FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2078132170> ?p ?o ?g. }

• W2078132170 endingPage "19858" @default.
• W2078132170 startingPage "19853" @default.
• W2078132170 abstract "2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is a common environmental pollutant causing public concern. Its toxic effects include disruption of the immune, endocrine, and reproductive systems, impairment of fetal development, carcinogenicity, and lethality in rodents. Here, we report that TCDD induces apoptosis in two cultured human leukemic lymphoblastic T cell lines. This cell death was found not to be dependent on an aryl hydrocarbon receptor and to be inhibited by the inhibitor of tyrosine kinases and caspases. Apoptosis-linked c-Jun N-terminal kinase is rapidly activated in these cells by the treatment with TCDD. A dominant-negative mutant of c-Jun N-terminal kinase prevented cell death in the treatment with TCDD. Furthermore, TCDD decreases the Bcl-2 protein level in these cell lines. These findings will help in the understanding of the molecular mechanism underlying TCDD-mediated immunotoxicity. 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is a common environmental pollutant causing public concern. Its toxic effects include disruption of the immune, endocrine, and reproductive systems, impairment of fetal development, carcinogenicity, and lethality in rodents. Here, we report that TCDD induces apoptosis in two cultured human leukemic lymphoblastic T cell lines. This cell death was found not to be dependent on an aryl hydrocarbon receptor and to be inhibited by the inhibitor of tyrosine kinases and caspases. Apoptosis-linked c-Jun N-terminal kinase is rapidly activated in these cells by the treatment with TCDD. A dominant-negative mutant of c-Jun N-terminal kinase prevented cell death in the treatment with TCDD. Furthermore, TCDD decreases the Bcl-2 protein level in these cell lines. These findings will help in the understanding of the molecular mechanism underlying TCDD-mediated immunotoxicity. 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) 1The abbreviations used are: TCDD, 2,3,7,8-tetrachlorodibenzo-p-dioxin; Ah, aryl hydrocarbon; CHX, cycloheximide; CYP1A1, cytochrome P450 1A1; JNK, c-Jun N-terminal kinase; TCDF, 2,3,7,8-tetrachlorodibenzofuran; Z-Asp-CH2-DCB, carbobenzoxyl-l-aspartyl-α-[(2,6-dichlorobenzoyl)oxy] methane; RT, reverse transcriptase; PCR, polymerase chain reaction; PBS, phosphate-buffered saline; MOPS, morpholinepropanesulfonic acid. is a prototype halogenated aromatic hydrocarbon, and it is considered to be one of the most potent toxicants studied (1DeVito M.J. Birnbaum L.S. Toxicology. 1995; 102: 115-123Crossref PubMed Scopus (43) Google Scholar). The adverse biological effects of TCDD seen in experimental animals include immune, reproductive, and developmental toxicity, carcinogenicity, wasting syndrome, chloracne, and lethality (2Huff J. Lucier G. Tritscher A. Annu. Rev. Pharmacol. Toxicol. 1994; 34: 343-372Crossref PubMed Scopus (166) Google Scholar). While the immunotoxic effects of TCDD have been well characterized in the rodent model, little data are available for humans. The thymic atrophy caused by TCDD in rodents is mediated by a selective killing of immature thymocytes, although the exact mechanism remains unknown. In the rat (3McConkey D.J. Hartzeli P. Duddy S.K. Hakansson H. Orrenius S. Science. 1988; 242: 256-259Crossref PubMed Scopus (432) Google Scholar) and mouse (4Rhile M.J. Nagarkatti M. Nagarkatti P.S. Toxicology. 1996; 110: 153-167Crossref PubMed Scopus (63) Google Scholar) immature thymocytes treated with TCDD (in vitro) have been reported to die due to apoptosis, although other studies have produced contradictory results (5Silverstone A.J. Frazier D.E. Fiore N.C. Soults J.A. Gasciewz T.A. Toxicol. Appl. Pharmacol. 1994; 126: 248-259Crossref PubMed Scopus (90) Google Scholar). However, the demonstration of this effect in vivo has met with only limited success. The lack of a cell culture system in which toxicity can be readily detected and shown in a regulated manner has hindered efforts to understand the intracellular and molecular events by which TCDD induces apoptosis. It has been assumed that all the biological effects of TCDD are mediated through the Ah receptor (1DeVito M.J. Birnbaum L.S. Toxicology. 1995; 102: 115-123Crossref PubMed Scopus (43) Google Scholar), a ligand-activated member of the bHLH-PAS family of transcription factors (6Ema M. Sogawa K. Watanabe N. Chujoh Y. Matsushita N. Gotoh N. Funae Y. Fujii-Kuriyama Y. Biochem. Biophys. Res. Commun. 1992; 184: 246-253Crossref PubMed Scopus (357) Google Scholar, 7Burbach K.M. Poland A. Bradfield C.A. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 8185-8189Crossref PubMed Scopus (723) Google Scholar). However, not all the biological effects of TCDD can be explained using this receptor-based model. Thus while it is clear that TCDD is highly toxic to mammals, the cellular mechanisms by which TCDD exerts its toxic effects are obscure. We now describe a cell culture system derived from human T cell lymphomas that provides unique advantages for studying the molecular mechanisms underlying the action of TCDD. The idea for this culture system came to us when we observed, during our recent studies of TCDD, that, when the human leukemic lymphoblastic T cell line L-MAT (8Morita S. Tsuchiya S. Fujie H. Itano M. Ohashi Y. Minegishi M. Imaizumi M. Endo M. Takano N. Konno T. Leukemia. 