FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2077601612> ?p ?o ?g. }

• W2077601612 endingPage "15842" @default.
• W2077601612 startingPage "15833" @default.
• W2077601612 abstract "The clinical immunosuppressant FTY720 is a sphingosine analogue that, once phosphorylated by sphingosine kinase 2 (Sphk2), is an agonist of multiple receptor subtypes for sphingosine 1-phosphate. Short exposures to FTY720 afford long term protection in lymphoproliferative and autoimmune disease models, presumably by inducing apoptosis in subsets of cells essential for pathogenesis. Sphingosine itself is pro-apoptotic, and apoptosis induced with FTY720 or sphingosine is thought to proceed independently of their phosphorylation. Following chemical mutagenesis of Jurkat cells we isolated mutants that are selectively resistant to FTY720 analogue AAL(R), as well as natural sphingolipid bases, including sphingosine. Cells lacking functional Sphk2 were resistant to apoptosis induced with AAL(R), indicating that apoptosis proceeds through AAL(R) phosphorylation. Phosphorylation of AAL(R) was also required for induction of lymphocyte apoptosis in mice, as apoptosis was not induced with the non-phosphorylatable chiral analogue, AAL(S). Apoptosis was induced in the spleen but not the thymus of mice administered 1 mg/kg AAL(R), correlating with levels of AAL(R)-phosphate (AFD(R)) in organ extracts. AFD(R) did not induce apoptosis when added to the cell culture medium, indicating that it induces apoptosis through an intracellular target. NBD-labeled AAL(R) localized to the endoplasmic reticulum, and AAL(R) treatment resulted in elevated cytosolic calcium, Bax redistribution from cytosol to mitochondrial and endoplasmic reticulum membranes, and caspase-independent mitochondrial permeabilization in Jurkat cells. We therefore describe an apoptotic pathway triggered by intracellular accumulation of sphingolipid base phosphates and suggest that sphingoid base substrates for Sphk2 acting intracellularly could be useful in the treatment of lymphoproliferative diseases. The clinical immunosuppressant FTY720 is a sphingosine analogue that, once phosphorylated by sphingosine kinase 2 (Sphk2), is an agonist of multiple receptor subtypes for sphingosine 1-phosphate. Short exposures to FTY720 afford long term protection in lymphoproliferative and autoimmune disease models, presumably by inducing apoptosis in subsets of cells essential for pathogenesis. Sphingosine itself is pro-apoptotic, and apoptosis induced with FTY720 or sphingosine is thought to proceed independently of their phosphorylation. Following chemical mutagenesis of Jurkat cells we isolated mutants that are selectively resistant to FTY720 analogue AAL(R), as well as natural sphingolipid bases, including sphingosine. Cells lacking functional Sphk2 were resistant to apoptosis induced with AAL(R), indicating that apoptosis proceeds through AAL(R) phosphorylation. Phosphorylation of AAL(R) was also required for induction of lymphocyte apoptosis in mice, as apoptosis was not induced with the non-phosphorylatable chiral analogue, AAL(S). Apoptosis was induced in the spleen but not the thymus of mice administered 1 mg/kg AAL(R), correlating with levels of AAL(R)-phosphate (AFD(R)) in organ extracts. AFD(R) did not induce apoptosis when added to the cell culture medium, indicating that it induces apoptosis through an intracellular target. NBD-labeled AAL(R) localized to the endoplasmic reticulum, and AAL(R) treatment resulted in elevated cytosolic calcium, Bax redistribution from cytosol to mitochondrial and endoplasmic reticulum membranes, and caspase-independent mitochondrial permeabilization in Jurkat cells. We therefore describe an apoptotic pathway triggered by intracellular accumulation of sphingolipid base phosphates and suggest that sphingoid base substrates for Sphk2 acting intracellularly could be useful in the treatment of lymphoproliferative diseases. The sphingolipids are a class of lipids characterized by a serine head group with one or two fatty acyl tails. The common constituent of all sphingolipids is the long chain base (LCB), 3The abbreviations used are: LCB, long chain base; AAL(R), 2-amino-4-(4-heptyloxyphenyl)-2-methylbutanol; ER, endoplasmic reticulum; LC-MS, liquid chromatography mass spectrometry; MEF, murine