FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2078461132> ?p ?o ?g. }

• W2078461132 endingPage "24818" @default.
• W2078461132 startingPage "24808" @default.
• W2078461132 abstract "In the course of decidualization, human endometrial stromal cells (ESC) activate the alternative upstream promoter of the decidual prolactin (dPRL) gene. The dPRL promoter is induced by the protein kinase A pathway in a delayed fashion via the region −332/−270 which contains two overlapping consensus binding sequences, B and D, for CCAAT/enhancer-binding proteins (C/EBP). Here we show that sites B and D both bind C/EBPβ and -δ from ESC nuclear extracts. When decidualization of cultured ESC was induced by treatment with 8-Br-cAMP, complex formation on sites B and D was enhanced. Western blot analysis revealed an elevation of both C/EBPβ isoforms, liver-enriched activator protein and liver-enriched inhibitory protein, with a delayed onset between 8 and 24 h of cAMP treatment, while C/EBPδ expression remained unaffected. Cyclic AMP-mediated activation of dPRL promoter construct dPRL-332/luc3 was abrogated by mutation of sites B and D at −310/−285. An expression vector for liver-enriched activator protein potently induced transcription of dPRL-332/luc3 and further enhanced cAMP-mediated induction, while liver-enriched inhibitory protein expression vector abolished the cAMP response, implying that C/EBPs serve as mediators in the delayed cAMP signal transduction to the dPRL promoter. The ratio between activating and repressing isoforms is likely to dictate the transcriptional output. In the course of decidualization, human endometrial stromal cells (ESC) activate the alternative upstream promoter of the decidual prolactin (dPRL) gene. The dPRL promoter is induced by the protein kinase A pathway in a delayed fashion via the region −332/−270 which contains two overlapping consensus binding sequences, B and D, for CCAAT/enhancer-binding proteins (C/EBP). Here we show that sites B and D both bind C/EBPβ and -δ from ESC nuclear extracts. When decidualization of cultured ESC was induced by treatment with 8-Br-cAMP, complex formation on sites B and D was enhanced. Western blot analysis revealed an elevation of both C/EBPβ isoforms, liver-enriched activator protein and liver-enriched inhibitory protein, with a delayed onset between 8 and 24 h of cAMP treatment, while C/EBPδ expression remained unaffected. Cyclic AMP-mediated activation of dPRL promoter construct dPRL-332/luc3 was abrogated by mutation of sites B and D at −310/−285. An expression vector for liver-enriched activator protein potently induced transcription of dPRL-332/luc3 and further enhanced cAMP-mediated induction, while liver-enriched inhibitory protein expression vector abolished the cAMP response, implying that C/EBPs serve as mediators in the delayed cAMP signal transduction to the dPRL promoter. The ratio between activating and repressing isoforms is likely to dictate the transcriptional output. endometrial stromal cells prolactin decidual PRL cyclic AMP response element CRE-like element CCAAT/enhancer-binding protein liver-enriched activator protein liver-enriched inhibitory protein electrophoretic mobility shift assay activation domain DNA-binding domain protein kinase A CRE-binding protein interleukin activation domain reverse transcriptase-polymerase chain reaction glyceraldehyde-3-phosphate dehydrogenase Decidualization is a differentiation process of the endometrium in preparation for blastocyst implantation. In humans this process is independent of the presence of a blastocyst and is first apparent in the stromal cells surrounding the spiral arteries in the second half of the luteal phase. The key stimulus for decidualization in vivo is progesterone acting on an estrogen-primed uterus, however, in vitro in cultured endometrial stromal cells (ESC),1 progesterone only acts as a weak inducer of decidualization (1Daly D.C. Maslar I.A. Riddick D.H. Am. J. Obstet. Gynecol. 1983; 145: 672-678Abstract Full Text PDF PubMed Scopus (122) Google Scholar). Its action is synergistically enhanced by a number of factors such as prostaglandin E2, corticotropin releasing factor, and gonadotropin free α-subunit (2Frank G.R. Brar A.K. Cedars M.I. Handwerger S. Endocrinology. 