–12% BisTris gel. The gels were stained with Coomassie Blue, destained, soaked in Amplify™ (Amersham Biosciences), dried, and exposed to film. RNA Extraction and RT-PCR—RNA was isolated according to the manufacturer's instructions for RNAqueous™-4PCR kit (Ambion, Austin, TX) or TRIzol (Invitrogen). The RNA was further treated with DNase I (Ambion or Roche Diagnostics). RT-PCR was performed in a two-step procedure. 1 μg of total RNA was reverse transcribed (Superscript II; Invitrogen) with random hexamers (PerkinElmer Life the manufacturer's instructions (Platinum Pfx; Invitrogen). The following oligonucleotides were used: p39 Upstream, 5′-GGCCGTCCGTGCTCATCTCGGCGCTCA-3′ (nucleotides 165–186); p39 Downstream, 5′-CGGCCCTTGCGGAGAAGGTTCTCGCGGTTGCG-3′ (nucleotides 284–324); Muskelin Upstream, 5′-GAACCACAATTCAGTGGGCT-3′ (nucleotides 1264–1284); Muskelin Downstream, 5′-TTGCTCTCTGTGTGAATCCG-3′ (nucleotides 1555–1574). Immunohistochemistry—Heads of E18 rat embryos and adult mouse eyes were embedded in paraffin and sectioned. Paraffin sections (10 μm) were placed on silanated slides (Digene Corp., Gaithersburg, MD). Sections were deparaffinized in xylenes and rehydrated in a series of decreasing concentrations of ethanol. Antigen unmasking was performed by heat treatment with 10 mm sodium citrate, pH 6.0. To remove endogenous peroxidase activity, samples were incubated in 3% hydrogen peroxide in PBS for 30 min. Following several washes in PBS and blocking in 5% normal goat serum in PBS, sections were incubated with anti-muskelin rabbit polyclonal antibody overnight at 4 °C. After extensive washing in PBS, the eye sections were incubated with an anti-rabbit fluorescein isothiocyanate-conjugated secondary, whereas the head sections were incubated with secondary biotinylated antibodies (ABC kit, Vector Laboratories, Burlingame, CA) for 30 min. Finally the head section slides were developed with Vector NovaRED and hydrogen peroxide substrate (Vector Laboratories) according to the manufacturer's instructions. Samples were then washed in distilled water, mounted with Aqua Poly mount (Polysciences, Warrington, PA), and examined with a Zeiss Axioplan 2 photomicroscope. Images were captured with a charge-coupled device camera (Opelco, Sterling, VA). For controls, the antigenic peptide was included during incubation with primary antibodies. For co-localization of the Myc-muskelin and EGFP-p39 transiently transfected N/N1003A cells were fixed with 4% paraformaldehyde for 5 min, rinsed with PBS, blocked with 5% normal goat serum for 1 h, incubated with an anti-Myc monoclonal antibody (Cell Signaling Technology) for 1 h, rinsed with PBS, incubated with a goat anti-mouse Alexa568- or Alexa350-conjugated secondary antibody, rinsed, and coverslipped. In some experiments, the cells were further stained with rhodamine phalloidin before coverslipping. Fluorescence Microscopy—A Leica TCS-SP2 laser scanning confocal microscope (Leica Microsystems) was used for fluorescence microscopy of ECFP-muskelin (excitation, 458 nm), Alexa568-coupled goat anti-rabbit IgG (excitation, 568 nm), or Alexa350-coupled goat anti-rabbit IgG (excitation, 350 nm) (to detect Myc-muskelin); EGFP-p39 (excitation, 488); EYFP-p39 (excitation, 514 nm); and rhodamine-phalloidin (excitation, 568 nm). Expression of p39 RNA and Protein in the Lens—Although previous studies from this laboratory have demonstrated expression of Cdk5 and p35 in lenses of embryonic chickens (28Gao C.Y. Bassnett S. Zelenka P.S. Dev. Biol. 1995; 169: 185-194Crossref PubMed Scopus (35) Google Scholar) and newborn rat lens (3Gao C.Y. Zakeri Z. Zhu Y. He H.Y. Zelenka P.S. Dev. Genet. 