FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2078421611> ?p ?o ?g. }

• W2078421611 endingPage "9245" @default.
• W2078421611 startingPage "9238" @default.
• W2078421611 abstract "Previous studies have shown that a single G protein-coupled receptor can regulate different effector systems by signaling through multiple subtypes of heterotrimeric G proteins. In LD2S fibroblast cells, the dopamine D2S receptor couples to pertussis toxin (PTX)-sensitive Gi/Goproteins to inhibit forskolin- or prostaglandin E1-stimulated cAMP production and to stimulate calcium mobilization. To analyze the role of distinct Gαi/oprotein subtypes, LD2S cells were stably transfected with a series of PTX-insensitive Gαi/o protein Cys → Ser point mutants and assayed for D2S receptor signaling after PTX treatment. The level of expression of the transfected Gα mutant subunits was similar to the endogenous level of the most abundant Gαi/o proteins (Gαo, Gαi3). D2S receptor-mediated inhibition of forskolin-stimulated cAMP production was retained only in clones expressing mutant Gαi2. In contrast, the D2S receptor utilized Gαi3 to inhibit PGE1-induced (Gs-coupled) enhancement of cAMP production. Following stable or transient transfection, no single or pair set of mutant Gαi/o subtypes rescued the D2S-mediated calcium response following PTX pretreatment. On the other hand, in LD2S cells stably transfected with GRK-CT, a receptor kinase fragment that specifically antagonizes Gβγ subunit activity, D2S receptor-mediated calcium mobilization was blocked. The observed specificity of Gαi2 and Gαi3 for different states of adenylyl cyclase activation suggests a higher level of specificity for interaction of Gαi subunits with forskolin- versus Gs-activated states of adenylyl cyclase than has been previously appreciated. Previous studies have shown that a single G protein-coupled receptor can regulate different effector systems by signaling through multiple subtypes of heterotrimeric G proteins. In LD2S fibroblast cells, the dopamine D2S receptor couples to pertussis toxin (PTX)-sensitive Gi/Goproteins to inhibit forskolin- or prostaglandin E1-stimulated cAMP production and to stimulate calcium mobilization. To analyze the role of distinct Gαi/oprotein subtypes, LD2S cells were stably transfected with a series of PTX-insensitive Gαi/o protein Cys → Ser point mutants and assayed for D2S receptor signaling after PTX treatment. The level of expression of the transfected Gα mutant subunits was similar to the endogenous level of the most abundant Gαi/o proteins (Gαo, Gαi3). D2S receptor-mediated inhibition of forskolin-stimulated cAMP production was retained only in clones expressing mutant Gαi2. In contrast, the D2S receptor utilized Gαi3 to inhibit PGE1-induced (Gs-coupled) enhancement of cAMP production. Following stable or transient transfection, no single or pair set of mutant Gαi/o subtypes rescued the D2S-mediated calcium response following PTX pretreatment. On the other hand, in LD2S cells stably transfected with GRK-CT, a receptor kinase fragment that specifically antagonizes Gβγ subunit activity, D2S receptor-mediated calcium mobilization was blocked. The observed specificity of Gαi2 and Gαi3 for different states of adenylyl cyclase activation suggests a higher level of specificity for interaction of Gαi subunits with forskolin- versus Gs-activated states of adenylyl cyclase than has been previously appreciated. guanine nucleotide-binding protein adenylyl cyclase intracellular calcium concentration fetal bovine serum pertussis toxin G protein insensitive to PTX Hepes-buffered balanced salt solution minimum Eagles's medium phospholipase C polymerase chain reaction prostaglandin E1 A wide variety of physiological functions and pathological conditions are regulated by hormones and neurotransmitters which transduce intracellular signals by coupling to heterotrimeric guanine nucleotide-binding proteins (G proteins).1 Upon receptor activation, G proteins dissociate into Gα and Gβγ subunits which in turn regulate the activity of effector molecules (1Neer E.J. Cell. 1995; 80: 249-257Abstract Full Text PDF PubMed Scopus (1280) Google Scholar, 2Bourne H.R. Curr. Opin. Cell Biol. 1997; 9: 134-142Crossref PubMed Scopus (524) Google Scholar, 3Raymond J.R. Am. J. Physiol. 