1994; 134 (ss): 258-263Crossref PubMed Scopus (116) Google Scholar, 3Ferrari A. Petraglia F. Gurpide E. J. Steroid Biochem. Mol. Biol. 1995; 54: 251-255Crossref PubMed Scopus (92) Google Scholar, 4Nemansky M. Moy E. Lyons C.D., Yu, I. Blithe D.L. J. Clin. Endocrinol. Metab. 1998; 83: 575-581Crossref PubMed Scopus (33) Google Scholar). In fact, in vitro decidualization of ESC can be triggered in the absence of progesterone by agents that elevate intracellular cAMP levels, including gonadotropins, relaxin, or cAMP analogs (3Ferrari A. Petraglia F. Gurpide E. J. Steroid Biochem. Mol. Biol. 1995; 54: 251-255Crossref PubMed Scopus (92) Google Scholar, 5Tang B. Gurpide E. J. Steroid Biochem. Mol. Biol. 1993; 47: 115-121Crossref PubMed Scopus (123) Google Scholar, 6Huang J.R. Tseng L. Bischof P. Jänne O.A. Endocrinology. 1987; 121: 2011-2017Crossref PubMed Scopus (188) Google Scholar, 7Zhu H.H. Huang J.R. Mazella J. Rosenberg M. Tseng L. J. Clin. Endocrinol. Metab. 1990; 71: 889-899Crossref PubMed Scopus (68) Google Scholar, 8Tabanelli S. Tang B. Gurpide E. J. Steroid Biochem. Mol. Biol. 1992; 42: 337-344Crossref PubMed Scopus (125) Google Scholar, 9Tang B. Guller S. Gurpide E. Endocrinology. 1993; 133: 2197-2203Crossref PubMed Scopus (88) Google Scholar). Induction of prolactin (PRL) gene expression serves as a decidualization marker in human ESC (8Tabanelli S. Tang B. Gurpide E. J. Steroid Biochem. Mol. Biol. 1992; 42: 337-344Crossref PubMed Scopus (125) Google Scholar, 10Irwin J.C. Kirk D. King R.J.B. Quigley M.M. Gwatkin R.B.L. Fertil. Steril. 1989; 52: 761-768Abstract Full Text PDF PubMed Scopus (244) Google Scholar). PRL expressed in the human endometrium is referred to as decidual PRL (dPRL) to distinguish it from pituitary-derived PRL. Transcription of the human PRL gene is driven by two alternative tissue-specific promoters, the dPRL promoter being located approximately 5.7 kilobases upstream of the pituitary promoter at an additional non-coding exon 1A (11DiMattia G.E. Gellersen B. Duckworth M.L. Friesen H.G. J. Biol. Chem. 1990; 265: 16412-16421Abstract Full Text PDF PubMed Google Scholar, 12Gellersen B. Kempf R. Telgmann R. DiMattia G.E. Mol. Endocrinol. 1994; 8: 356-373Crossref PubMed Scopus (225) Google Scholar, 13Berwaer M. Martial J.A. Davis J.R.E. Mol. Endocrinol. 1994; 8: 635-642Crossref PubMed Scopus (118) Google Scholar). Utilization of the dPRL promoter has been detected in decidualized endometrial stroma, in myometrial smooth muscle cells, and in hematopoietic cells (12Gellersen B. Kempf R. Telgmann R. DiMattia G.E. Mol. Endocrinol. 1994; 8: 356-373Crossref PubMed Scopus (225) Google Scholar, 13Berwaer M. Martial J.A. Davis J.R.E. Mol. Endocrinol. 1994; 8: 635-642Crossref PubMed Scopus (118) Google Scholar, 14Gellersen B. Bonhoff A. Hunt N. Bohnet H.G. Endocrinology. 1991; 129: 158-168Crossref PubMed Scopus (64) Google Scholar, 15Pellegrini I. Lebrun J.J. Ali S. Kelly P.A. Mol. Endocrinol. 1992; 6: 1023-1031Crossref PubMed Scopus (229) Google Scholar), and is specific to humans and primates (16Brown N.A. Bethea C.L. Biol. Reprod. 1994; 50: 543-552Crossref PubMed Scopus (14) Google Scholar). Little is known about the molecular mechanisms governing dPRL promoter control. Cyclic AMP, which is a major decidualization stimulus in vitro, also controls dPRL gene transcription (12Gellersen B. Kempf R. Telgmann R. DiMattia G.E. Mol. Endocrinol. 1994; 8: 356-373Crossref PubMed Scopus (225) Google Scholar). We have shown previously that the cAMP response of the transfected dPRL promoter in ESC occurs in two phases. An early weak induction, mediated by an imperfect cAMP response element (CRE-L) at position −12 relative to the major transcriptional start site, is detectable within 6 h of treatment with 8-Br-cAMP. This is followed by a delayed strong induction which sets in after 12–18 h of stimulation and is dependent on the dPRL promoter region −332/−270 (17Telgmann R. Maronde E. Taskén K. Gellersen B. Endocrinology. 1997; 138: 929-937Crossref PubMed Scopus (118) Google Scholar). Mutation of the CRE-L abolishes the early, but not the delayed cAMP-mediated induction of promoter activity (17Telgmann R. Maronde E. Taskén K. Gellersen B. Endocrinology. 