1997; 20: 267-275Crossref PubMed Scopus (68) Google Scholar), those studies did not examine expression of p39. Therefore, we performed both RT-PCR and immunoblotting to determine whether this Cdk5 activator is also expressed in the lens. RT-PCR detected a specific transcript that when sequenced corresponded to p39 mRNA (Fig. 1A). Immunoblotting of newborn rat lens proteins that co-immunoprecipitated with Cdk5 showed an immunoreactive band of the proper molecular weight that comigrated with p39 from rat brain and was blocked in the presence of the antigenic peptide (Fig. 1B). Separating the lysate into detergent-soluble and detergent-insoluble fractions prior to immunoprecipitation indicated that Cdk5/p39 is primarily in the soluble fraction of the brain but primarily in the detergent-insoluble fraction of the lens (Fig. 1C). Identification of a Novel p39-interacting Protein—To identify lens proteins that interact with Cdk5, p35, and p39, the respective coding sequences were cloned downstream of the GAL4 DNA binding domain and used as baits for yeast two-hybrid screening of an E18 embryonic rat lens cDNA library. With the GAL4 DNA binding domain/p39 (pBD-p39) fusion plasmid as bait we isolated several prey sequences that supported growth on medium lacking histidine, leucine, and tryptophan and had significant β-galactosidase activity. Sequence analysis of ∼57 such plasmids after rescue in Escherichia coli yielded α-crystallins (4Zhang Q. Ahuja H.S. Zakeri Z.F. Wolgemuth D.J. Dev. Biol. 1997; 183: 222-233Crossref PubMed Scopus (90) Google Scholar), β-crystallins (12Kato G. Maeda S. J. Biochem. (Tokyo). 1999; 126: 957-961Crossref PubMed Scopus (35) Google Scholar), γ-crystallins (17Gilmore E.C. Ohshima T. Goffinet A.M. Kulkarni A.B. Herrup K. J. Neurosci. 1998; 18: 6370-6377Crossref PubMed Google Scholar), a cytoskeletal protein (1Lew J. Beaudette K. Litwin C.M. Wang J.H. J. Biol. Chem. 1992; 267: 13383-13390Abstract Full Text PDF PubMed Google Scholar), a hypothetical poxvirus and zinc finger (POZ) domain protein (1Lew J. Beaudette K. Litwin C.M. Wang J.H. J. Biol. Chem. 1992; 267: 13383-13390Abstract Full Text PDF PubMed Google Scholar), and the nearly complete sequence of muskelin cDNA (pAD-muskelin), lacking only the first nine bases. Muskelin encodes a polypeptide of 735 amino acids containing six kelch motifs, a discoidin domain (23Prag S. Collett G.D.M. Adams J.C. Biochem. J. 2004; 381: 547-559Crossref PubMed Scopus (19) Google Scholar), a LisH motif, and a CTLH domain (24Adams J.C. Seed B. Lawler J. EMBO J. 1998; 17: 4964-4974Crossref PubMed Scopus (73) Google Scholar) (Fig. 2A). The specificity of the interaction between pAD-muskelin and p39 was examined by co-transforming yeast with this clone in conjunction with pBD-p39, pBD-p35, pBD-Cdk5, or the BD fusion of an unrelated protein, human lamin C. Only the muskelin/p39 co-transformants grew in the absence of leucine, tryptophan, and histidine (Fig. 2B) and activated LacZ transcription in a filter lift assay (not shown). In Vitro Interaction between Muskelin and p39 —To confirm the interaction between muskelin and p39 detected by the yeast two-hybrid analysis, a complete muskelin cDNA was constructed by PCR and cloned into a pGEX-4T-1 vector to generate a fusion protein with a GST tag at the N terminus. GST-muskelin was immobilized on a glutathione-agarose matrix and incubated with in vitro translated 35S-labeled p39, p35, or