1995; 38: F141-F158Google Scholar). The family of Gα subunits is divided into structural and functional homologues, for example, Gαs proteins couple positively to AC to increase intracellular production of cAMP; Gαi/o proteins couple negatively to AC and are inactivated by PTX; and Gαq proteins couple to PLC-β subtypes to increase [Ca2+]i and are insensitive to PTX. The Gβγ subunits of G proteins couple to a variety of cell-specific effectors including AC types II and IV, PLC-β2 and PLC-β3, inwardly rectifying potassium channels, and N-type calcium channels (4Birnbaumer L. Cell. 1992; 71: 1069-1072Abstract Full Text PDF PubMed Scopus (375) Google Scholar, 5Clapham D.E. Neer E.J. Annu. Rev. Pharmacol. Toxicol. 1997; 37: 167-203Crossref PubMed Scopus (697) Google Scholar). In addition, G protein-coupled receptors appear to utilize particular combinations of subunits to initiate specific types of responses (6Gudermann T. Kalkbrenner F. Schultz G. Annu. Rev. Pharmacol. Toxicol. 1996; 36: 429-459Crossref PubMed Scopus (332) Google Scholar). The dopamine D2S receptor couples to PTX-sensitive G proteins (Gi/o) to initiate multiple signaling pathways (7Civelli O. Bunzow J.R. Grandy D.K. Annu. Rev. Pharmacol. Toxicol. 1993; 33: 281-307Crossref PubMed Scopus (560) Google Scholar, 8Albert P.R. Vitam. Horm. 1994; 48: 59-109Crossref PubMed Scopus (25) Google Scholar). In cells of neuroendocrine origin the D2S couples to “inhibitory” pathways, including inhibition of adenylyl cyclase, activation of potassium channels to hyperpolarize the cell membrane, and inhibition of l-type calcium channels (9Castellano M.A. Liu L.X. Monsma F.J. Sibley D.R. Kapatos G. Chiodo L.A. Mol. Pharmacol. 1993; 44: 649-656PubMed Google Scholar, 10Einhorn L.C. Gregerson K.A. Oxford G.S. J. Neurosci. 1991; 11: 3727-3737Crossref PubMed Google Scholar, 11Lledo P.M. Homburger V. Bockaert J. Vincent J.D. Neuron. 1992; 8: 455-463Abstract Full Text PDF PubMed Scopus (176) Google Scholar, 12Memo M. Pizzi M. Belloni M. Benarese M. Spano P. J. Neurochem. 1992; 59: 1829-1835Crossref PubMed Scopus (11) Google Scholar), which in concert mediate inhibition of hormone secretion and gene transcription, and inhibition of cell proliferation (13Albert P.R. Neve K.A. Bunzow J.R. Civelli O. J. Biol. Chem. 1990; 265: 2098-2104Abstract Full Text PDF PubMed Google Scholar, 14Liu Y.F. Jakobs K.H. Rasenick M.M. Albert P.R. J. Biol. Chem. 1994; 269: 13880-13886Abstract Full Text PDF PubMed Google Scholar, 15Senogles S.E. Endocrinology. 1994; 134: 783-789Crossref PubMed Scopus (31) Google Scholar, 16Vallar L. Muca C. Magni M. Albert P. Bunzow J. Meldolesi J. Civelli O. J. Biol. Chem. 1990; 265: 10320-10326Abstract Full Text PDF PubMed Google Scholar, 17Lew A.M. Elsholtz H.P. J. Biol. Chem. 1995; 270: 7156-7160Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar, 18Elsholtz H.P. Lew A.M. Albert P.R. Sundmark V.C. J. Biol. Chem. 1991; 266: 22919-22925Abstract Full Text PDF PubMed Google Scholar). By contrast, when expressed in cells of mesenchymal lineage (e.g. Ltk− fibroblast or Chinese hamster ovary cells), the same receptor mediates stimulation of phospholipase C activity to induce calcium mobilization, and activation of the mitogen-activated protein kinase cascade leading to enhanced gene transcription and cell proliferation (8Albert P.R. Vitam. Horm. 1994; 48: 59-109Crossref PubMed Scopus (25) Google Scholar, 14Liu Y.F. Jakobs K.H. Rasenick M.M. Albert P.R. J. Biol. Chem. 1994; 269: 13880-13886Abstract Full Text PDF PubMed Google Scholar, 17Lew A.M. Elsholtz H.P. J. Biol. Chem. 1995; 270: 7156-7160Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar, 19Huff R.M. Lajiness M.E. J. Cell. Biochem. 1994; 18B: 220Google Scholar, 20Lajiness M.E. Chio C.L. Huff R.M. J. Pharmacol. Exp. Therap. 1993; 267: 1573-1581PubMed Google Scholar, 21Liu Y.F. Civelli O. Grandy D.K. Albert P.R. J. Neurochem. 1992; 59: 2311-2317Crossref PubMed Scopus (67) Google Scholar, 22Hayes G. Biden T.J. Selbie L.A. Shine J. Mol. Endocrinol. 1992; 6: 920-926Crossref PubMed Google Scholar, 23Tang L. Todd R.D. Heller A. O'Malley K.L. J. Pharmacol. Exp. Therap. 