1997; 138: 929-937Crossref PubMed Scopus (118) Google Scholar). Computerized search for transcription factor binding sequences revealed two consensus sites for members of the CCAAT/enhancer-binding protein (C/EBP) family in the dPRL-332/-270 promoter fragment. C/EBP factors belong to the superfamily of basic region/leucine zipper DNA-binding proteins (18Landschulz W.H. Johnson P.F. McKnight S.L. Science. 1988; 240: 1759-1764Crossref PubMed Scopus (2534) Google Scholar). So far, six members of the C/EBP family have been described: C/EBPα, -β, -δ, -ε, -γ and -ζ (reviewed in Ref. 19Lekstrom-Himes J. Xanthopoulos K.G. J. Biol. Chem. 1998; 273: 28545-28548Abstract Full Text Full Text PDF PubMed Scopus (688) Google Scholar). C/EBPα, -β, and -δ are found in liver, adipose tissue, intestine, lung, cells of the inflammatory system, and in reproductive tissues, while C/EBPε is restricted to myeloid and lymphoid lineages (19Lekstrom-Himes J. Xanthopoulos K.G. J. Biol. Chem. 1998; 273: 28545-28548Abstract Full Text Full Text PDF PubMed Scopus (688) Google Scholar, 20Sterneck E. Tessarollo L. Johnson P.F. Genes Dev. 1997; 11: 2153-2162Crossref PubMed Scopus (342) Google Scholar, 21Seagroves T.N. Krnacik S. Raught B. Gay J. Burgess-Beusse B. Darlington G.J. Rosen J.M. Genes Dev. 1998; 12: 1917-1928Crossref PubMed Scopus (214) Google Scholar, 22Robinson G.W. Johnson P.F. Hennighausen L. Sterneck E. Genes Dev. 1998; 12: 1907-1916Crossref PubMed Scopus (219) Google Scholar, 23Raught B. Warren S.-L.L. Rosen J.M. Mol. Endocrinol. 1995; 9: 1223-1232PubMed Google Scholar, 24Pall M. Hellberg P. Brännström M. Mikuni M. Peterson C.M. Sundfeldt K. Nordén B. Hedin L. Enerbäck S. EMBO J. 1997; 16: 5273-5279Crossref PubMed Scopus (49) Google Scholar, 25Sirois J. Richards J.S. J. Biol. Chem. 1993; 268: 21931-21938Abstract Full Text PDF PubMed Google Scholar, 26Grønning L.M. Dahle M.K. Taskén K.A. Enerbäck S. Hedin L. Taskén K. Knutsen H.K. Endocrinology. 1999; 140: 835-843Crossref PubMed Scopus (0) Google Scholar, 27Chumakov A.M. Grillier I. Chumakova E. Chih D. Slater J. Koeffler H.P. Mol. Cell. Biol. 1997; 17: 1375-1386Crossref PubMed Google Scholar). Specificity of gene control by C/EBPs is ensured through their ability to homo- and heterodimerize and to interact with other transcription factors, together with cell-specific and temporal expression patterns and different transactivation potentials (28Yeh W.-C. Cao Z. Classon M. McKnight S.L. Genes Dev. 1995; 9: 168-181Crossref PubMed Scopus (809) Google Scholar, 29Kinoshita S. Akira S. Kishimoto T. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 1473-1476Crossref PubMed Scopus (258) Google Scholar, 30Roesler W.J. Park E.A. McFie P.J. J. Biol. Chem. 1998; 273: 14950-14957Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar, 31Chang C.J. Chen Y.L. Lee S.C. Mol. Cell. Biol. 1998; 18: 5880-5887Crossref PubMed Google Scholar, 32Lu M. Seufert J. Habener J.F. J. Biol. Chem. 1997; 272: 28349-28359Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar, 33Lee Y.-H. Williams S.C. Baer M. Sterneck E. Gonzalez F.J. Johnson P.F. Mol. Cell. Biol. 1997; 17: 2038-2047Crossref PubMed Google Scholar, 34McNagny K.M. Sieweke M.H. Doderlein G. Graf T. Nerlov C. EMBO J. 1998; 17: 3669-3680Crossref PubMed Scopus (106) Google Scholar, 35Chen P.-L. Riley D.J. Chen-Kiang S. Lee W.-H. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 465-469Crossref PubMed Scopus (197) Google Scholar, 36Miau L.H. Chang C.J. Tsai W.H. Lee S.C. Mol. Cell. Biol. 1997; 17: 230-239Crossref PubMed Scopus (58) Google Scholar, 37Nerlov C. Ziff E.B. EMBO J. 1995; 14: 4318-4328Crossref PubMed Scopus (134) Google Scholar). C/EBPβ was originally identified as a mediator of interleukin-6 (IL6) signaling and is therefore also known as NF-IL6 (38Akira S. Isshiki H. Sugita T. Tanabe O. Kinoshita S. Nishio Y. Nakajima T. Hirano T. Kishimoto T. EMBO J. 1990; 9: 1897-1906Crossref PubMed Scopus (1210) Google Scholar, 39Poli V. J. Biol. Chem. 1998; 273: 29279-29282Abstract Full Text Full Text PDF PubMed Scopus (554) Google Scholar). The related factor C/EBPδ is occasionally designated NF-IL6β (29Kinoshita S. Akira S. Kishimoto T. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 1473-1476Crossref PubMed Scopus (258) Google Scholar). From the single C/EBPβ mRNA, protein isoforms with different functions can be generated by a leaky ribosomal scanning mechanism involving three methionine residues in the intronless C/EBPβ gene, Met1, Met24, and Met199. Proteins initiated at Met1 or Met24 have a calculated molecular mass of about 36 and 33.5 kDa and are referred to as LAP (liver-enriched activator protein) whereas translation initiation at Met199results in the 16-kDa isoform LIP (liver-enriched inhibitory protein) which lacks the transactivation domain of the longer forms. LIP readily heterodimerizes with LAP, counteracting its activation potential in substoichiometric amounts and therefore acts as a potent repressor (40Descombes P. Schibler U. Cell. 1991; 67: 569-579Abstract Full Text PDF PubMed Scopus (859) Google Scholar). Several lines of evidence indicate an important role for C/EBPs as mediators of hormonal signals in reproductive tissues. C/EBPβ is regulated by gonadotropins in the ovary and testis (20Sterneck E. Tessarollo L. Johnson P.F. Genes Dev. 1997; 11: 2153-2162Crossref PubMed Scopus (342) Google Scholar, 24Pall M. Hellberg P. Brännström M. Mikuni M. Peterson C.M. Sundfeldt K. Nordén B. Hedin L. Enerbäck S. EMBO J. 1997; 16: 5273-5279Crossref PubMed Scopus (49) Google Scholar, 25Sirois J. Richards J.S. J. Biol. Chem. 1993; 268: 21931-21938Abstract Full Text PDF PubMed Google Scholar, 26Grønning L.M. Dahle M.K. Taskén K.A. Enerbäck S. Hedin L. Taskén K. Knutsen H.K. Endocrinology. 1999; 140: 835-843Crossref PubMed Scopus (0) Google Scholar, 41Nalbant D. Williams S.C. Stocco D.M. Khan S.A. Endocrinology. 1998; 139: 272-279Crossref PubMed Scopus (74) Google Scholar). Deletion of the C/EBPβ gene in female mice leads to sterility, caused by the inability to form corpora lutea (20Sterneck E. Tessarollo L. Johnson P.F. Genes Dev. 1997; 11: 2153-2162Crossref PubMed Scopus (342) Google Scholar). C/EBPβ is also an essential factor for mammary gland differentiation and proliferation (21Seagroves T.N. Krnacik S. Raught B. Gay J. Burgess-Beusse B. Darlington G.J. Rosen J.M. Genes Dev. 1998; 12: 1917-1928Crossref PubMed Scopus (214) Google Scholar, 22Robinson G.W. Johnson P.F. Hennighausen L. Sterneck E. Genes Dev. 1998; 12: 1907-1916Crossref PubMed Scopus (219) Google Scholar). In this study we demonstrate for the first time the presence of C/EBP transcription factors in human endometrial stroma, an interaction between C/EBP family members and the dPRL promoter, and their involvement in cAMP-induced dPRL gene expression. Primary cultures of purified human ESC were prepared and maintained as described previously (12Gellersen B. Kempf R. Telgmann R. DiMattia G.E. Mol. Endocrinol. 1994; 8: 356-373Crossref PubMed Scopus (225) Google Scholar, 17Telgmann R. Maronde E. Taskén K. Gellersen B. Endocrinology. 1997; 138: 929-937Crossref PubMed Scopus (118) Google Scholar). Cells of the first passage were used for transfections and for extraction of nuclear and cytoplasmic protein and RNA. Primary cultures of myometrial smooth muscle cells were prepared as detailed elsewhere (42Bonhoff A. Gellersen B. Endocrine. 1996; 5: 241-246Crossref PubMed Google Scholar) and maintained in Dulbecco's modified Eagle's medium/Ham's F-12, 10% fetal calf serum, 100 units/ml penicillin, 100 μg/ml streptomycin, and 10−9m 17 β-estradiol. COS-7 cells were kept in the same medium but without estradiol. Transient transfections were performed by the calcium phosphate precipitation method for ESC and myometrial cells and with DOTAP reagent (Roche Molecular Biochemicals) for COS-7 cells overnight as described previously (43Gellersen B. Kempf R. Telgmann R. Mol. Endocrinol. 1997; 11: 97-113Crossref PubMed Scopus (62) Google Scholar) in triplicates using 12-well dishes if not indicated otherwise, or 24-well dishes. Medium was replaced the next morning and 0.5 mm 8-Br-cAMP (Biolog, Bremen, Germany) added for stimulation experiments. Cell harvest was performed for ESC and myometrial cultures 48 h and for COS-7 cells 24 h after medium replacement. Luciferase activity was measured with the luciferase reagent kit (Promega) and expressed as relative light units. Transfections were repeated at least three times, and representative experiments are shown (mean ± S.D.). Nuclear and cytoplasmic protein extracts were prepared as described by Schreiber et al. (43Gellersen B. Kempf R. Telgmann R. Mol. Endocrinol. 