embryonic fibroblast; S1P, sphingosine 1-phosphate; Sphk, sphingosine kinase; Sphk1, sphingosine kinase 1; Sphk2, sphingosine kinase 2; EGFP, enhanced green fluorescent protein; FS, frameshift; Ctrl, control; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; NBD, 12-(N-methyl-N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)); SBR, sphingoid base resistant; Z, benzyloxycarbonyl; fmk, fluoromethyl ketone.3The abbreviations used are: LCB, long chain base; AAL(R), 2-amino-4-(4-heptyloxyphenyl)-2-methylbutanol; ER, endoplasmic reticulum; LC-MS, liquid chromatography mass spectrometry; MEF, murine embryonic fibroblast; S1P, sphingosine 1-phosphate; Sphk, sphingosine kinase; Sphk1, sphingosine kinase 1; Sphk2, sphingosine kinase 2; EGFP, enhanced green fluorescent protein; FS, frameshift; Ctrl, control; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; NBD, 12-(N-methyl-N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)); SBR, sphingoid base resistant; Z, benzyloxycarbonyl; fmk, fluoromethyl ketone. and the most commonly occurring LCBs in mammals are sphingosine (Fig. 1A) and dihydrosphingosine. Sphingosine may be phosphorylated by sphingosine kinases 1 and 2 (Sphk1 and Sphk2), yielding sphingosine 1-phosphate (S1P), which has mitogenic and pro-survival properties (1Ogretmen B. Hannun Y.A. Nat. Rev. Cancer. 2004; 4: 604-616Crossref PubMed Scopus (999) Google Scholar, 2Taha T.A. Hannun Y.A. Obeid L.M. J. Biochem. Mol. Biol. 2006; 39: 113-131Crossref PubMed Google Scholar). Ceramides are the N-acylated precursors of sphingosine, generated either through the breakdown of the abundant membrane lipid sphingomyelin, or through de novo synthesis of sphingolipids from palmitoyl coenzyme A and serine. Ceramides have been widely implicated in apoptosis, leading to the proposal of a sphingolipid rheostat, with pro-survival S1P at one end and pro-apoptotic ceramide at the other (1Ogretmen B. Hannun Y.A. Nat. Rev. Cancer. 2004; 4: 604-616Crossref PubMed Scopus (999) Google Scholar). Sphingosine itself is pro-apoptotic when added exogenously to cells, and its levels are elevated in response to a number of pro-apoptotic stimuli, including anti-Fas, tumor necrosis factor, and dexamethasone (3Cuvillier O. Biochim. Biophys. Acta. 2002; 1585: 153-162Crossref PubMed Scopus (286) Google Scholar, 4Lepine S. Lakatos B. Courageot M.P. Le Stunff H. Sulpice J.C. Giraud F. J. Immunol. 2004; 173: 3783-3790Crossref PubMed Scopus (49) Google Scholar). S1P is secreted from cells, following phosphorylation of sphingosine on internal membranes, and may act in an auto-crine or a paracrine fashion to affect a diverse array of physiological processes, including maturation and survival of the vasculature, trafficking of lymphocytes through blood, lymph, and secondary lymphoid organs, inflammation, and cell transformation (2Taha T.A. Hannun Y.A. Obeid L.M. J. Biochem. Mol. Biol. 2006; 39: 113-131Crossref PubMed Google Scholar, 5Rosen H. Goetzl E.J. Nat. Rev. Immunol. 2005; 5: 560-570Crossref PubMed Scopus (618) Google Scholar). These effects of S1P are mediated in large part through the activation of a family of five G-protein-coupled receptors, termed S1P1-S1P5. A number of effects have also been attributed to S1P acting through unidentified intracellular targets (2Taha T.A. Hannun Y.A. Obeid L.M. J. Biochem. Mol. Biol. 2006; 39: 113-131Crossref PubMed Google Scholar). Release of caged S1P inside the cell was shown to induce calcium release from endoplasmic reticulum (ER) stores, an effect that was not seen with S1P released on the outside of the cell (6Meyer Zu Heringdorf D. J. Cell. Biochem. 2004; 92: 937-948Crossref PubMed Scopus (70) Google Scholar). Using S1P receptor-deficient fibroblasts in combination with inhibition of G-protein signaling, Olivera et al. (7Olivera A. Rosenfeldt H.M. Bektas M. Wang F. Ishii I. Chun J. Milstien S. Spiegel S. J. Biol. Chem. 2003; 278: 46452-46460Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar) also found that Sphk1 promotes proliferation and survival independently of the S1P receptors. Furthermore, whereas overexpression of Sphk1 enhances cell proliferation and survival, overexpression of Sphk2 has been shown to inhibit proliferation and enhance apoptosis in response to a number of pro-apoptotic agents or serum withdrawal (8Igarashi