Cdk5 (Fig. 3, A and B). The proteins retained on the matrix were eluted, analyzed by SDS-PAGE, dried, and exposed to film. Consistent with the yeast data, the GST-muskelin fusion protein interacted with p39 but not with p35 or Cdk5 (Fig. 3, A and B). To determine which region of p39 was recognized by muskelin, we performed a similar GST pull-down experiment with a chimeric fusion protein that links the N terminus of p35 with the C terminus of p39, the isolated p39 C terminus (amino acids 110–367), and a p39 truncation lacking the C terminus (amino acids 1–328) (Fig. 3A). GST-muskelin bound to the p39 C terminus and the p35/p39 chimera but not to the p39 truncation, thus localizing the muskelin binding site to the C-terminal end of the p39 protein (amino acids 329–367) (Fig. 3B). This region includes a 24-amino acid insertion not present in p35. Intracellular Interaction between Muskelin and p39 —We next examined the ability of muskelin and p39 to interact in mammalian cells. Myc-tagged muskelin cDNA was transiently transfected into COS1 cells or COS1 cells that were stably transfected with His-tagged p39, p35, or Cdk5 constructs. Cells were lysed and immunoprecipitated with anti-histidine monoclonal antibody and then blotted with anti-Myc polyclonal antibody. Immunoblotting demonstrated that Myc-muskelin co-immunoprecipitated with histidine-tagged proteins from His-p39-transfected cells but not from cells transfected with His-p35 or His-Cdk5 (Fig. 3C). Thus, muskelin appears to interact specifically with p39 both in vitro and in an intracellular environment. Mapping of Interaction Sites in Muskelin—To establish which domain of muskelin was important for binding to p39, we generated a series of GST-muskelin deletions, which sequentially removed each of the six kelch domains (Fig. 4, A and B). Each GST-muskelin construct was then incubated with in vitro translated 35S-labeled p39 (Fig. 4C). Deletion of the C terminus and sixth kelch domain had little effect on the ability of muskelin to bind p39. In contrast, loss of the fifth kelch domain caused a significant loss of the muskelin-p39 binding, sugg" @default.
• W2077514227 created "2016-06-24" @default.
• W2077514227 creator A5005356206 @default.
• W2077514227 creator A5011206435 @default.
• W2077514227 creator A5050697789 @default.
• W2077514227 creator A5052621701 @default.
• W2077514227 creator A5059151872 @default.
• W2077514227 creator A5089309011 @default.
• W2077514227 date "2005-06-01" @default.
• W2077514227 modified "2023-10-15" @default.
• W2077514227 title "A Specific Interaction between Muskelin and the Cyclin-dependent Kinase 5 Activator p39 Promotes Peripheral Localization of Muskelin" @default.
• W2077514227 cites W1485851925 @default.
• W2077514227 cites W1503126591 @default.
• W2077514227 cites W1521887797 @default.
• W2077514227 cites W1548138662 @default.
• W2077514227 cites W1637051517 @default.
• W2077514227 cites W1849680308 @default.
• W2077514227 cites W1868464733 @default.
• W2077514227 cites W1968066199 @default.
• W2077514227 cites W1968866933 @default.
• W2077514227 cites W1971468364 @default.
• W2077514227 cites W1972132222 @default.
• W2077514227 cites W1977971438 @default.
• W2077514227 cites W1989826511 @default.
• W2077514227 cites W2001720542 @default.
• W2077514227 cites W2002860017 @default.
• W2077514227 cites W2003907210 @default.
• W2077514227 cites W2005592859 @default.
• W2077514227 cites W2007151485 @default.
• W2077514227 cites W2021958350 @default.
• W2077514227 cites W2022782470 @default.