1996; 10: 102-105PubMed Google Scholar) was exposed to TCDD, the cells underwent morphological changes and eventual apoptosis. Using this cell culture system, we can now more fully investigate the role of the Ah receptor in the mechanism of TCDD-mediated apoptosis, which has hitherto been difficult with the use of human tissues. Cells were grown in RPMI 1640 medium containing 10% fetal calf serum, 100 IU/ml penicillin, and 0.1% streptomycin at 37 °C, in 95% air, 5% CO2. Treatment of cells with TCDD was carried out as follows. Exponentially growing cells in RPMI 1640 medium containing 10% fetal calf serum were collected, and fresh medium was added. In this condition, cells were grown for another 4–6 h at 37 °C. Then, cells were collected and washed once with phosphate-buffered saline (PBS). Cells were incubated at a density of 2.0 × 105 cells/ml in serum-free RPMI 1640 medium either in the presence of TCDD or in an equal volume of solvent Me2SO (concentration never exceeded the 0.1% level). Cells were harvested at different time points for the apoptosis assay. Cells (1.0 × 106) were collected and suspended in 500 μl of 100 mm Tris·Cl, pH 8.0, containing 0.5 mg/ml proteinase K, 0.2 m NaCl, 0.2% SDS, and 0.5 mm EDTA, then incubated overnight at 37 °C. Soluble cytoplasmic DNA was collected by centrifugation at 27,000 × g for 75 min at 4 °C, intact chromosomal DNA remaining in the pellet. The supernatant containing soluble apoptotic DNA was pelleted using isopropanol. The pelleted DNA was resuspended in 25 μl of TE buffer (10 mmTris·Cl, pH 7.5, 1 mm EDTA) containing 0.1 mg/ml RNase A, then incubated at 37 °C for 2 h. The DNA (5.0 μl) was applied to 2.0% agarose gel electrophoresis and visualized by ethidium bromide staining. Cells were collected (0.5 × 106 to 1.0 × 106 cells) by centrifugation at 300 × g for 10 min, then washed once with PBS. Cells were resuspended in 50 μl of 3% paraformaldehyde in PBS, then incubated for 10 min at room temperature. Fixation solution was removed by centrifugation and washing with PBS. Fixed cells were resuspended in 15 μl of bis-benzimide (Hoechst 33258) solution (16 μg/ml in PBS), then incubated for 15 min at room temperature. Stained cells were placed (10 μl) on a glass slide and, under a fluorescence microscope, 500 cells per slide were scored for the incidence of apoptotic changes in chromatin. Cells with two or more chromatin fragments were considered apoptotic. Electron microscopy was done essentially as described elsewhere (9Minegishi M. Minegishi N. Yanagisawa T. Tsuchiya S. Tezuka H. Kaji M. Nakamura M. Hayashi Y. Konno T. Leuk. Res. 1995; 19: 433-442Crossref PubMed Scopus (8) Google Scholar). Total RNA was prepared from the cells by the method of Chomczyniski and Sacchi (10Chomczynski P. Sacchi N. Anal. Biochem. 1987; 162: 156-159Crossref PubMed Scopus (63189) Google Scholar). The prepared RNA (0.5–5.0 μg) was reverse-transcribed (to synthesize cDNA) by means of avian myeloblastosis virus reverse transcriptase (Life Sciences) using a random hexamer. Primer sequences were from published sources and were as follows; Ah receptor, TTGGCTTTGTTTGCGATAGCT and CTGCATGTGTCTGATGTCTTC; and cytochrome P450 1A1 (CYP1A1), TCCATCAGCATCTATGTGGC and TTCATCCCTATTCTTCGCTAC. PCR reactions were carried out in a final volume of 20.0 μl containing 0.1 volume of the RT sample, 2.0 μl of 10× Taq buffer, 500 μmof each dNTP in the presence of 1.0 μm of each primer, and 2.5 units of Taq DNA polymerase (Life Technologies, Inc.). Amplification was performed by way of the following profiles. For CYP1A1 (30 cycles) and glyceraldehyde-3-phosphate dehydrogenase (25 cycles), 4 min at 94 °C, 1 min at 65 °C before the first cycle, 1 min for denaturation at 94 °C, 1 min at 65 °C for annealing, and 1 min and 30 s for primer extension at 72 °C, then finally 10 min at 72 °C after the last cycle. For the Ah receptor (35 cycles), the procedure was as for CYP1A1, except that annealing was at 60 °C, and 2 min with 5-s extensions were used for primer extension at 72 °C. The PCR products (5.0 μl) were then subjected to 1.5% agarose gel electrophoresis and stained with ethidium bromide. The solid phase JNK assay was carried out by using a glutathione S-transferase-c-Jun (amino acids 1–79) fusion protein coupled to glutathione beads as a substrate according to a published report (11Lenczowski J.M. Dominguez L. Eder A.M. King L.B. Zacharchuk C.M. Ashwell J.D. Mol. Cell. Biol. 1997; 17: 170-181Crossref PubMed Scopus (235) Google Scholar). Briefly, to measure JNK activity in cell lysates, 1 × 106 cells were incubated for various period of time with various stimuli and then lysed in lysis buffer (25 mm HEPES, pH 7.5, 0.3m NaCl, 1.5 mm MgCl2, 0.5 mm EDTA, 0.1% Triton