N. Okada T. Hayashi S. Fujita T. Jahangeer S. Nakamura S. J. Biol. Chem. 2003; 278: 46832-46839Abstract Full Text Full Text PDF PubMed Scopus (346) Google Scholar, 9Liu H. Toman R.E. Goparaju S.K. Maceyka M. Nava V.E. Sankala H. Payne S.G. Bektas M. Ishii I. Chun J. Milstien S. Spiegel S. J. Biol. Chem. 2003; 278: 40330-40336Abstract Full Text Full Text PDF PubMed Scopus (305) Google Scholar, 10Maceyka M. Sankala H. Hait N.C. Le Stunff H. Liu H. Toman R. Collier C. Zhang M. Satin L.S. Merrill Jr., A.H. Milstien S. Spiegel S. J. Biol. Chem. 2005; 280: 37118-37129Abstract Full Text Full Text PDF PubMed Scopus (483) Google Scholar, 11Pitson S.M. Xia P. Leclercq T.M. Moretti P.A. Zebol J.R. Lynn H.E. Wattenberg B.W. Vadas M.A. J. Exp. Med. 2005; 201: 49-54Crossref PubMed Scopus (227) Google Scholar). The sphingosine analogue FTY720 is a promising novel immunosuppressant that is currently in Phase III clinical trials for the treatment of multiple sclerosis. Phosphorylation of FTY720 by Sphk2 in vivo yields the bioactive derivate, FTY720-phosphate, which inhibits lymphocyte egress from lymph nodes and thymus into the bloodstream (12Chiba K. Pharmacol. Ther. 2005; 108: 308-319Crossref PubMed Scopus (239) Google Scholar, 13Chiba K. Yanagawa Y. Kataoka H. Kawaguchi T. Ohtsuki M. Hoshino Y. Transplant. Proc. 1999; 31: 1230-1233Crossref PubMed Scopus (41) Google Scholar, 14Mandala S. Hajdu R. Bergstrom J. Quackenbush E. Xie J. Milligan J. Thornton R. Shei G.J. Card D. Keohane C. Rosenbach M. Hale J. Lynch C.L. Rupprecht K. Parsons W. Rosen H. Science. 2002; 296: 346-349Crossref PubMed Scopus (1421) Google Scholar, 15Kharel Y. Lee S. Snyder A.H. Sheasley-O'Neill S.L. Morris M.A. Setiady Y. Zhu R. Zigler M.A. Burcin T.L. Ley K. Tung K.S. Engelhard V.H. Macdonald T.L. Pearson-White S. Lynch K.R. J. Biol. Chem. 2005; 280: 36865-36872Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar, 16Zemann B. Kinzel B. Muller M. Reuschel R. Mechtcheriakova D. Urtz N. Bornancin F. Baumruker T. Billich A. Blood. 2005; 107: 1454-1458Crossref PubMed Scopus (241) Google Scholar). FTY720-phosphate is a high potency agonist of four of the five S1P receptors: S1P1, S1P3, S1P4, and S1P5, and immunosuppression is the result of this compound's binding to S1P1 (5Rosen H. Goetzl E.J. Nat. Rev. Immunol. 2005; 5: 560-570Crossref PubMed Scopus (618) Google Scholar, 17Matloubian M. Lo C.G. Cinamon G. Lesneski M.J. Xu Y. Brinkmann V. Allende M.L. Proia R.L. Cyster J.G. Nature. 2004; 427: 355-360Crossref PubMed Scopus (2046) Google Scholar). FTY720 showed considerable promise in the prevention of transplant rejection, is effective in a number of autoimmune diseases, and is in clinical trials for the treatment of multiple sclerosis (12Chiba K. Pharmacol. Ther. 2005; 108: 308-319Crossref PubMed Scopus (239) Google Scholar). In addition to its immediate immunosuppressive effects, a short course of FTY720 affords long term protection against the lymphoproliferative and autoimmune disease caused by Fas deficiency in MRL-lpr/lpr mice (18Suzuki S. Li X.K. Shinomiya T. Enosawa S. Amemiya H. Amari M. Naoe S. Clin. Exp. Immunol. 1997; 107: 103-111Crossref PubMed Scopus (69) Google Scholar, 19Okazaki H. Hirata D. Kamimura T. Sato H. Iwamoto M. Yoshio T. Masuyama J. Fujimura A. Kobayashi E. Kano S. Minota S. J. Rheumatol. 2002; 29: 707-716PubMed Google Scholar). FTY720 induces apoptosis of human multiple myeloma cells at concentrations considerably lower than those required to induce apoptosis of normal peripheral blood mononuclear cells (20Yasui H. Hideshima T. Raje N. Roccaro A.M. Shiraishi N. Kumar S. Hamasaki M. Ishitsuka K. Tai Y.T. Podar K. Catley L. Mitsiades C.S. Richardson P.G. Albert R. Brinkmann V. Chauhan D. Anderson K.C. Cancer Res. 2005; 65: 7478-7484Crossref PubMed Scopus (96) Google Scholar), and inhibits the growth of androgen-independent prostate carcinoma (21Chua C.W. Lee D.T. Ling M.T. Zhou C. Man K. Ho J. Chan F.L. Wang X. Wong Y.C. Int. J. Cancer. 