1994; 268: 495-502PubMed Google Scholar). These findings suggest that the same receptor mediates different cellular responses depending on the repertoire of cell-specific effectors that are expressed. To address the pathways that underlie cell-specific signaling we have studied the G protein specificity of D2S receptor coupling, based on the hypothesis that different G protein subunits mediate receptor coupling to inhibitory versus stimulatory signaling events. PTX acts to uncouple Gαi/o proteins by ADP-ribosylating these subunits at a conserved carboxyl-terminal domain cysteine (Cys) residue (24Yamane H.K. Fung B.K. Annu. Rev. Pharmacol. Toxicol. 1993; 33: 201-241Crossref PubMed Scopus (56) Google Scholar). By mutating the conserved Cys residue in Gαi1, Gαi2, Gαi3, and Gαo to a ribosylation-resistant serine (Ser) residue we have generated a series of PTX-insensitive mutants of Gαi/o protein (G-PTX). Because the Cys → Ser mutation is a structurally conservative change, the mutant G proteins remain functional following PTX pretreatment (25Taussig R. Sanchez S. RIfo M. Gilma A.G. Belardeti F. Neuron. 1992; 8: 799-809Abstract Full Text PDF PubMed Scopus (107) Google Scholar, 26Chuprun J.K. Raymond J.R. Blackshear P.J. J. Biol. Chem. 1997; 272: 773-781Crossref PubMed Scopus (33) Google Scholar, 27Ghahremani M.H. Albert P.R. Proceeding of the Society for Neuroscience. 21. Society for Neuroscience, San Diego1995: 1863Google Scholar, 28Hunt T.W. Carroll R.C. Peralta E.G. J. Biol. Chem. 1994; 269: 29565-29570Abstract Full Text PDF PubMed Google Scholar). We have assessed the contribution of individual or specific combinations of G protein subunits to D2S-mediated signaling. The D2S receptor utilizes distinct single Gα subunits to inhibit cAMP accumulation depending on the method of AC activation. In contrast, calcium mobilization induced by the D2S receptor is not reconstituted with single or combinations of Gα subunits, but is blocked by inhibiting Gβγ function. These results indicate a strong dependence on Gαi subtype for D2S-mediated inhibition of AC that is not observed for stimulation of calcium mobilization. Apomorphine, dopamine, EGTA, forskolin, PGE1, isobutylmethylxanthine, and PTX were from Sigma. Fura 2-AM was purchased from Molecular Probes (Eugene, OR) and hygromycin B from Calbiochem. 125I-Succinyl cAMP and polyvinylpyrrolidone membrane were from NEN Life Science Products Inc. and [α-32P]dCTP and ECL Western blot detection kits were from Amersham Corp. Sera, media, and Geneticin (G418) were obtained from Life Technologies, Inc. Plasmids pY3 and pCMV-LacZ II were obtained from the American Type Culture Collection (Manassas, VA). Endonucleases and DNA polymerase were purchased from New England Biolabs (Mississauga, Ontario, Canada). Taq polymerase has been purchased from Pharmacia Biotech Inc. (Baie d'Urfe, QB). The cDNAs encoding wild-type rat Gαo, Gαi1, Gαi2, and Gαi3 were generously provided by Dr. Randall Reed, Johns Hopkins University, Baltimore, MD. The Gαo antibody was from Santa Cruz Biotechnology Inc. (Santa Cruz, CA) and anti-Gαi1–2 and anti-Gαi3 were obtained from Calbiochem (San Diego, CA). Anti-RGS-His6 was purchased from Qiagen (Santa Clarita, CA). Murine Ltk− cells stably transfected with rat dopamine D2S receptor (LD2S) (13Albert P.R. Neve K.A. Bunzow J.R. Civelli O. J. Biol. Chem. 1990; 265: 2098-2104Abstract Full Text PDF PubMed Google Scholar) were maintained in minimum Eagle's medium (MEM) with 10% FBS in a humidified atmosphere of 5% CO2, 95% air at 37 °C. The cells were routinely passaged using 0.05% trypsin, 0.02% EDTA in HBBS. For PTX treatment, the cells were treated with 50 ng/ml PTX for 16 h prior to experimentation. Site-directed mutagenesis was performed using the Altered Sites IITM system (Promega). PTX-insensitive Gαi/o mutants were generated using rat cDNAs (29Jones D.T. Reed R.R. J. Biol. Chem. 1987; 262: 14241-14249Abstract Full Text PDF PubMed Google Scholar) encoding Gαo, Gαi1, Gαi2, and Gαi3 subunits. The cysteine 351 codon (352 for Gαi2), i.e. TGT, was mutated to TCT in order to encode serine using the following oligonucleotides: Gαo-PTX, TCCGGGGCTCTGGCTTGTA; Gαi1-PTX, AACCTAAAAGACTCTGGTC; Gαi2-PTX, ACAACCTGAAGGACTCTGGC, and Gαi3-PTX, AAGGAATCTGGGCTTTACT. The mutation was confirmed by endonuclease restriction analysis and Sanger dide- oxynucleotide sequencing. The mutant cDNAs were then subcloned into theEcoRI site of the pcDNA3 (Invitrogen) mammalian expression vector under control of the cytomegalovirus promoter. The OK-GRK2 cDNA (30Lembo P.M.C. Ghahremani M.H. Albert P.R. Mol. Endocrinol. 