X-100, 0.5 mmdithiothreitol, 20 mm β-glycerophosphate, 0.1 mm Na3VO4, 2 μg/ml leupeptin, and 1 mm phenylmethylsulfonyl fluoride). Fifty micrograms of cellular extract were mixed with glutathione agarose beads to which 10 μg of glutathione S-transferase-c-Jun (amino acids 1–79) were bound, then incubated at 4 °C for 3 h. The beads were washed three times with PBS containing 1% Nonidet P-40 and 2 mm vanadate, once with 100 mm Tris·Cl, pH 7.5, and 0.5 mm LiCl, and once with final wash buffer (12.5 mm MOPS, pH 7.5, 12.5 mm β-glycerophosphate, 7.5 mm MgCl2, 0.5 mm EGTA, 0.5 mm NaF, 0.5 mm Na3VO4). The beads were then incubated in kinase reaction buffer (12.5 mm MOPS, pH 7.5, 12.5 mm β-glycerophosphate, 7.5 mm MgCl2, 0.5 mm EGTA, 0.5 mm NaF, 0.5 mm Na3VO4, 20 μm ATP, and 3.3 mm dithiothreitol) containing 1 μCi of [γ-32P]ATP at 30 °C for 30 min. The reaction was terminated by addition of 10 μl of SDS-polyacrylamide gel electrophoresis sample buffer, and the phosphorylated proteins were resolved by SDS-polyacrylamide gel electrophoresis and visualized by autoradiography. L-MAT cells were cotransfected with pCAG plasmid expressing β-galactosidase and a dominant-negative mutant of JNK1, pcDNA3-Flag-JNK1(APF) (a gift from Dr. Roger J. Davies) (12Chen Y-R. Wang X. Templeton D. Davies R.J. Tan T-H. J. Biol. Chem. 1996; 271: 31929-31936Abstract Full Text Full Text PDF PubMed Scopus (855) Google Scholar), by the LipofectAMINE method according to the manufacturer's (Life Technologies, Inc.) instructions. After 48 h of transfection with expression plasmids, cells were treated with 20 nm TCDD for 4 h for the detection of apoptosis in β-galactosidase-positive cells. Cells were fixed with 2% paraformaldehyde, washed, and incubated with anti-β-galactosidase antibody (5 Prime → 3 Prime, Inc., Boulder, CO) at 1:500 dilution for 1 h at 4 °C. After washing, cells were incubated with fluorescein isothiocyanate-labeled goat anti-rabbit antibody (5 Prime → 3 Prime, Inc.) at a dilution of 1:500 for 1 h at 4 °C. For staining of DNA, Hoechst dye 33258 at a concentration of 16 μg/ml was added during the second antibody incubation period. After washing, cells were mounted and examined under a Leica DM LB fluorescent microscope. Cells were treated with 20 nm TCDD for different time periods, and cell extracts were prepared as described for JNK assay. Protein (100 μg) was electrophoresed in 13.5% SDS-polyacrylamide gel electrophoresis and transferred onto a nitrocellulose membrane. The membrane was immunostained with anti-Bcl-2 monoclonal antibody, clone Bcl-2-100 (Sigma), and was developed with an enhanced chemiluminescent kit (Amersham International PLC). Treatment of L-MAT cells with 20 nm TCDD in serum-free culture medium resulted in an apoptotic DNA ladder consisting of 180-base pair fragments in the agarose gel (Fig. 1 A). As a control, DNA was prepared from an equal volume of solvent (dimethyl sulfoxide)-treated cells. A DNA ladder was routinely observed within 4 h of treatment with TCDD. We extracted only the degraded DNA, not the intact chromosomal DNA, from apoptotic as well as nonapoptotic cells. This DNA extraction method simplified sample loading on to the gel. Sample loading was optimized as follows. Samples of soluble apoptotic DNA obtained from the same number of cells were dissolved in equal volumes of TE buffer, and the same volume of sample was applied to each lane. This TCDD-mediated apoptosis was not restricted to L-MAT cells; another lymphoblastic T cell line, Jurkat, also showed the characteristics of apoptosis when treated with TCDD (Fig. 1 A). Incubation of L-MAT cells with 20 nm TCDD also resulted in the appearance of morphological changes characteristic of apoptosis upon staining with the DNA-specific fluorochrome bis-benzimide (Fig. 1 B). These changes include condensation of chromatin, its compaction along the periphery of the nucleus, and segmentation of the nucleus. The early stages of the cytoplasmic and nuclear morphology typical of apoptosis were revealed by electron micrography (Fig.1 C). The time course of changes in L-MAT cell viability was measured by means of a trypan blue exclusion assay. An increase in the number of nonviable cells became apparent at 2–4 h after the addition of TCDD to the culture medium and, at 8 h, nearly 90% of the cells exhibited a loss of viability (Fig. 1 D). This apoptotic effect was observed with doses of TCDD as low as 1 nm, and a plateau of nearly 90% cell death at 8 h was observed with doses of 20 nm or more TCDD (Fig. 1 E). To examine the specificity of TCDD-mediated apoptosis, we tested other Ah receptor ligands for the induction of apoptosis in L-MAT cells. A close structural analog, 2,3,7,8-tetrachlorodibenzofuran (TCDF), failed to induce apoptosis at a similar concentration (Fig.2 A). Another Ah receptor ligand, β-naphthoflavone, also failed to induce apoptosis even at a 1000-fold molar excess (20 μm) in this cell line (Fig.2 A). These results demonstrate both the specificity of action of TCDD and the usefulness of this system as an in vitro model for assaying TCDD-mediated