• W2077514227 cites W2026412056 @default.
• W2077514227 cites W2032824431 @default.
• W2077514227 cites W2033100763 @default.
• W2077514227 cites W2038901745 @default.
• W2077514227 cites W2039151789 @default.
• W2077514227 cites W2048949076 @default.
• W2077514227 cites W2056791505 @default.
• W2077514227 cites W2058381459 @default.
• W2077514227 cites W2066888192 @default.
• W2077514227 cites W2098921291 @default.
• W2077514227 cites W2103288282 @default.
• W2077514227 cites W2132503351 @default.
• W2077514227 cites W2142133262 @default.
• W2077514227 cites W2150812732 @default.
• W2077514227 cites W2151605417 @default.
• W2077514227 cites W2187243633 @default.
• W2077514227 doi "https://doi.org/10.1074/jbc.m501215200" @default.
• W2077514227 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15797862" @default.
• W2077514227 hasPublicationYear "2005" @default.
• W2077514227 type Work @default.
• W2077514227 sameAs 2077514227 @default.
• W2077514227 citedByCount "33" @default.
• W2077514227 countsByYear W20775142272012 @default.
• W2077514227 countsByYear W20775142272013 @default.
• W2077514227 countsByYear W20775142272014 @default.
• W2077514227 countsByYear W20775142272015 @default.
• W2077514227 countsByYear W20775142272018 @default.
• W2077514227 countsByYear W20775142272019 @default.
• W2077514227 countsByYear W20775142272020 @default.
• W2077514227 countsByYear W20775142272022 @default.
• W2077514227 crossrefType "journal-article" @default.
• W2077514227 hasAuthorship W2077514227A5005356206 @default.
• W2077514227 hasAuthorship W2077514227A5011206435 @default.
• W2077514227 hasAuthorship W2077514227A5050697789 @default.
• W2077514227 hasAuthorship W2077514227A5052621701 @default.
• W2077514227 hasAuthorship W2077514227A5059151872 @default.
• W2077514227 hasAuthorship W2077514227A5089309011 @default.
• W2077514227 hasBestOaLocation W20775142271 @default.
• W2077514227 hasConcept C104317684 @default.
• W2077514227 hasConcept C126322002 @default.
• W2077514227 hasConcept C175738201 @default.
• W2077514227 hasConcept C184235292 @default.
• W2077514227 hasConcept C185592680 @default.
• W2077514227 hasConcept C46762472 @default.
• W2077514227 hasConcept C51853150 @default.
• W2077514227 hasConcept C55493867 @default.
• W2077514227 hasConcept C71924100 @default.
• W2077514227 hasConcept C82495950 @default.
• W2077514227 hasConcept C86803240 @default.
• W2077514227 hasConcept C88045685 @default.
• W2077514227 hasConcept C95444343 @default.
• W2077514227 hasConcept C97029542 @default.
• W2077514227 hasConceptScore W2077514227C104317684 @default.
• W2077514227 hasConceptScore W2077514227C126322002 @default.
• W2077514227 hasConceptScore W2077514227C175738201 @default.
• W2077514227 hasConceptScore W2077514227C184235292 @default.
• W2077514227 hasConceptScore W2077514227C185592680 @default.
• W2077514227 hasConceptScore W2077514227C46762472 @default.
• W2077514227 hasConceptScore W2077514227C51853150 @default.
• W2077514227 hasConceptScore W2077514227C55493867 @default.
• W2077514227 hasConceptScore W2077514227C71924100 @default.
• W2077514227 hasConceptScore W2077514227C82495950 @default.
• W2077514227 hasConceptScore W2077514227C86803240 @default.
• W2077514227 hasConceptScore W2077514227C88045685 @default.
• W2077514227 hasConceptScore W2077514227C95444343 @default.
• W2077514227 hasConceptScore W2077514227C97029542 @default.
• W2077514227 hasIssue "22" @default.

• next