2005; 117: 1039-1048Crossref PubMed Scopus (73) Google Scholar), hepatocellular carcinoma (22Ho J.W. Man K. Sun C.K. Lee T.K. Poon R.T. Fan S.T. Mol. Cancer Ther. 2005; 4: 1430-1438Crossref PubMed Scopus (81) Google Scholar), and breast cancer (23Azuma H. Takahara S. Ichimaru N. Wang J.D. Itoh Y. Otsuki Y. Morimoto J. Fukui R. Hoshiga M. Ishihara T. Nonomura N. Suzuki S. Okuyama A. Katsuoka Y. Cancer Res. 2002; 62: 1410-1419PubMed Google Scholar) xenografts in mice. The efficacy of FTY720 against solid tumors and lymphoproliferative diseases is most likely the result of an induction of apoptosis in the target cells. The precise molecular basis for the induction of apoptosis with FTY720 remains unknown, although a number of mechanisms have been suggested. Several reports have described induction of the mitochondrial permeability transition and consequent activation of caspases by FTY720, with modulation of these processes by the mitochondrial gatekeeper Bcl-2 family proteins (20Yasui H. Hideshima T. Raje N. Roccaro A.M. Shiraishi N. Kumar S. Hamasaki M. Ishitsuka K. Tai Y.T. Podar K. Catley L. Mitsiades C.S. Richardson P.G. Albert R. Brinkmann V. Chauhan D. Anderson K.C. Cancer Res. 2005; 65: 7478-7484Crossref PubMed Scopus (96) Google Scholar, 24Nagahara Y. Ikekita M. Shinomiya T. Br. J. Pharmacol. 2002; 137: 953-962Crossref PubMed Scopus (34) Google Scholar, 25Nagahara Y. Ikekita M. Shinomiya T. J. Immunol. 2000; 165: 3250-3259Crossref PubMed Scopus (75) Google Scholar). Other reports have described a down-modulation of pro-survival mitogen-activated protein kinase and phosphatidylinositol 3-kinase/Akt pathways, and up-regulation of stress-activated kinases such as p38 (26Matsuoka Y. Nagahara Y. Ikekita M. Shinomiya T. Br. J. Pharmacol. 2003; 138: 1303-1312Crossref PubMed Scopus (145) Google Scholar, 27Permpongkosol S. Wang J.D. Takahara S. Matsumiya K. Nonomura N. Nishimura K. Tsujimura A. Kongkanand A. Okuyama A. Int. J. Cancer. 2002; 98: 167-172Crossref PubMed Scopus (75) Google Scholar). Effects on the cytoskeleton and integrin-dependent adhesion have also been described for both FTY720 and sphingosine (23Azuma H. Takahara S. Ichimaru N. Wang J.D. Itoh Y. Otsuki Y. Morimoto J. Fukui R. Hoshiga M. Ishihara T. Nonomura N. Suzuki S. Okuyama A. Katsuoka Y. Cancer Res. 2002; 62: 1410-1419PubMed Google Scholar, 28Suzuki E. Handa K. Toledo M.S. Hakomori S. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 14788-14793Crossref PubMed Scopus (73) Google Scholar). Protein kinase C is an established target for inhibition by sphingosine (29Hannun Y.A. Loomis C.R. Merrill Jr., A.H. Bell R.M. J. Biol. Chem. 1986; 261: 12604-12609Abstract Full Text PDF PubMed Google Scholar, 30Hamaguchi A. Suzuki E. Murayama K. Fujimura T. Hikita T. Iwabuchi K. Handa K. Withers D.A. Masters S.C. Fu H. Hakomori S. J. Biol. Chem. 2003; 278: 41557-41565Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar), whereas a number of protein kinases, including the “sphingosine dependent kinases” are activated by sphingosine but not S1P or ceramide (30Hamaguchi A. Suzuki E. Murayama K. Fujimura T. Hikita T. Iwabuchi K. Handa K. Withers D.A. Masters S.C. Fu H. Hakomori S. J. Biol. Chem. 2003; 278: 41557-41565Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar, 31Megidish T. Takio K. Titani K. Iwabuchi K. Hamaguchi A. Igarashi Y. Hakomori S. Biochemistry. 1999; 38: 3369-3378Crossref PubMed Scopus (34) Google Scholar). A direct intracellular target for FTY720 has not been identified. In this study we have used a combination of genetic and chemical biology approaches to investigate the molecular basis for induction of apoptosis with the FTY720 analogue 2-amino-4-(4-heptyloxyphenyl)-2-methylbutanol (AAL(R)). We show that phosphorylation of AAL(R) by Sphk2 is an absolute requirement for its induction of apoptosis in vitro and in vivo, that inactivation of Sphk2 reduces the apoptotic potency of endogenous LCBs including sphingosine, and that apoptosis is driven by intracellular LCB phosphates, most likely formed at the ER. We therefore describe an apoptotic pathway in mammalian cells, with potential in the treatment of cancer, that is triggered by phosphorylation of long chain bases. Cell Culture and Transfection—Jurkat and HeLa cells were cultured in RPMI1640 supplemented with 10% fetal bovine serum (Hyclone), penicillin/streptomycin, and 2 mml-glutamine. Cells were transfected with Lipofectamine 2000, using 4 μg of DNA and 10 μl of Lipofectamine to transfect 106 cells. Jurkat cells transfected with the pIRES-EGFP vector were selected with 0.8 mg/ml G418 for 2-3 weeks, after which the cells were sorted for EGFP expression by flow cytometry. Assays were performed with cells sorted for equal EGFP expression. Cell culture reagents were purchased from Invitrogen. Mutagenesis—Jurkat cells were mutagenized at a density of 5 × 105 cells/ml, by treatment with 4 μg/ml ICR191 (Sigma) for 48 h (32Cvijic M.E. Xiao G. Sun S.C. J. Immunol. Methods. 