toxicity. Some of the initial evidence suggested that apoptosis is caused by an active process, and that new protein synthesis is required for apoptosis (13Oppenheim R.W. Prevette D. Tytell M. Homma S. Dev. Biol. 1990; 138: 104-113Crossref PubMed Scopus (307) Google Scholar). However, it was subsequently shown that a macromolecular synthesis inhibitor failed to block apoptosis in many systems and, indeed, could even induce this process in many situations (14Martin S.J. Trends Cell Biol. 1993; 3: 141-144Abstract Full Text PDF PubMed Scopus (122) Google Scholar). To determine whether macromolecular synthesis is essential for TCDD-induced cell death, L-MAT cells were pretreated for 2 h with CHX or actinomycin D, to block new protein synthesis. Then, 2 h later, TCDD was added to the cells. Actinomycin D itself proved to be cytotoxic to L-MAT cells (data not shown). Treatment with 20 nm TCDD and CHX (10 μg/ml) failed to inhibit apoptosis (Fig. 2 B). However, CHX was found to increase the sensitivity of the cells to TCDD, although CHX alone did not have any effect on this cell line (Fig.2 B). We also confirmed that, in our hands dexamethasone-induced cell death is inhibited by CHX (data not shown). We thought it possible that CYP1A1-mediated oxygen radicals might be the major cause of the apoptosis induced by TCDD in these cell lines. To test this possibility, we checked the inducibility of CYP1A1 in L-MAT and Jurkat cells. In fact, RT-PCR revealed that CYP1A1 is not inducible in either of these two cell lines by 2 nm TCDD, although we could routinely use this concentration of TCDD to induce CYP1A1 in HepG2 cells (Fig. 3 A). It could be argued that the serum-free culture conditions used for the apoptosis assay had already induced CYP1A1. In an attempt to rule out this possibility, we prepared RNA from dying cells (20 nmTCDD-treated apoptotic cells), then performed RT-PCR. As expected, CYP1A1 was not induced during the apoptosis (Fig. 3 B). These results clearly indicate that CYP1A1-mediated oxygen radicals are not the cause of the apoptosis produced by TCDD. The finding that inhibition of protein synthesis failed to block the induction of apoptosis by TCDD in L-MAT cells (Fig. 2) raised the possibility that direct transcriptional activation of death gene(s) by the Ah receptor is not required for the induction of apoptosis by TCDD. Like glucocorticoid and retinoic acid receptors (15Helmberg A. Auphan N. Caelles C. Karin M. EMBO J. 1995; 14: 452-460Crossref PubMed Scopus (248) Google Scholar), the Ah receptor might cause transcriptional repression of some survival genes in TCDD-mediated apoptosis. To test this hypothesis, we first examined the expression level of the Ah receptor in our cell lines. In fact, using RT-PCR, we could not detect any mRNA for the Ah receptor in either the L-MAT or Jurkat cell line (Fig. 3 A). In contrast, HepG2 cells showed the presence of Ah receptor mRNA in both TCDD-treated and nontreated samples (Fig. 3 A). This result was verified by three independent experiments, with the RT-PCR standardized using different numbers of cycles (25–35 cycles) and using different amounts of mRNA (range, 0.5 to 5.0 μg). The results of RT-PCR using mRNA from dying cells were essentially the same as those described above (Fig. 3 B). Next, we tried to determine which signaling events that might mediate the apoptosis caused by TCDD in these cell lines. Besides transforming the Ah receptor, TCDD activates protein-tyrosine kinases in responsive cells (16Ma X. Mufti N.A. Babish J.G. Biochem. Biophys. Res. Commun. 1992; 189: 5965-5971Crossref Scopus (22) Google Scholar, 17Bombick D.W. Jankun J. Tullis K. Matsumura F. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 4128-4132Crossref PubMed Scopus (85) Google Scholar). Moreover, genistein, a selective protein-tyrosine kinase inhibitor, has been found to block apoptosis (18Bronte V. Macino A. Zambon A. Rosato S. Mandruzzato P. Zanovello P. Collavo D. Biochem. Biophys. Res. Commun. 1996; 218: 344-351Crossref PubMed Scopus (38) Google Scholar, 19Migita K. Eguchi K. Kawabe Y. Mizokami A. Tsukada A. Nagataki S. J. Immunol. 1994; 153: 3457-3465PubMed Google Scholar). To determine whether protein-tyrosine kinase is involved in TCDD-mediated apoptosis, we used genistein to try to block the apoptosis produced by TCDD. A range of different concentrations of genistein was used (10–50 μg/ml) in L-MAT cells and, as expected, 50 μg/ml genistein completely blocked the induction of cell death by TCDD (Figs.4 and 5). Genistein alone had no effect in these cell lines (data not shown).Figure 5Dose dependence of inhibition of TCDD-mediated apoptosis by inhibitors of protein-tyrosine kinase and caspases. Inhibition of TCDD-mediated apoptosis by genistein (Gen) and by Z-Asp-CH2-DCB (Z-Asp). Cells were treated with different concentrations of either genistein (10–60 μg/ml) or Z-Asp (10–60 μm). Cell viability was assessed by the trypan blue exclusion method.View Large Image Figure ViewerDownload Hi-res image Download (PPT) In mammalian cells, caspases (formerly known as interleukin-1β-converting enzyme (ICE) or ICE-related proteases) have been implicated in apoptosis (20Alnemri E.S. Livingston D.J. Nicholson D.W. Salvesen G. Thornberry N.A. Wong W.W. Yuan J. Cell. 1996; 87: 171Abstract Full Text Full Text PDF PubMed Scopus (2146) Google Scholar, 21Nicholoson D.W. Thornberry N.A. Valliancourt J.P. Ding C.K. Gallank K. Gareace Y. Griffin P.R. Labelle M. Lazebnik Y.A. Munday N.A. Raju S.M. Smulson M.E. Yami T. Yu V.L. Miller D.K. Nature. 