1999; 13: 138-147PubMed Google Scholar) was partially digested with BbsI and EcoRI endonuclease and the 1506-bp fragment encoding the COOH-terminal domain starting from Thr493 was isolated and used for the construct (GRK-CT). The His-tag was incorporated using the following complementary oligonucleotides: 5′-CACCATGCGAGGTAGTCACCACCACCACCACCACAC-3′ and 5′-CTTTGTGTGGTGGTGGTGGTGGTGACTACCTCGCATGGTGGTAC-3′. The two oligonucleotides were designed to encode Met-Arg-Gly-Ser-His6 with a Kozak sequence (31Kozak M. Cell. 1986; 44: 292-383Abstract Full Text PDF Scopus (3556) Google Scholar) in the NH2-terminal and cohesive KpnI site at the 5′ end and a BbsI site at the 3′ end. The oligonucleotides were annealed and ligated to GRK-CT fragment using BbsI-cohesive end (His-GRK-CT) and the His-GRK-CT fragment was cloned in pcDNA3 mammalian expression vector in KpnI/EcoRI site. The structure of the His-GRK-CT construct was confirmed by DNA sequencing. LD2S cells plated at 50% confluence were co-transfected with 30 μg each of the mutant Gα subunit constructs (Go-PTX, Gi1-PTX, Gi2-PTX, and Gi3-PTX) and 2 μg of pY3 using the calcium phosphate co-precipitation method (32Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar) and cultured in MEM, 10% FBS containing 400 μg/ml hygromycin-B for 2–3 weeks. Antibiotic-resistant clones of each transfection were picked (24 clones/transfection) and tested for the expression of corresponding Gα proteins using Northern blot analysis. Ltk− cells were plated at 30–40% confluent on 15-cm plates with MEM + 10% FBS. The cells were co-transfected with D2S-pcDNA3 using individual Gα subunit (Go-PTX, Gi1-PTX, Gi2-PTX, and Gi3-PTX) mutant constructs (30 or 60 μg) or the combination of two G proteins (Go/Gi1, Go/Gi2, Go/Gi3, Gi1/Gi2, Gi1/Gi3, and Gi2/Gi3; 30 μg/construct) and pCMV-LacZII (2 μg) using DEAE-dextran (33Morris S.J. Kriz R. Albert P.R. Proceeding of the Society for Neuroscience. 22. Society for Neuroscience, Washington, D. C.1996Google Scholar). Briefly, 1 volume (40 μl) of DNA in TBS was added dropwise to 2 volumes of DEAE-dextran (10 mg/ml) in TBS with agitation. The mixture was added dropwise to plates containing 12 ml of MEM + 1% FBS and the plates were incubated for 4 h at 37 °C, 5% CO2. The medium was aspirated and the cells were incubated in phosphate-buffered saline (136 mm NaCl, 2.68 mm KCl, 0.01 mmNa2HPO4, 1.78 μmKH2PO4, pH 7.4) with 10% dimethyl sulfoxide for 1 min. The plates were rinsed with phosphate-buffered saline and incubated in MEM + 10% FBS. After 36–48 h, the transfected cells were assayed for intracellular free calcium and β-galactosidase activity. A 100-μl portion (10%) of the transfected cells was resuspended in 100 μl of Reporter Lysis Buffer (Promega), incubated for 15 min at room temperature, centrifuged (14,000 rpm, 20 s) and the supernatant recovered. Equal volumes (30 μl each) of cell extract and substrate (0.3 μm4-methylumbelliferyl β-d-galactoside, 15 mmTris, pH 8.8) were mixed and incubated in the dark at 37 °C for 15 min. The reaction was terminated by addition of 50 μl of Stop solution (300 mm glycine, 15 mm EDTA, pH 11.2). Samples were transferred to 2 ml of Z buffer (60 mmNa2HPO4, 40 mmNaH2PO4, 10 mm KCl, 1 mm MgSO4) and fluorescence was measured at λEX = 350 nm, λEM = 450 nm in a Perkin-Elmer LS-50 spectrofluorometer (Buckinghamshire, United Kingdom). The transfection efficiencies differed by <10%. Cells (107/10-cm plate) were harvested and resuspended in 200 μl of RIPA-L buffer (10 mm Tris, pH 8, 1.5 mm MgCl2, 5 mm KCl, 0.5 mm dithiothreitol, 0.5 mm phenylmethylsulfonyl fluoride, 1% Nonidet P-40, 1% sodium lauryl sulfate, 0.5% sodium deoxycholate, 5 μg/ml leupeptin) on ice. The cell lysate was then passed through a G-25 needle three times to shear genomic DNA and incubated on ice. After 30 min, the lysate was centrifuged (10,000 × g, 10 min, 4 °C) and the supernatant recovered and assayed for protein content by the bicinchonic acid protein assay kit (Pierce). Lysates (100 μg/lane) were electrophoresed on sodium lauryl sulfate-containing 12% polyacrylamide gels at 100 V, 40 mA for 1 h, blotted on polyvinylpyrrolidone membranes for 1 h at 250 mA at 4 °C. Blots were incubated overnight in 5% nonfat dry milk in TBS-T (10 mm Tris, 150 mm NaCl, pH 8.0, 0.05% Tween 20) at 4 °C. The blots were then incubated for 1 h with primary