2003; 278: 293-304Crossref PubMed Scopus (10) Google Scholar). The medium was replaced and the cells were allowed to recover for 5-6 days before the next round of mutagenesis. Following three rounds of mutagenesis, the cells were treated for 48 h with 10 μm AAL(R), then plated into 96-well plates to isolate surviving clonal lines. PCR and Vector Construction—Primers AGCTCGTGGAGATCTATTCATGGATCCAGCGGGCGG (forward) and GCTGTGCGGCGAATTCTCATAAGGGCTCTTCTGGCGGTGG (reverse), and TCCCGTTGAGAATTCAGAGCAGAGGACCAGCAGATGAAT (forward) and CGACGGGGATCCAGCTTGTTTAGTTTCAGGGCTCCC (reverse) were used for amplification of SPHK1 and SPHK2, respectively, from human endothelial cDNA. PCR products were cloned into the pCR-TOPO 2.1 vector (Invitrogen) and sequenced, before subcloning into the pIRES-EGFP expression vector (Clontech). Internal SPHK2 sequence primers TGTCTGCTCCGAGGACTGCCA and ACGGGTGAGTGTAGAGCTGCCT were used for sequencing of SPHK2. Detection of Frameshift Mutations in SPHK2—SPHK2 cDNA was amplified from SBR1 cells and sequenced. Two frameshifting mutations were identified as single base insertions that caused a mixed signal. To confirm that these mutations occurred on opposite alleles of the SBR1 SPHK2 gene, a PCR assay was employed. The following primers were used: 5′ control (Ctrl), CCATGGCCCCGCCCCCA; 5′ frameshifted (FS), CATGGCCCCGCCCCCCA; 3′ Ctrl, TCTGTGCCTGTAGCGGCCCAT; 3′ FS, GTGCCTGTAGCGGCCCCA. SPHK2 was amplified from cDNA with 36 cycles, using 62 °C annealing for the 5′ Ctrl/3′ Ctrl primer pair, and 64 °C for the 5′ FS/3′ Ctrl, 5′ Ctrl/3′ FS, and 5′ FS/3′ FS primer pairs. SPHK2 could be amplified from SBR1 cDNA using only the 5′ FS/3′ Ctrl and 5′ Ctrl/3′ FS primer pairs, whereas only the 5′ Ctrl/3′ Ctrl primer pair amplified SPHK2 from control Jurkat cDNA. Cell Viability/Apoptosis Assays—For MTT and caspase-3/7 assays, Jurkat cells were seeded at 5 × 104 cells/well into a 96-well plate, and treated for 18 h with compounds. MTT assays were performed with an ATCC assay kit, exactly as described in the product information. Caspase-3/7 assays were performed with a Caspase-Glo 3/7 assay kit (Promega), according to the product information. AAL(R) and AAL(S) (kindly provided by Dr. V. Brinkmann, Novartis, Basel) were dissolved at 20 mg/ml in dimethyl sulfoxide, then diluted in water for addition to cells. Sphingosine, dihydrosphingosine, and phytosphingosine (Avanti Polar Lipids) were dissolved in dimethyl sulfoxide at 2 mm, and delivered in dimethyl sulfoxide, to a final concentration of 0.5% dimethyl sulfoxide. S1P (Biomol) and AFD(R) (V. Brinkmann) were dissolved in methanol at 1 mm, and added to the cells as a complex with 0.1% fatty acid-free bovine serum albumin (Sigma). Measurement of Apoptosis in Cultured Splenocytes and in Vivo; MEF Cells—Splenocytes were isolated by grinding spleens between frosted glass slides, followed by a single round of red blood cell lysis with 0.17 m NH4Cl for 5 min on ice. Cells were resuspended in RPMI, 10% fetal bovine serum, treated for 18 h with compounds at 37 °C, then incubated on ice with 1 μg/ml propidium iodide and immediately analyzed by flow cytometry. Viability was scored as the proportion of cells excluding propidium iodide, then normalized to 100% for the vehicle-treated cells. Sphk1-/- (33Allende M.L. Sasaki T. Kawai H. Olivera A. Mi Y. van Echten-Deckert G. Hajdu R. Rosenbach M. Keohane C.A. Mandala S. Spiegel S. Proia R.L. J. Biol. Chem. 2004; 279: 52487-52492Abstract Full Text Full Text PDF PubMed Scopus (400) Google Scholar) and Sphk2-/- (34Mizugishi K. Yamashita T. Olivera A. Miller G.F. Spiegel S. Proia R.L. Mol. Cell. Biol. 2005; 25: 11113-11121Crossref PubMed Scopus (612) Google Scholar) mice were on a mixed Sv/C57BL6 background. AAL(R) and AAL(S) were administered by intraperitoneal injection in 2% dimethyl sulfoxide to 3-month-old male MRL/MpJ-lpr/lpr mice. Spleen, inguinal lymph nodes, and thymus were homogenized and filtered through 40-μm sieves. Spleen was subjected to red blood cell lysis as