1995; 376: 37-43Crossref PubMed Scopus (3796) Google Scholar). We therefore investigated whether proteolytic activity of caspases might also be involved in TCDD-mediated apoptosis. In L-MAT cells, the apoptosis triggered by TCDD was strongly inhibited by the caspases inhibitor, carbobenzoxyl-l-aspartyl-α-[(2,6-dichlorobenzoyl)oxy] methane (Z-Asp-CH2-DCB) (22Mashima T. Naito M. Kataoka S. Kawai S. Tsuro T. Biochem. Biophys. Res. Commun. 1995; 209: 907-915Crossref PubMed Scopus (162) Google Scholar) (Figs. 4 and 5). We then tested other protease inhibitors: (i) the calpain inhibitor, leupeptin; (ii) the classical serine protease inhibitor, phenylmethylsulfonyl fluoride; and (iii) the cysteine protease inhibitor, antipain. However, all three failed to inhibit TCDD-mediated cell death (data not shown). In neuronal (23Xia Z. Dickens M. Raingeaud J. Davis R.J Greenberg M.E. Science. 1995; 270: 1326-1331Crossref PubMed Scopus (5035) Google Scholar) and hematopoietic (24Verheiz M. Bose R. Lin X.H. Yao B. Jarvis D.W. Grant S. Birrer M.J. Szabo E. Zon L.I. Kyriakis J.M. Haimovitz-Friedman A. Fuks Z. Kolesnick R.N. Nature. 1996; 380: 75-79Crossref PubMed Scopus (1716) Google Scholar) model systems, apoptosis induced by stress was linked to the sustained activation of JNK. Therefore, JNK activity was measured upon TCDD treatment in L-MAT cells. Induction of JNK activity was observed within 30 min upon TCDD treatment in L-MAT cells (Fig. 6). The peak activity of JNK was observed 90 min after TCDD treatment, and similar results were obtained in Jurkat cells (data not shown). These results revealed that TCDD-mediated apoptotic signals strongly induced JNK activity, which coincides with cell death. To determine the role of JNK in TCDD-mediated cell death in these cells, we tested the effect of interfering with JNK function by transient expression of a dominant-negative mutant of JNK (APF) in L-MAT cells. To identify the transfected cells, cells were transfected with β-galactosidase-expressing vector, pCAG, with or without the dominant-negative mutant of JNK. The cells were stained with anti-β-galactosidase antibody and fluorescein isothiocyanate-conjugated secondary antibody. For the identification of the apoptotic cells, in which the DNA was degraded, nuclei were stained with Hoechst dye 33258. In β-galactosidase-expressing cells, the dominant-negative JNK should be expressed, and normal JNK should be inhibited. Thus, the survival rate of transfected cells was determined as the percentage of apoptotic cells in β-galactosidase expressing cells in TCDD and Me2SO-treated cells. Expression of dominant-negative mutant of JNK blocked TCDD-mediated apoptosis (Fig.7), suggests a direct role of JNK signal transduction pathway in the TCDD-mediated cell death in these cell lines. We next asked whether TCDD-mediated apoptosis in these cells is associated with modulation of Bcl-2 protein expression. Using Western blot analysis, we found that Bcl-2 protein levels decreased as early as 2 h after onset of culture with TCDD and then declined further by 6 h of culture (Fig. 8). For a long time it has been thought that TCDD is not toxic to cultured cells (25Knutson J.C. Poland A. Toxicol. Appl. Pharmacol. 1980; 54: 377-383Crossref PubMed Scopus (71) Google Scholar, 26GreenLee W.F. Dold K.M. Irons R. Osborne M. Toxicol. Appl. Pharmacol. 1985; 79: 112-118Crossref PubMed Scopus (136) Google Scholar). However, the data reported in this study demonstrate for the first time that TCDD does cause cell death in cultured lymphoblastic T cell lines, and that this cell death exhibits distinct apoptotic features. The classically accepted morphological features of apoptosis including nucleoplasmic and cytoplasmic condensation, the formation of apoptotic bodies, membrane blebs, and loss of cell volume, were seen following TCDD treatment. These extensive cyto-architectural modifications, in conjunction with the induction of internucleosomal DNA fragmentation, a hallmark of apoptosis, established that TCDD is indeed toxic to at least these cultured cells and that the cell death mediated by TCDD is classical apoptosis. Since caspases are involved in many kinds of apoptosis in higher eukaryotes (21Nicholoson D.W. Thornberry N.A. Valliancourt J.P. Ding C.K. Gallank K. Gareace Y. Griffin P.R. Labelle M. Lazebnik Y.A. Munday N.A. Raju S.M. Smulson M.E. Yami T. Yu V.L. Miller D.K. Nature. 