1997; 11: 97-113Crossref PubMed Scopus (62) Google Scholar, 44Schreiber E. Matthias P. Müller M.M. Schaffner W. Nucleic Acids Res. 1989; 17: 6419Crossref PubMed Scopus (3916) Google Scholar) with minor modifications and protein concentrations were determined using the DC protein detection kit (Bio-Rad). For RNA isolation the method developed by Gough (45Gough M.N. Anal. Biochem. 1988; 173: 93-95Crossref PubMed Scopus (366) Google Scholar) was applied, using the cytosolic lysate generated during protein extraction as the source. Rabbit antisera against rat C/EBPα (numbers 6 and 247) were kindly provided by Dr. Steve McKnight (University of Texas Southwestern Medical Center, Dallas, TX) and diluted 1:10 for use as a working stock solution. Rabbit antibodies raised against rat C/EBPβ and human C/EBPδ (0.1 μg/μl) were purchased from Santa Cruz Biotechnology. A modified method of Rittenhouse and Marcus (46Rittenhouse J. Marcus F. Anal. Biochem. 1983; 138: 442-448Crossref Scopus (81) Google Scholar) was used for protein analysis. Nuclear and cytosolic proteins were loaded on 12% SDS-polyacrylamide gels and electrophoresed for 1 h at 150 V. Gels were transferred for 1 h at 1.2 mA/cm2in a semi-dry chamber with a three buffer system (cathode buffer: 25 mm Tris-HCl, pH 9.4, 40 mm ε-aminocaproic acid, 20% methanol; anode buffer I: 30 mm Tris-HCl, pH 10.4, 20% methanol; anode buffer II: 300 mm Tris-HCl, pH 10.4, 20% methanol) onto PVDF Immobilon membrane (Millipore) and stained with Fount India Ink (Pelikan) to control for even loading and transfer efficiency. Blots were blocked overnight at 4 °C with Blotto (5% nonfat dry milk in 15 mm Tris-HCl, pH 7.6, 136 mm NaCl), exposed to primary antibodies for 1 h at room temperature (dilution 1:1000 in Blotto), and then incubated with secondary antibody (horseradish peroxidase-conjugated anti-rabbit IgG, Sigma), diluted 1:1000 in Blotto, for 1 h at room temperature. Detection was performed with the ECL system (Pierce). Total RNA was used for oligo(dT)-primed cDNA synthesis with SuperScript RNase H− reverse transcriptase (Life Technologies Inc.). PCR for dPRL and GAPDH cDNAs was performed as described previously (42Bonhoff A. Gellersen B. Endocrine. 1996; 5: 241-246Crossref PubMed Google Scholar, 43Gellersen B. Kempf R. Telgmann R. Mol. Endocrinol. 1997; 11: 97-113Crossref PubMed Scopus (62) Google Scholar). For amplification of C/EBPβ cDNA (38Akira S. Isshiki H. Sugita T. Tanabe O. Kinoshita S. Nishio Y. Nakajima T. Hirano T. Kishimoto T. EMBO J. 1990; 9: 1897-1906Crossref PubMed Scopus (1210) Google Scholar) Taq DNA polymerase and solution Q (Qiagen) were used. The sense primer TCTCCGACCTCTTCTCCGACGA spans cDNA positions 353–374 relative to the first start codon, and the antisense primer CAGCTGCTTGAASAASTKCCG anneals to the region 982–1002. After transfer of the electrophoresed PCR products to positively charged nylon membrane (Roche Molecular Biochemicals), Southern blot hybridization was performed with internal oligonucleotides labeled with terminal deoxynucleotidyl transferase (Life Technologies) and digoxigenin-11-dUTP (Roche Molecular Biochemicals), and detected with the DIG luminescent detection kit (Roche Molecular Biochemicals). The probe sequences were for GAPDH: TCGTCATGGGTGTGAACCATG; for hPRL: CAAGGGGGCCACGCTCTGGCA; for C/EBPβ: TTGCGCACGGCGATGTTGTTG (antisense to positions 840–860). All luciferase gene reporter constructs were generated in the pGL3-Basic plasmid (Promega). The dPRL promoter/luciferase reporter fusion construct dPRL-332/luc3 contains the wild type dPRL promoter sequence −332 to +65 relative to the major transcriptional start site and has been described previously (12Gellersen B. Kempf R. Telgmann R. DiMattia G.E. Mol. Endocrinol. 1994; 8: 356-373Crossref PubMed Scopus (225) Google Scholar, 17Telgmann R. Maronde E. Taskén K. Gellersen B. Endocrinology. 