above. Lymphocytes were resuspended in 0.1 ml of 20 mm Hepes, pH 7.4, 150 mm NaCl, 2.5 mm CaCl2 and incubated for 15 min with 1:50 annexin V-fluorescein isothiocyanate (BD Pharmingen) and 1 μg/ml propidium iodide, after which the volume was increased to 0.3 ml and the cells were analyzed with an LSRII cytometer (BD Biosciences), and FlowJo software (Treestar). WT (+/+) and knock-out (-/-) MEF cells were derived from day 13.5 embryos of a single Sphk2+/- female bred with a Sphk2+/- male. Head and liver were removed, and the remaining tissue was digested in 0.25% trypsin/EDTA solution (Invitrogen) on ice for 6 h, then at 37 °C for 30 min, after which the embryonic cells were dissociated by pipetting, and plated in RPMI1640 supplemented with 10% fetal bovine serum. Mice were genotyped as described (34Mizugishi K. Yamashita T. Olivera A. Miller G.F. Spiegel S. Proia R.L. Mol. Cell. Biol. 2005; 25: 11113-11121Crossref PubMed Scopus (612) Google Scholar). Measurement of Lipids by Liquid Chromatography Mass Spectrometry (LC-MS)—Cells were incubated at a density of 2.5 × 105 cells/ml with 5 μm AAL(R) for 4 h or 5 μm sphingosine for 2 h at 37 °C. AFD(R) or S1P formation was determined to be linear with respect to time over this time frame in Jurkat cells. Cells were washed once with phosphate-buffered saline, then extracted into 0.1 ml of ice-cold methanol. Extracts were cleared at 21,800 × g for 15 min and run over a Zorbax SB-C18 column (Agilent) at 0.35 ml/min, loading in 0.1% formic acid, 15% acetonitrile, and increasing to 98% acetonitrile over 15 min. An Agilent 1100 single quadrapole mass spectrometer was used. To extract AAL(R) and AFD(R) from spleen and thymus, the organs were homogenized with a Biospec Products Mini-BeadBeater in 0.5 ml of cold methanol. Extracts were incubated for 20 min at 4 °C on a platform rocker, then cleared at 21,800 × g for 20 min. Spiked controls were used to estimate compound recovery from spleen and thymus. Sphingosine Kinase Assays—Use of NBD-sphingosine to assay sphingosine kinase activity has been described previously (35Billich A. Ettmayer P. Anal. Biochem. 2004; 326: 114-119Crossref PubMed Scopus (50) Google Scholar). Cells were lysed with a single freeze-thaw in 50 mm Hepes, pH 7.4, 10 mm KCl, 15 mm MgCl2, 0.1% Triton X-100, 20% glycerol, 2 mm orthovanadate, 2 mm dithiothreitol, 10 mm NaF, 1 mm deoxypyridoxine, and EDTA-free complete protease inhibitor (Roche). Lysates were cleared at 21,800 × g for 15 min. Total sphingosine kinase activity was measured in 50 mm Hepes, pH 7.4, 15 mm MgCl2, 10 mm KCl, 10% glycerol, 2 mm ATP, 5 mm NaF, and 1 mm deoxypyridoxine, to which was added 10 μm NBD-sphingosine as substrate. Sphk1 activity was measured in 50 mm Hepes, pH 7.4, 15 mm MgCl2, 0.5% Triton X-100, 10% glycerol, 2 mm ATP; and Sphk2 activity in 50 mm Hepes, pH 7.4, 15 mm MgCl2, 0.5 m KCl, 10% glycerol, 2 mm ATP (36Liu H. Sugiura M. Nava V.E. Edsall L.C. Kono K. Poulton S. Milstien S. Kohama T. Spiegel S. J. Biol. Chem. 2000; 275: 19513-19520Abstract Full Text Full Text PDF PubMed Scopus (560) Google Scholar). Reactions were started with the addition of 25 μg of Jurkat lysate protein. The 50-μl reactions were extracted with the addition of 50 μl of 1 m potassium phosphate, pH 8.5, followed by 250 μl of chloroform/methanol (2:1), then cleared at 15,000 × g for 1 min. NBD fluorescence was read using 100 μl of upper aqueous phase, combined with 100 μl of dimethylformamide. Reactions containing no enzyme were used for blanks, and fluorescence units were converted to nanomoles of S1P using NBD-S1P standards extracted as described above. NBD-sphingosine and NBD-S1P were from Avanti Polar Lipids. To assay inhibition of Sphk1 in vitro, HEK293 lysates were prepared 48 h after transfection with Sphk1 expression plasmid. Expression and Purification of Recombinant Sphk2—SPHK2, full-length or truncated, was subcloned into the pMAL-c2E vector (New England Biolabs). Maltose-binding protein-Sphk2 (MBP-Sphk2) fusion proteins were produced from 200 ml of bacterial cultures, as described in the pMAL-c2E product manual. Maltose-binding protein-Sphk2 fusion protein was soluble, and stable when stored at -20 °C in the presence of 50% glycerol. Activity was determined in Sphk2 selective assay buffer (as above), using 2 μg of recombinant protein/30-min