1995; 376: 37-43Crossref PubMed Scopus (3796) Google Scholar), the inhibition of TCDD-mediated cell death by a selective caspase inhibitors also suggested that this cell death is an example of apoptosis. Possibly, the apoptosis mediated by TCDD may play an important role in the immunotoxicity of this agent. The induction of the xenobiotic metabolic enzyme, CYP1A1, by TCDDin vivo and in vitro has been well characterized in many experimental systems (27Whitlock J.P. Okino S.T. Dong L. Ko P. Clarke-Katzenberg R. Ma Q. Li H. FASEB J. 1996; 10: 808-818Google Scholar). Recently, it has been found that induction of CYP1A1 in the mouse hepatoma cell line, Hepa-1, produces oxygen radicals which then cause oxidative DNA damage (28Park J-Y.K. Shigenaga M.K. Ames B.N. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 2322-2327Crossref PubMed Scopus (249) Google Scholar). In fact, oxygen radicals are involved in the apoptosis induced by many kinds of extracellular stimuli (29Korsmeyer S.J. Yin X.M. Oltvai Z.N. Veis-Novack D.J. Linette G.P. Biochim. Biophys. Acta. 1995; 1271: 63-66Crossref PubMed Scopus (254) Google Scholar). However, we found that CYP1A1 is not inducible in these cell lines by TCDD, and consequently we can say that CYP1A1-mediated formation of oxygen radicals is not involved in the apoptosis studied here. However, we cannot rule out the possibility that oxygen radicals are generated from other sources by TCDD in these cell lines; such oxygen radicals could be involved in this apoptosis. That the Ah receptor is not required for the TCDD-mediated induction of apoptosis in these cell lines was established by the following findings: 1) ligands other than TCDD did not cause apoptosis at doses sufficient to activate the Ah receptor (30Harris M. Piskorska-Plisczyznska J. Zacharewski T. Romkes M. Safe S. Cancer Res. 1989; 49: 4531-4535PubMed Google Scholar, 31Poland A. Glover E. Mol. Pharmacol. 1977; 13: 924-938PubMed Google Scholar, 32Berghard A. Gardin K. Toftgard R. J. Biol. Chem. 1990; 265: 21086-21090Abstract Full Text PDF PubMed Google Scholar), 2) CYP1A1 was not inducible in these cell lines (i.e. a functional Ah receptor is not present in these cell lines), and (3McConkey D.J. Hartzeli P. Duddy S.K. Hakansson H. Orrenius S. Science. 1988; 242: 256-259Crossref PubMed Scopus (432) Google Scholar) the mRNA for the Ah receptor was not present in either of the two cell lines tested. We stably transformed the human Ah receptor gene in both L-MAT and Jurkat cells and checked the kinetics of the TCDD-mediated apoptosis. As we expected, there were no differences between the Ah receptor-transformed and nontransformed cells with respect to the kinetics of TCDD-mediated apoptosis (data not shown). These findings are well supported by other studies. For example, in Hepa-1 cells, TCDD has been found to induce c-Fos, c-Jun, JunB, and JunD mRNA (33Puga A. Nebert D.W. Carrier F. DNA Cell Biol. 1992; 11: 269-281Crossref PubMed Scopus (181) Google Scholar). This induction also occurred in Ah receptor-less and Ah receptor nuclear translocator mutant cell lines (c2 mutant cells and c4 mutant cells, respectively). This suggests that an Ah receptor-TCDD interaction may not be involved in some of the actions of TCDD (34Hoffer A. Chang C.Y. Puga A. Toxicol. Appl. Pharmacol. 1996; 141: 238-247Crossref PubMed Google Scholar). The Ah receptor is present in all the mammalian species so far checked, but the binding affinity of TCDD for the Ah receptor differs from one species to another (35Gasiewicz T.A. Rucci G. Mol. Pharmacol. 1984; 26: 90-98PubMed Google Scholar). Moreover, the actual binding affinity does not always correlate with the TCDD-mediated toxicity in a given species (1DeVito M.J. Birnbaum L.S. Toxicology. 1995; 102: 115-123Crossref PubMed Scopus (43) Google Scholar). Indeed, only two strains of mice (C57BL/6J and DBA/2) have shown a good relationship between sensitivity to TCDD (in terms of induced toxicity) and Ah receptor binding affinity (36Poland A. Glover E. Mol. Pharmacol. 1980; 17: 86-94PubMed Google Scholar). Taken together, this suggests that besides the TCDD-Ah receptor interaction, additional TCDD-activated signal-transduction pathway(s) may also play an important role in the toxicity of this agent. One recent report suggested that apoptotic machinery is constitutively present in virtually all cell types in mammals, and that on-going transcription is required in some cases for the activation of signal transduction pathways to occur (37Weil M. Jacobson M.D. Coles H.S.R. Davies T.J. Gardner R.L. Raff K.D. Raff M.C. J. Cell Biol. 1996; 133: 1053-1059Crossref PubMed Scopus (356) Google Scholar). Our results suggest that, in the present lymphoblastic T cell lines, TCDD probably activates only the preexisting death pathway, new protein synthesis not being required. However, we cannot rule out the other possibility purely on the basis of the effects of CHX treatment on these cells. CHX has been proven to be an activator of c-Jun N-terminal kinases or stress-activated protein kinases, which are directly involved in stress-activated apoptosis in T cell lines (24Verheiz M. Bose R. Lin X.H. Yao B. Jarvis D.W. Grant S. Birrer M.J. Szabo E. Zon L.I. Kyriakis J.M. Haimovitz-Friedman A. Fuks Z. Kolesnick R.N. Nature. 