1997; 138: 929-937Crossref PubMed Scopus (118) Google Scholar). The minimal promoter construct dPRL-32/luc3 was generated by PCR using dPRL-332/luc3 as the template. Primers were: CCTGAAGCttGCCATAAAAGAATCCTCTGACGTTTC (sense), annealing at positions −39 to −4 of the dPRL promoter and including two mismatches (lowercase letters) to introduce a Hin dIII site (underlined) at position −32, and CTTTATGTTTTTGGCGTCTTCCA (antisense), corresponding to positions 2–23 relative to the ATG start codon of the luciferase gene in pGL3-Basic. The PCR product was cleaved with Hin dIII and ligated into Hin dIII digested pGL3-Basic. The fragment dPRL-332/-270 was amplified using primers with Bam HI overhangs (underlined): AGGATCCATTATGTTCTGAGGGCTG (sense) spanning the dPRL sequence −332/−315 (primer dPRL-332-S), and AGGATCCGAGCAGAGACCAGACATG (antisense), corresponding to positions −287/−270. The PCR products were digested with Bam HI, concatamerized, and cloned into pLucIAV Link V.4 (kindly provided by Dr. Richard N. Day, University of Virginia, Charlottesville, VA). Inserts with one or two copies were excised by digestion at 3′ with Pst I followed by polishing, and digestion at 5′ with Acc 65I, and then ligated into the Acc 65I and Sma I sites of dPRL-32/luc3 5′ to the minimal promoter element. The resultant constructs 1x(dPRL-332/-270)/-32/luc3 and 2x(dPRL-332/-270)/-32/luc3 carry the dPRL promoter fragment in 5′-3′ orientation. Plasmid dPRL(-332/-191)/-32/luc3 was constructed by PCR with Pwo polymerase (Peqlab, Erlangen, Germany), using dPRL-332-S (see above) as upstream primer and the downstream primer GTCAAGATCTCTCCCAGGAGACATTTGG (antisense), corresponding to positions −208/−191 and carrying an overhang with Bgl II recognition sequence (underlined). The PCR product was digested with Bgl II and inserted into the Ecl 136II (AGS, Heidelberg, Germany) and Bgl II sites of dPRL-32/luc3. Plasmid dPRL(-332/-134)/-32/luc3 was generated with the sense primer ATTATGTTCTGAGGGCTGCTTGTGTTGT (positions −332/−302) and the antisense primer AGGATCCCATCAATCTAAATGAGTG (positions −154/−135) with Bam HI overhang (underlined). The PCR product was digested with Bam HI and inserted into Ecl 136II and Bgl II sites of dPRL-32/luc3. Plasmid dPRL-270/luc3 was generated by PCR, using dPRL-332/luc3 as template. The upstream primer AGGATCCACCAGATGCCAGCAGCAC spans positions −270 to −253 of the dPRL promoter and contains a Bam HI overhang (underlined); the antisense primer is anchored in exon 1A: CAAGAAGAATCGGAtCcTACAGGCTTT, covering positions +54 to +80 relative to the transcription start site, and containing two mismatches (lowercase letters) to introduce a Bam HI restriction site (underlined) at position +65. The PCR product was subjected to incomplete digestion with Bam HI to prevent restriction at the Bam HI site close to the 5′ end of the upstream primer. This created a dPRL−270/+65 fragment with 5′ blunt and 3′ Bam HI ends which was ligated into pGL3-Basic digested with Ecl 136II and Bgl II. Computerized searches for transcription factor consensus binding sites were performed with TFSEARCH v1.3 by Yutaka Akiyama using the TRANSFAC data bases (47Heinemeyer T. Wingender E. Reuter I. Hermjakob H. Kel A.E. Kel O.V. Ignatieva E.V. Ananko E.A. Podkolodnaya O.A. Kolpakov F.A. Podkolodny N.L. Kolchanov N.A. Nucleic Acids Res. 1998; 26: 362-367Crossref PubMed Scopus (1324) Google Scholar). Mutations of consensus sequences were introduced into the dPRL promoter by site-directed mutagenesis of dPRL-332/luc3 using the QuikChange system and Pfu polymerase (Stratagene). PCR products were transformed and plasmid DNA prepared to retrieve the mutated insert by Acc 65I/Nco I digestion and ligate it into native pGL3-Basic cleaved with the same enzyme combination. The sense sequences of the complementary oligonucleotides used for site-directed mutagenesis (D-B-mut, F-mut, G-mut) and the resultant constructs (dPRL-332/D-Bmut/luc3, dPRL-332/F-mut/luc3, dPRL-332/G-mut/luc3) are illustrated in Fig. 6. As a reporter control for C/EBP expression vectors NFIL6RE/luc3 was constructed. Complementary oligonucleotides with Acc 65I overhangs were annealed and inserted into the Acc 65I site of the dPRL-32/luc3 minimal promoter construct. The resultant insert sequence GGTACCCAGATCTGGCAGGATCC AGATTG CG CAATCT GCGGTACCcarries a palindromic NF-IL6 response element consensus sequence (bold faced) flanked by Acc 65I sites (underlined). Expression vectors for transient transfections were created in pSG5 (Stratagene) under the SV40 promoter. The human C/EBPα cDNA insert (48Antonson P. Xanthopoulos K.G. Biochem. Biophys. Res. Commun. 