antibody, followed by a 30-min incubation with horseradish peroxidase-conjugated secondary antibody at room temperature in TBS-T, and the peroxidase product was developed using the ECL for Western blot protocol. Total RNA was extracted from mouse brain tissue and LD2S cells using guanidium acetate and reverse-transcribed using SuperScript II RNase H− reverse transcriptase (Life Technologies Inc., Burlington, ON) and random hexamer primers (50 ng). The cDNAs were subjected to PCR with the following primer pairs (2 pmol/μl) designed using Primer Select program (DNASTAR Inc.) to amplify specific fragments of different AC subtypes (AC I-VI) with the indicated sizes (bp): ACI (444), 5′-CTGCGGGCGTGCGATGAGGA-GTTC and 5′-GCGCACGGGCAGCAGGGCATAG; ACII (425), 5′-GCTGGCGTCATAGGGGCTCAAAA and 5′-GGCACGCGCAGACACCAAACAGTA; ACIII (418), 5′-GGACGCCCTTCACCCACAACCAA and 5′-AGACCACCGCGCACATCACTACCA; ACIV (454), 5′-CACGGCCGGGATTGCGAGTAGC and 5′-TGCCGAGCCAGGACGAGGAGTGT; ACV (412), 5′-GAGCCCCAATGACCCCAGCCACTA and 5′-CGGGAGCGGCGCAATGATGAACT; ACVI (362), 5′-CCTGGCGGAAGCTGTGTCGGTTAC and 5′-GCGGTCAGTGGCCTTGGGGTTTG. The PCR reaction was performed with different concentrations of cDNA (0.1, 0.5, and 1 μg/reaction) and repeated at least 2 times. The amplified DNA fragment was subcloned into pGEM-T Easy vector (Promega) and sequenced by the Sanger dideoxynucleotide chain termination using modified T7 DNA polymerase (Pharmacia Biotech Inc.). Equivalent numbers of cells were plated in 6-well plates and grown to 70–80% confluence. After rinsing with HBBS buffer (118 mm NaCl, 4.6 mm KCl, 1.0 mm CaCl2, 10 mmd-glucose, and 20 mm Hepes, pH 7.2) the cells were incubated with or without experimental compounds in 1 ml/well of HBBS + 100 μm isobutylmethylxanthine at 37 °C. After 20 min the media were recovered and stored at −20 °C. Samples were analyzed by specific radioimmunoassay to detect cAMP (34Liu Y.F. Albert P.R. J. Biol. Chem. 1991; 266: 23689-23697Abstract Full Text PDF PubMed Google Scholar). Percent inhibition was calculated using the following formula: % inhibition = 100 − [100(D-C)/(S-C)], where D = cAMP in dopamine-treated cells; C = control or nontreated cells (basal cAMP); S = stimulated cAMP in forskolin- or PGE1-treated cells. Cells were grown to 80% confluence, harvested with trypsin/EDTA, resuspended in 1 ml of HBBS with 2 μm Fura-2 AM and incubated at 37 °C for 45 min with shaking (100 rpm). The cells were washed twice with HBBS, resuspended in 2 ml of HBBS, and subjected to fluorometric measurement. The fluorescence ratio of Fura-2 was monitored in a Perkin-Elmer LS-50 spectrofluorometer at λEX = 340/380 nm and λEM = 510 nm. Calibration was done using 0.1% Triton X-100 and 20 mm Tris base to determineR max and 10 mm EGTA (pH > 8) to obtain R min (34Liu Y.F. Albert P.R. J. Biol. Chem. 1991; 266: 23689-23697Abstract Full Text PDF PubMed Google Scholar) and the fluorescence ratio was converted to [Ca2+]i based on aK d of 227 nm for the Fura 2-calcium complex. Experimental compounds were added directly to cuvette from 100-fold concentrated solutions at the times indicated in the figures. The data are presented as mean ± S.E. of at least three independent experiments. The data were analyzed by repeated measure using ANOVA for each set of experiments. The percent inhibition data was analyzed with repeated measure using ANOVA and the data from G-PTX expressing clones were compared with LD2S cell (wild type) using Bonferroni multiple comparison post-test. In order to investigate the importance of individual Gα subtypes in dopamine-mediated responses, PTX-insensitive mutants of Gαi/o were generated and stably transfected into LD2S cells (Ltk− cells stably transfected with the rat D2S receptor cDNA). Transfected clones expressing the highest levels of individual mutant Gαi/o RNA were identified by Northern blot analysis (data not shown) and were named RGo, RGi1, RGi2, and RGi3 for clones expressing Gαo-PTX, Gαi1-PTX, Gαi2-PTX, and Gαi3-PTX, respectively. Cell extracts from clones of interest were subjected to Western blot analysis to assess at the protein level the overexpression of Gα proteins (Fig. 1). Wild-type LD2S cells expressed all four Gαi/o subunits, although Gαo and Gαi3 appeared to be the most abundant based on densitometric analysis. Comparison of Gαo and Gαi3 expression in each transfectant to LD2S (wild type) indicates that transfectant cell lines expressed approximately 2-fold more than the corresponding endogenous Gα subunit. This indicates that approximately equal amounts of mutant and wild-type protein were produced in the transfected cell lines. In LD2S cells, dopamine did not alter the basal cAMP production (21Liu Y.F. Civelli O. Grandy D.K. Albert P.R. J. Neurochem. 