reaction. Synthesis of AAL(R)-NBD—AAL(R)-NBD was synthesized as described (37Ettmayer P. Baumruker T. Guerini D. Mechtcheriakova D. Nussbaumer P. Streiff M.B. Billich A. Bioorg. Med. Chem. Lett. 2006; 16: 84-87Crossref PubMed Scopus (9) Google Scholar), with the following modification: the key phenolic intermediate was alkylated with 1-azido-7-iodoheptane (80% yield), followed by quantitative reduction of the azide group to the primary amine, which was then reacted with NBD-Cl. The t-butoxycarbonyl group was cleaved to afford the NBD-labeled (R)-AAL derivative. Immunofluorescence—HeLa cells, seeded overnight on glass coverslips, were incubated for 1 h with 10 μm NBD-AAL(R). The cells were then washed once and incubated in fresh growth medium for 1 h, with ER Tracker Red (2 μm), Lysotracker Red (75 nm), or Mitotracker Deep Red (50 nm) (all from Molecular Probes) added for the final 30 min. The cells were washed once more, and immediately imaged (in growth medium at room temperature) with an Olympus FV500 confocal microscope. Western Blotting and Subcellular Fractionation—Cells were treated at a density of 2.5 × 106 cells/ml, then washed with phosphate-buffered saline, and either lysed directly in Laemmli buffer, or resuspended in fractionation buffer: 200 mm mannitol, 68 mm sucrose, 10 mm KCl, 2 mm MgCl2, 0.5 mm EGTA, 10 mm Hepes, pH 7.4, and complete protease inhibitor mixture (Roche). Cells were broken with 50 passes through a 27-gauge needle, then centrifuged for 10 min at 800 × g to pellet nuclei and unbroken cells, followed by 4,000 and 22,000 × g spins to pellet mitochondrial and microsomal fractions. Proteins were resolved on 4-12% NU-PAGE gels (Invitrogen). Antibodies used included rabbit anti-Bax NT (Upstate), mouse anti-calnexin and mouse anti-TOM20 (BD Biosciences), and rabbit anti-PARP1 (Novus). Intracellular Ca2+ Measurement—Jurkat cells were treated for 8 h with 5 μm AAL(R) or AAL(S), incubated for 30 min with 5 μm Fluo-3 (Molecular Probes) in phosphate-buffered saline, 1% bovine serum albumin, 0.02% Pluronic F127 (Molecular Probes), then washed and incubated for a further 30 min in phosphate-buffered saline, 1% bovine serum albumin at 37 °C, after which the cells were analyzed by flow cytometry. Geometric mean Fluo-3 fluorescence was determined for viable cells only, gated on the basis of light scatter. Isolation of AAL(R)-resistant Mutants—Jurkat cells were mutagenized with ICR191, then treated with the FTY720 analogue, AAL(R) (Fig. 1B), for 48 h to isolate resistant cells. Nine AAL(R)-resistant cell lines were derived from two distinct mutagenized pools. As we aimed to isolate mutants that were resistant to AAL(R) but not to all apoptosis inducing agents, the mutant cell lines were then tested by MTT assay for resistance to the DNA damaging agent etoposide, and anti-Fas antibody. Five mutants were found to be resistant to AAL(R) but not etoposide or anti-Fas antibody. The viability curves for three such mutants, designated SBR1-3 (sphingoid base resistant), are shown in Fig. 2, A-C. Induction of Apoptosis with AAL(R) Requires Phosphorylation by Sphk2—These cell lines were assayed for their capacity to phosphorylate AAL(R) in culture, using LC-MS to detect AAL(R) and the phosphorylated derivative AFD(R). Mutant SBR1 was unable to phosphorylate AAL(R) (Fig. 2D). Several publications have reported that FTY720 is phosphorylated efficiently by Sphk2, but not by Sphk1 (15Kharel Y. Lee S. Snyder A.H. Sheasley-O'Neill S.L. Morris M.A. Setiady Y. Zhu R. Zigler M.A. Burcin T.L. Ley K. Tung K.S. Engelhard V.H. Macdonald T.L. Pearson-White S. Lynch K.R. J. Biol. Chem. 2005; 280: 36865-36872Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar, 16Zemann B. Kinzel B. Muller M. Reuschel R. Mechtcheriakova D. Urtz N. Bornancin F. Baumruker T. Billich A. Blood. 2005; 107: 1454-1458Crossref PubMed Scopus (241) Google Scholar, 38Brinkmann V. Davis M.D. Heise C.E. Albert R. Cottens S. Hof R. Bruns C. Prieschl E. Baumruker T. Hiestand P. Foster C.A. Zollinger M. Lynch K.R. J. Biol. Chem. 2002; 277: 21453-21457Abstract Full Text Full Text PDF PubMed Scopus (1306) Google" @default.
• W2077601612 created "2016-06-24" @default.
• W2077601612 creator A5019762035 @default.
• W2077601612 creator A5038784099 @default.
• W2077601612 creator A5038844409 @default.