1995; 215: 106-113Crossref PubMed Scopus (81) Google Scholar) was excised from hCMV-C/EBPα (kindly provided by Dr. G. Darlington, Baylor College of Medicine, Houston, TX) with Bam HI and ligated into Bam HI cleaved pSG5 to give pSG-C/EBPα. Expression vectors for human C/EBPβ and C/EBPδ (pCMV/NF-IL6, pCMV/NF-IL6β) were a gift from Dr. S. Akira (Hyogo College of Medicine, Hyogo, Japan) (29Kinoshita S. Akira S. Kishimoto T. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 1473-1476Crossref PubMed Scopus (258) Google Scholar, 38Akira S. Isshiki H. Sugita T. Tanabe O. Kinoshita S. Nishio Y. Nakajima T. Hirano T. Kishimoto T. EMBO J. 1990; 9: 1897-1906Crossref PubMed Scopus (1210) Google Scholar). Inserts were excised with Sal I, blunt-ended and cloned into pSG5 which had been linearized with Bam HI and blunt-ended. This yielded pSG-C/EBPβ, pSG-C/EBPδ, and pSG-C/EBPβrev, which carries the C/EBPβ cDNA in the reverse orientation and was used as a negative control. To generate pSG/LIP, pSG-C/EBPβ plasmid was cut with Eco RI (in the polylinker region of pSG5 upstream of the cDNA insert) and Sac II (in the insert). Released cDNA fragments were removed and the remaining plasmid polished with mung bean nuclease (Promega) and recircularized, retaining as the insert the C-terminal portion of CEBPβ cDNA extending from the Sac II site 49-base pair upstream of the Met199 codon to beyond the stop codon. To generate the expression vector pSG/LAP, Met199 was changed to Leu by PCR-mediated mutagenesis using the following primers: LAP-H-S (CGCAGGC tTG GCGGCa aGC TTCCCGTAC, corresponding to positions 588–615 in the human C/EBPβ cDNA relative to the first Met codon; lowercase letters represent nucleotide changes, italicized triplets indicate codon mutations from Met199 to Leu and Gly202 to Ser, and underlined is a Hin dIII site introduced by mutation), LAP-H-AS (antisense to LAP-H-S), and NFIL6-H (TTGCGCACGGCGATGTTGTTG, antisense to positions 840–860 of human C/EBPβ cDNA). Two separate PCR reactions were performed with Pfu polymerase on template pSG-C/EBPβ. Primer pairs T7 (anchored in the polylinker of pSG5 5′ to the cDNA insert) and LAP-H-AS, and LAP-H-S and NFIL6-H were used to amplify overlapping portions of the C/EBPβ cDNA, introducing the mutations Met199 to Leu, Gly202 to Ser, and a Hin dIII site within the overlap. Both PCR products were digested with Hin dIII and ligated to one another to span the entire amplified region from the T7 to the NFIL6-H sequences. The purified ligation product was cleaved with Bsi WI to isolate an internal 495-base pair fragment containing the mutations. This Bsi WI fragment was used to replace the wild type Bsi WI fragment in pSG-C/EBPβ thus yielding pSG/LAP. The construct pABVP16 was kindly provided by Drs. Sergio Onate and Sophia Tsai (Baylor College of Medicine, Houston, TX). It contains coding region for the transactivation domain (AD) of herpes simplex virus VP16 under control of the Rous sarcoma virus promoter and was used to generate pVP16/LAP-DBD. The sequence encoding the DNA-binding domain (DBD) was excised from pSG-C/EBPβ by digestion with Bsi WI (immediately downstream of the Met199codon), polishing with mung bean nuclease, and digestion with Bgl II in the polylinker 3′ to the cDNA insert. The fragment was ligated into pABVP16 which had been prepared as follows: the plasmid was cut with Xho I in the polylinker 3′ to the VP16 sequence, filled in with the Klenow fragment of DNA polymerase I and dTTP/dCTP only, polished with mung bean nuclease, and finally cleaved with Bam HI. The ligation resulted in an in-frame fusion of VP16-AD and LAP-DBD. All mutations and preservation of open reading frames were verified by sequencing. Fragments of the dPRL promoter used as probes or competitors for EMSA were: dPRL-332/-270, dPRL-301/-270 (subfragment B), dPRL-311/-291 (subfragment D), dPRL-332/-302 (subfragment A), dPRL-332/-312 (subfragment C), and dPRL-290/-270 (subfragment E). Recombinant proteins were produced from cDNAs cloned into pSG5, using the TNT T7 quick coupled transcription/translation system (Promega). Per binding reaction 5 μg of nuclear protein or 2 μl of transcription/translation product and 30,000 cpm of end-labeled probe were used. Final concentrations of components in the binding reaction, including high salt nuclear extracts, were: 15 mm HEPES, 200 mm NaCl, 5 mm MgCl2, 65 mm KCl, 0.05 mm EDTA, 0.05 mm EGTA, 1 mm dithiothreitol, 1.25 mm spermidine, 3.5% Ficoll," @default.