1992; 59: 2311-2317Crossref PubMed Scopus (67) Google Scholar). Upon addition of forskolin (10 μm), cAMP levels were increased by 4.5-fold compared with basal (2.22 ± 0.17 versus 0.50 ± 0.04 pmol/ml) (Fig. 2 A). Dopamine (10 μm) inhibited forskolin-stimulated cAMP accumulation in these cells by 84.5 ± 12.2% (n = 5), an action that was mimicked by apomorphine (1 μm, not shown) and was largely reversed by pretreatment with PTX (Fig.2 A), indicating the involvement of Gi/oproteins. PGE1 has been shown to induce a concentration-dependent increase in cAMP production indicating the presence of endogenous Gs-coupled PGE1 receptors (30Lembo P.M.C. Ghahremani M.H. Albert P.R. Mol. Endocrinol. 1999; 13: 138-147PubMed Google Scholar). In LD2S cells, PGE1 (1 μm) increased cAMP accumulation by 7–8-fold basal cAMP (1.65 ± 0.25 versus 0.196 ± 0.002 pmol/ml) (Fig.2 B). The greater effect of PGE1 may be related to the specific isoforms of adenylyl cyclase present in LD2S cells. Activation of D2S receptors with apomorphine (1 μm) inhibited PGE1-induced cAMP production by 66.3 ± 7.3% (Fig. 2 B) and this action of apomorphine was largely reversed after PTX treatment, implicating Gαi/oproteins. The PTX sensitivity of dopamine-mediated inhibition of forskolin-induced cAMP production was examined in wild-type LD2S and stable clones expressing the mutant Gα subunits. Dopamine inhibited forskolin-stimulated cAMP accumulation in all clones expressing mutant Gαi/o proteins, as observed in LD2S cells (wild type). However, PTX blocked dopamine action in all clones except for those clones which express the mutant Gi2-PTX. In multiple experiments, the percent inhibition by dopamine of forskolin-stimulated cAMP accumulation was unaltered by PTX in only RGi2–3 and RGi2–4 clones, whereas in other clones a significant attenuation of dopamine action by PTX was observed (Fig.3). These results indicate that the PTX-insensitive mutant of Gαi2 is functional and that Gαi2 is the only subunit required for D2S-mediated inhibition of forskolin-induced cAMP production in LD2S cells. The ability of D2S receptor activation to inhibit Gs-coupled stimulation of cAMP accumulation was tested in the LD2S clones expressing PTX-insensitive G proteins. In these clones PGE1 (1 μm) induced a 7–8-fold increase in basal cAMP and apomorphine inhibited PGE1-stimulated cAMP production by 60–70%, comparable to wild-type LD2S cells. Upon pretreatment with PTX, apomorphine-mediated inhibition was completely reversed in RGo, RGi1, and RGi2 clones. In contrast, PTX treatment of the RGi3-2 clone did not block apomorphine-mediated inhibition of the PGE1 response. In multiple experiments, clone RGi3-2 retained significantly higher dopamine inhibitory activity following PTX treatment than any of the other clones (Fig. 4). Thus, the inhibitory action of the D2S receptor on Gs-coupled enhancement of cAMP is mediated through the Gαi3 subunit, rather than the Gαi2 subunit as observed for forskolin-induced cAMP accumulation. These results show that the D2S receptor utilizes distinct Gαi subtypes to inhibit forskolin- or Gs-stimulated adenylyl cyclase activity. To further investigate the role of AC expression in LD2S cells, we performed semi-quantitative reverse transcriptase-PCR to determine the relative expression of AC subtypes I-VI, since their regulation has been well characterized compare with other subtypes (VII-X) (21Liu Y.F. Civelli O. Grandy D.K. Albert P.R. J. Neurochem. 1992; 59: 2311-2317Crossref PubMed Scopus (67) Google Scholar, 35Nevo I. Avidorreiss T. Levy R. Bayewitch M. Heldman E. Vogel Z. Mol. Pharmacol. 1998; 54: 419-426Crossref PubMed Scopus (60) Google Scholar, 36Sunahara R.K. Dessauer C.W. Gilman A.G. Annu. Rev. Pharmacol. Toxicol. 1996; 36: 461-480Crossref PubMed Scopus (727) Google Scholar, 37Sutkowski E.M. Tang W.J. Broome C.W. Robbins J.D. Seamon K.B. Biochemistry. 