• W2077601612 creator A5039339022 @default.
• W2077601612 creator A5048492327 @default.
• W2077601612 creator A5075441922 @default.
• W2077601612 date "2007-05-01" @default.
• W2077601612 modified "2023-10-18" @default.
• W2077601612 title "Essential Requirement for Sphingosine Kinase 2 in a Sphingolipid Apoptosis Pathway Activated by FTY720 Analogues" @default.
• W2077601612 cites W1507235573 @default.
• W2077601612 cites W1539102283 @default.
• W2077601612 cites W1595133660 @default.
• W2077601612 cites W1966705891 @default.
• W2077601612 cites W1973579966 @default.
• W2077601612 cites W1976709850 @default.
• W2077601612 cites W1977644244 @default.
• W2077601612 cites W1978492782 @default.
• W2077601612 cites W1979236863 @default.
• W2077601612 cites W1991115604 @default.
• W2077601612 cites W1991558659 @default.
• W2077601612 cites W1993449698 @default.
• W2077601612 cites W1994513122 @default.
• W2077601612 cites W2006985918 @default.
• W2077601612 cites W2014941104 @default.
• W2077601612 cites W2016087648 @default.
• W2077601612 cites W2017689420 @default.
• W2077601612 cites W2018350020 @default.
• W2077601612 cites W2025122749 @default.
• W2077601612 cites W2025671438 @default.
• W2077601612 cites W2027727753 @default.
• W2077601612 cites W2033536958 @default.
• W2077601612 cites W2034202087 @default.
• W2077601612 cites W2035138062 @default.
• W2077601612 cites W2036044676 @default.
• W2077601612 cites W2039884289 @default.
• W2077601612 cites W2043979469 @default.
• W2077601612 cites W2047275732 @default.
• W2077601612 cites W2051485704 @default.
• W2077601612 cites W2054820743 @default.
• W2077601612 cites W2061923945 @default.
• W2077601612 cites W2079368297 @default.
• W2077601612 cites W2100749062 @default.
• W2077601612 cites W2108091182 @default.
• W2077601612 cites W2108813293 @default.
• W2077601612 cites W2110388058 @default.
• W2077601612 cites W2114926817 @default.
• W2077601612 cites W2138728266 @default.
• W2077601612 cites W2143068056 @default.
• W2077601612 cites W2146307680 @default.
• W2077601612 cites W2149902537 @default.
• W2077601612 cites W2151948261 @default.
• W2077601612 cites W2153813261 @default.
• W2077601612 cites W2154089780 @default.
• W2077601612 cites W2155497355 @default.
• W2077601612 cites W2162108926 @default.
• W2077601612 cites W2164422031 @default.
• W2077601612 doi "https://doi.org/10.1074/jbc.m609124200" @default.
• W2077601612 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17400555" @default.
• W2077601612 hasPublicationYear "2007" @default.
• W2077601612 type Work @default.
• W2077601612 sameAs 2077601612 @default.
• W2077601612 citedByCount "77" @default.
• W2077601612 countsByYear W20776016122012 @default.
• W2077601612 countsByYear W20776016122013 @default.
• W2077601612 countsByYear W20776016122014 @default.
• W2077601612 countsByYear W20776016122015 @default.
• W2077601612 countsByYear W20776016122016 @default.
• W2077601612 countsByYear W20776016122017 @default.
• W2077601612 countsByYear W20776016122018 @default.
• W2077601612 countsByYear W20776016122019 @default.
• W2077601612 countsByYear W20776016122020 @default.
• W2077601612 countsByYear W20776016122021 @default.
• W2077601612 countsByYear W20776016122022 @default.
• W2077601612 countsByYear W20776016122023 @default.
• W2077601612 crossrefType "journal-article" @default.
• W2077601612 hasAuthorship W2077601612A5019762035 @default.
• W2077601612 hasAuthorship W2077601612A5038784099 @default.
• W2077601612 hasAuthorship W2077601612A5038844409 @default.
• W2077601612 hasAuthorship W2077601612A5039339022 @default.
• W2077601612 hasAuthorship W2077601612A5048492327 @default.
• W2077601612 hasAuthorship W2077601612A5075441922 @default.
• W2077601612 hasBestOaLocation W20776016121 @default.
• W2077601612 hasConcept C170493617 @default.
• W2077601612 hasConcept C184235292 @default.
• W2077601612 hasConcept C185592680 @default.
• W2077601612 hasConcept C190283241 @default.
• W2077601612 hasConcept C2776596873 @default.
• W2077601612 hasConcept C2777700496 @default.
• W2077601612 hasConcept C2778703144 @default.
• W2077601612 hasConcept C55493867 @default.
• W2077601612 hasConcept C61705674 @default.
• W2077601612 hasConcept C86803240 @default.
• W2077601612 hasConcept C95444343 @default.
• W2077601612 hasConceptScore W2077601612C170493617 @default.
• W2077601612 hasConceptScore W2077601612C184235292 @default.
• W2077601612 hasConceptScore W2077601612C185592680 @default.

• next