1996; 380: 75-79Crossref PubMed Scopus (1716) Google Scholar). The present finding that CHX did not inhibit apoptosis is in contrast to an earlier report concerning TCDD-mediated apoptosis in a rat thymocyte culture (3McConkey D.J. Hartzeli P. Duddy S.K. Hakansson H. Orrenius S. Science. 1988; 242: 256-259Crossref PubMed Scopus (432) Google Scholar). The most likely explanation for the discrepancy is that we used human cultured lymphoblastic T cell lines, whereas the previous study used immature rat thymocytes. In keratinocytes, genistein, a selective inhibitor of protein tyrosine kinases, completely blocks the induction of CYP1A1 by TCDD (38Gardin K. Whitelaw M.L. Toftgard R. Poellinger L. Berghard A. J. Biol. Chem. 1994; 269: 23800-23807Abstract Full Text PDF PubMed Google Scholar), and induction of transforming growth factor-β2 by TCDD is also inhibited by genistein (39Lee D.C. Barlow K.D. Gaido K.W. Toxicol. Appl. Pharmacol. 1996; 137: 90-99Crossref PubMed Scopus (21) Google Scholar). In the present study, genistein completely blocked the apoptosis mediated by TCDD in the absence of the Ah receptor. Depending on the cellular context, tyrosine kinases transmit either cell survival or cell death signals. Long term exposure of the cell to protein-tyrosine kinase inhibitors can itself cause apoptosis in some systems (40McCabe M.J. Orrenius S. Biochem. Biophys. Res. Commun. 1993; 194: 944-949Crossref PubMed Scopus (116) Google Scholar); however, we used genistein for a relatively short period of time. Our results suggest that, at least in the present cell lines, activation of protein-tyrosine kinase is essential for TCDD-mediated apoptosis, and perhaps for some of the other toxic effects of the TCDD, notably its immunotoxicity. The connections between TCDD signaling and the apoptosis were explored in this study. This motivated the examination of the role of the stress-response signal transduction pathway in the TCDD-mediated apoptosis in these cell lines. Stress-activated protein kinase JNK is rapidly activated in these cell lines by TCDD. The JNK pathway is well known to respond to extracellular stimuli that induce apoptosis, such as ceramide, granzyme B, interleukin-1, UV, and γ-radiation (23Xia Z. Dickens M. Raingeaud J. Davis R.J Greenberg M.E. Science. 1995; 270: 1326-1331Crossref PubMed Scopus (5035) Google Scholar, 24Verheiz M. Bose R. Lin X.H. Yao B. Jarvis D.W. Grant S. Birrer M.J. Szabo E. Zon L.I. Kyriakis J.M. Haimovitz-Friedman A. Fuks Z. Kolesnick R.N. Nature. 1996; 380: 75-79Crossref PubMed Scopus (1716) Google Scholar,41Davis R.J. Trends Biochem. Sci. 1994; 19: 470-474Abstract Full Text PDF PubMed Scopus (917) Google Scholar, 42Derijard B. Hibi M. Wu I.H. Barrett T. Su B. Deng T. Karin M. Davis R.J. Cell. 1994; 76: 1025-1037Abstract Full Text PDF PubMed Scopus (2955) Google Scholar, 43Kawakami Y. Miura T. Bissonnette R. Hata D. et al.Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 3938-3942Crossref PubMed Scopus (128) Google Scholar). Latter, it has been found that JNK mediated this apoptotic process. Sustained JNK activity is up-regulated severalfold in these cell lines by TCDD. This result clearly demonstrates that TCDD treatment regulates the well characterized stress response pathway. The mechanism by which TCDD treatment triggers the sustained JNK activation remains to be elucidated. A dominant-negative mutant of JNK blocked the TCDD-mediated cell death in these cells. This further supports the notion of the role of a JNK signal transduction pathway in the TCDD-mediated apoptosis. The central role of Bcl-2 in apoptosis was well established by numerous studies (44Reed J.C. Nature. 1997; 387: 773-776Crossref PubMed Scopus (1389) Google Scholar, 45Kroemer G. Nat. Med. 1997; 3: 614-620Crossref PubMed Scopus (1713) Google Scholar). Posttranslational modification of Bcl-2 has a major impact in apoptosis. Activation of the Bcl-2 by proteases degradation has been implicated as a mechanism by which the death signal can neutralize the anti-apoptotic function of Bcl-2 and enhance cell death (46Cheng E.H. Y Kirsch D.G. Clem R.J. Ravi R. Kastan M.B. Bedi A. Ueno K. Hardwick J.M. Science. 1997; 278: 1966-1968Crossref PubMed Scopus (1005) Google Scholar). We found evidence that apoptosis mediated by TCDD is preceded by down-regulation of Bcl-2 protein in these cell lines. These findings suggest that down-regulation of Bcl-2 protein is one of the factors playing an important role in the pathway of TCDD-induced apoptosis of these cells. In summary, the results of the present study will help in the understanding of the molecular mechanism by which TCDD exerts its toxic actions in humans. It is tempting to speculate that, in mammalian species, the immunotoxicity of TCDD is partly due to a direct action on signal transduction pathways (i.e. an action independent of the Ah receptor), and partly to an action that does depend on the formation of Ah receptor-TCDD complexes. A better understanding of the molecular mechanisms underlying TCDD-mediated toxicity will help in assessing the risk to humans of exposure to TCDD. We thank Dr. A. Yasui for a constructive review of the manuscript." @default.