1994; 33: 12852-12859Crossref PubMed Scopus (105) Google Scholar). The PCR was performed with different concentrations of cDNA (0.1, 0.5, and 1.0 μg/reaction) and repeated at least twice for each concentration. Each PCR reaction amplified a single, specific product with the predicted sized for each AC subtypes, and the sequence was confirmed by sequencing the subcloned fragment. The specificity of the primers used was not altered with change in cDNA concentration, but the intensity of the product increased with concentration (TableI). Mouse brain RNA was used as positive control and was found to express all the subtypes of AC (data not shown). In LD2S cells, RNA for AC I and VI was expressed more abundantly than AC III, AC IV, and AC II (ACI = ACVI > ACIII > ACIV > ACII) and AC V RNA was not detected in these cells (Table I). These results indicate that LD2S cells express AC subtypes at different levels, which may direct the specificity of signaling through AC in these cells.Table IExpression of different adenylyl cyclase subtypes in LD2S cellsAdenylyl cyclasecDNA concentration (μg/reaction)aThe reverse transcriptase-PCR was performed for ACI-VI with 0.1, 0.5, and 1.0 μg of cDNA as indicated. The data have been obtained from at least two independent experiments for each condition. Specific primers for each subtype of AC amplified only a single product with the predicted size corresponding to the subtype they have been targeted to. Positive (+) and negative (−) signs indicate the presence and the absence of the specific product on ethidium bromide stained gels, respectively, and “±” represents a weakly detectable product. As a positive control, all primer pairs yielded same size products from mouse brain RNA (not shown).0.10.51.0ACI+++ACII−−±ACIII−++ACIV−±±ACV−−±ACVI+++a The reverse transcriptase-PCR was performed for ACI-VI with 0.1, 0.5, and 1.0 μg of cDNA as indicated. The data have been obtained from at least two independent experiments for each condition. Specific primers for each subtype of AC amplified only a single product with the predicted size corresponding to the subtype they have been targeted to. Positive (+) and negative (−) signs indicate the presence and the absence of the specific product on ethidium bromide stained gels, respectively, and “±” represents a weakly detectable product. As a positive control, all primer pairs yielded same size products from mouse brain RNA (not shown). Open table in a new tab In LD2S cells, the D2S receptor couples to PI turnover to induce mobilization of calcium from ionomycin-sensitive intracellular stores (8Albert P.R. Vitam. Horm. 1994; 48: 59-109Crossref PubMed Scopus (25) Google Scholar). In LD2S cells dopamine induced a 2–2.5-fold increase in [Ca2+]i (Fig.5) which was blocked by the D2 receptor antagonist spiperone and was not observed in D2 receptor-negative Ltk− cells (data not shown), indicating that this effect is mediated by the D2S receptor. The increase in [Ca2+]i induced by dopamine was completely inhibited by PTX pretreatment, suggesting mediation via Gi/o proteins. Each of the clones expressing mutant G proteins responded to dopamine with a 2–2.5-fold increase in [Ca2+]i (Fig.6). Following pretreatment with PTX, none of the mutant G protein transfectants exhibited a D2S-mediated calcium response (Fig. 6). In order to test whether more than one G protein could rescue the calcium response, Ltk− cells were transfected with different pairs of the four G-PTX mutant constructs along with D2S receptor and assayed for [Ca2+]i. In all sets dopamine increased [Ca2+]i by 1.6-fold (Fig. 6), similar to that in LD2S cells (33Morris S.J. Kriz R. Albert P.R. Proceeding of the Society for Neuroscience. 22. Society for Neuroscience, Washington, D. C.1996Google Scholar). This indicates that the Ltk− cells express sufficient levels of transiently transfected cDNAs to mediate a full function" @default.
• W2078421611 created "2016-06-24" @default.
• W2078421611 creator A5002795098 @default.
• W2078421611 creator A5010364776 @default.
• W2078421611 creator A5017131080 @default.
• W2078421611 creator A5042565553 @default.
• W2078421611 date "1999-04-01" @default.
• W2078421611 modified "2023-10-02" @default.
• W2078421611 title "Distinct Roles for Gαi2, Gαi3, and Gβγ in Modulation of Forskolin- or Gs-mediated cAMP Accumulation and Calcium Mobilization by Dopamine D2S Receptors" @default.
• W2078421611 cites W1419666919 @default.