• W2078132170 created "2016-06-24" @default.
• W2078132170 creator A5006159126 @default.
• W2078132170 creator A5012824041 @default.
• W2078132170 creator A5025451632 @default.
• W2078132170 creator A5027772917 @default.
• W2078132170 creator A5034772950 @default.
• W2078132170 creator A5043597779 @default.
• W2078132170 creator A5043654188 @default.
• W2078132170 creator A5047440177 @default.
• W2078132170 creator A5060303955 @default.
• W2078132170 creator A5077305525 @default.
• W2078132170 date "1998-07-01" @default.
• W2078132170 modified "2023-10-02" @default.
• W2078132170 title "The Ah Receptor Is Not Involved in 2,3,7,8-Tetrachlorodibenzo-p-dioxin-mediated Apoptosis in Human Leukemic T Cell Lines" @default.
• W2078132170 cites W1517353469 @default.
• W2078132170 cites W1601650782 @default.
• W2078132170 cites W1621124914 @default.
• W2078132170 cites W1622053312 @default.
• W2078132170 cites W1792340383 @default.
• W2078132170 cites W1969158591 @default.
• W2078132170 cites W1969656285 @default.
• W2078132170 cites W1971776926 @default.
• W2078132170 cites W1974189474 @default.
• W2078132170 cites W1976385326 @default.
• W2078132170 cites W1981106016 @default.
• W2078132170 cites W1984903682 @default.
• W2078132170 cites W1997779746 @default.
• W2078132170 cites W1998153902 @default.
• W2078132170 cites W1999317280 @default.
• W2078132170 cites W2003054104 @default.
• W2078132170 cites W2008601243 @default.
• W2078132170 cites W2024113408 @default.
• W2078132170 cites W2025548430 @default.
• W2078132170 cites W2027775471 @default.
• W2078132170 cites W2035016164 @default.
• W2078132170 cites W2035574998 @default.
• W2078132170 cites W2046183216 @default.
• W2078132170 cites W2058390675 @default.
• W2078132170 cites W2059382298 @default.
• W2078132170 cites W2070862399 @default.
• W2078132170 cites W2074169536 @default.
• W2078132170 cites W2079849049 @default.
• W2078132170 cites W2081110323 @default.
• W2078132170 cites W2081145901 @default.
• W2078132170 cites W2086541189 @default.
• W2078132170 cites W2087332917 @default.
• W2078132170 cites W2089804471 @default.
• W2078132170 cites W2092335156 @default.
• W2078132170 cites W2092759765 @default.
• W2078132170 cites W2095384906 @default.
• W2078132170 cites W2156211746 @default.
• W2078132170 cites W2167962847 @default.
• W2078132170 cites W2177359510 @default.
• W2078132170 cites W4294216491 @default.
• W2078132170 doi "https://doi.org/10.1074/jbc.273.31.19853" @default.
• W2078132170 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9677421" @default.
• W2078132170 hasPublicationYear "1998" @default.
• W2078132170 type Work @default.
• W2078132170 sameAs 2078132170 @default.
• W2078132170 citedByCount "68" @default.
• W2078132170 countsByYear W20781321702012 @default.
• W2078132170 countsByYear W20781321702013 @default.
• W2078132170 countsByYear W20781321702014 @default.
• W2078132170 countsByYear W20781321702015 @default.
• W2078132170 countsByYear W20781321702016 @default.
• W2078132170 countsByYear W20781321702019 @default.
• W2078132170 countsByYear W20781321702020 @default.
• W2078132170 countsByYear W20781321702023 @default.
• W2078132170 crossrefType "journal-article" @default.
• W2078132170 hasAuthorship W2078132170A5006159126 @default.
• W2078132170 hasAuthorship W2078132170A5012824041 @default.
• W2078132170 hasAuthorship W2078132170A5025451632 @default.
• W2078132170 hasAuthorship W2078132170A5027772917 @default.
• W2078132170 hasAuthorship W2078132170A5034772950 @default.
• W2078132170 hasAuthorship W2078132170A5043597779 @default.
• W2078132170 hasAuthorship W2078132170A5043654188 @default.
• W2078132170 hasAuthorship W2078132170A5047440177 @default.
• W2078132170 hasAuthorship W2078132170A5060303955 @default.
• W2078132170 hasAuthorship W2078132170A5077305525 @default.
• W2078132170 hasBestOaLocation W20781321701 @default.
• W2078132170 hasConcept C1491633281 @default.
• W2078132170 hasConcept C153911025 @default.
• W2078132170 hasConcept C170493617 @default.
• W2078132170 hasConcept C178790620 @default.
• W2078132170 hasConcept C185592680 @default.
• W2078132170 hasConcept C190283241 @default.
• W2078132170 hasConcept C2909724048 @default.
• W2078132170 hasConcept C29730261 @default.
• W2078132170 hasConcept C502942594 @default.
• W2078132170 hasConcept C54355233 @default.
• W2078132170 hasConcept C55493867 @default.
• W2078132170 hasConcept C81885089 @default.
• W2078132170 hasConcept C86803240 @default.
• W2078132170 hasConcept C95444343 @default.
• W2078132170 hasConceptScore W2078132170C1491633281 @default.
• W2078132170 hasConceptScore W2078132170C153911025 @default.
• W2078132170 hasConceptScore W2078132170C170493617 @default.

• next