• W2078421611 cites W1500720615 @default.
• W2078421611 cites W1504031944 @default.
• W2078421611 cites W1509652229 @default.
• W2078421611 cites W1520595787 @default.
• W2078421611 cites W1522062003 @default.
• W2078421611 cites W1532616107 @default.
• W2078421611 cites W1548069410 @default.
• W2078421611 cites W1554714271 @default.
• W2078421611 cites W1584883312 @default.
• W2078421611 cites W1894685331 @default.
• W2078421611 cites W1931572133 @default.
• W2078421611 cites W1973613428 @default.
• W2078421611 cites W1979148478 @default.
• W2078421611 cites W1984212762 @default.
• W2078421611 cites W1992334846 @default.
• W2078421611 cites W2015860873 @default.
• W2078421611 cites W2025818505 @default.
• W2078421611 cites W2028965457 @default.
• W2078421611 cites W2031789967 @default.
• W2078421611 cites W2036341774 @default.
• W2078421611 cites W2049513959 @default.
• W2078421611 cites W2052624003 @default.
• W2078421611 cites W2055449125 @default.
• W2078421611 cites W2060999820 @default.
• W2078421611 cites W2104529835 @default.
• W2078421611 cites W2114777086 @default.
• W2078421611 cites W2117514208 @default.
• W2078421611 cites W2144001627 @default.
• W2078421611 cites W2154128645 @default.
• W2078421611 cites W2160146943 @default.
• W2078421611 cites W2160392761 @default.
• W2078421611 cites W2168808956 @default.
• W2078421611 cites W2172659222 @default.
• W2078421611 cites W2184174642 @default.
• W2078421611 cites W4231195547 @default.
• W2078421611 cites W1974076465 @default.
• W2078421611 doi "https://doi.org/10.1074/jbc.274.14.9238" @default.
• W2078421611 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10092597" @default.
• W2078421611 hasPublicationYear "1999" @default.
• W2078421611 type Work @default.
• W2078421611 sameAs 2078421611 @default.
• W2078421611 citedByCount "84" @default.
• W2078421611 countsByYear W20784216112012 @default.
• W2078421611 countsByYear W20784216112013 @default.
• W2078421611 countsByYear W20784216112014 @default.
• W2078421611 countsByYear W20784216112017 @default.
• W2078421611 countsByYear W20784216112018 @default.
• W2078421611 countsByYear W20784216112019 @default.
• W2078421611 countsByYear W20784216112021 @default.
• W2078421611 countsByYear W20784216112023 @default.
• W2078421611 crossrefType "journal-article" @default.
• W2078421611 hasAuthorship W2078421611A5002795098 @default.
• W2078421611 hasAuthorship W2078421611A5010364776 @default.
• W2078421611 hasAuthorship W2078421611A5017131080 @default.
• W2078421611 hasAuthorship W2078421611A5042565553 @default.
• W2078421611 hasBestOaLocation W20784216111 @default.
• W2078421611 hasConcept C120069818 @default.
• W2078421611 hasConcept C126322002 @default.
• W2078421611 hasConcept C134018914 @default.
• W2078421611 hasConcept C156708679 @default.
• W2078421611 hasConcept C170493617 @default.
• W2078421611 hasConcept C17744445 @default.
• W2078421611 hasConcept C185592680 @default.
• W2078421611 hasConcept C199539241 @default.
• W2078421611 hasConcept C2779276759 @default.
• W2078421611 hasConcept C513476851 @default.
• W2078421611 hasConcept C519063684 @default.
• W2078421611 hasConcept C71924100 @default.
• W2078421611 hasConcept C86803240 @default.
• W2078421611 hasConceptScore W2078421611C120069818 @default.
• W2078421611 hasConceptScore W2078421611C126322002 @default.
• W2078421611 hasConceptScore W2078421611C134018914 @default.
• W2078421611 hasConceptScore W2078421611C156708679 @default.
• W2078421611 hasConceptScore W2078421611C170493617 @default.
• W2078421611 hasConceptScore W2078421611C17744445 @default.
• W2078421611 hasConceptScore W2078421611C185592680 @default.
• W2078421611 hasConceptScore W2078421611C199539241 @default.
• W2078421611 hasConceptScore W2078421611C2779276759 @default.
• W2078421611 hasConceptScore W2078421611C513476851 @default.
• W2078421611 hasConceptScore W2078421611C519063684 @default.
• W2078421611 hasConceptScore W2078421611C71924100 @default.
• W2078421611 hasConceptScore W2078421611C86803240 @default.
• W2078421611 hasIssue "14" @default.
• W2078421611 hasLocation W20784216111 @default.
• W2078421611 hasOpenAccess W2078421611 @default.
• W2078421611 hasPrimaryLocation W20784216111 @default.
• W2078421611 hasRelatedWork W1975696001 @default.
• W2078421611 hasRelatedWork W1984070948 @default.

• next