• W2078461132 created "2016-06-24" @default.
• W2078461132 creator A5035681257 @default.
• W2078461132 creator A5078804936 @default.
• W2078461132 creator A5091306061 @default.
• W2078461132 date "1999-08-01" @default.
• W2078461132 modified "2023-09-30" @default.
• W2078461132 title "CCAAT/Enhancer-binding Proteins Are Mediators in the Protein Kinase A-dependent Activation of the Decidual Prolactin Promoter" @default.
• W2078461132 cites W1480527955 @default.
• W2078461132 cites W1559736216 @default.
• W2078461132 cites W1601426514 @default.
• W2078461132 cites W1658788964 @default.
• W2078461132 cites W179818011 @default.
• W2078461132 cites W1813044481 @default.
• W2078461132 cites W1939477527 @default.
• W2078461132 cites W1965520579 @default.
• W2078461132 cites W1965541545 @default.
• W2078461132 cites W1980514725 @default.
• W2078461132 cites W1980964148 @default.
• W2078461132 cites W1992333152 @default.
• W2078461132 cites W2001399144 @default.
• W2078461132 cites W2003798179 @default.
• W2078461132 cites W2005393972 @default.
• W2078461132 cites W2012255113 @default.
• W2078461132 cites W2016730049 @default.
• W2078461132 cites W2018082219 @default.
• W2078461132 cites W2022139382 @default.
• W2078461132 cites W2024238267 @default.
• W2078461132 cites W2026591908 @default.
• W2078461132 cites W2029824360 @default.
• W2078461132 cites W2031447271 @default.
• W2078461132 cites W2031603823 @default.
• W2078461132 cites W2038269021 @default.
• W2078461132 cites W2047842452 @default.
• W2078461132 cites W2048789360 @default.
• W2078461132 cites W2049048696 @default.
• W2078461132 cites W2049077650 @default.
• W2078461132 cites W2052859967 @default.
• W2078461132 cites W2061607157 @default.
• W2078461132 cites W2067124950 @default.
• W2078461132 cites W2072054038 @default.
• W2078461132 cites W2074501002 @default.
• W2078461132 cites W2076609567 @default.
• W2078461132 cites W2078853769 @default.
• W2078461132 cites W2085630652 @default.
• W2078461132 cites W2098974513 @default.
• W2078461132 cites W2099965878 @default.
• W2078461132 cites W2105051209 @default.
• W2078461132 cites W2114351224 @default.
• W2078461132 cites W2119577005 @default.
• W2078461132 cites W2129931758 @default.
• W2078461132 cites W2133901437 @default.
• W2078461132 cites W2139440574 @default.
• W2078461132 cites W2145733556 @default.
• W2078461132 cites W2151625863 @default.
• W2078461132 cites W2154932077 @default.
• W2078461132 cites W2155549511 @default.
• W2078461132 cites W2161657103 @default.
• W2078461132 cites W2168508124 @default.
• W2078461132 cites W2206590192 @default.
• W2078461132 cites W2241768283 @default.
• W2078461132 cites W4241015621 @default.
• W2078461132 cites W4313341455 @default.
• W2078461132 doi "https://doi.org/10.1074/jbc.274.35.24808" @default.
• W2078461132 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10455153" @default.
• W2078461132 hasPublicationYear "1999" @default.
• W2078461132 type Work @default.
• W2078461132 sameAs 2078461132 @default.
• W2078461132 citedByCount "88" @default.
• W2078461132 countsByYear W20784611322012 @default.
• W2078461132 countsByYear W20784611322013 @default.
• W2078461132 countsByYear W20784611322014 @default.
• W2078461132 countsByYear W20784611322015 @default.
• W2078461132 countsByYear W20784611322016 @default.
• W2078461132 countsByYear W20784611322017 @default.
• W2078461132 countsByYear W20784611322018 @default.
• W2078461132 countsByYear W20784611322019 @default.
• W2078461132 countsByYear W20784611322020 @default.
• W2078461132 countsByYear W20784611322022 @default.
• W2078461132 countsByYear W20784611322023 @default.
• W2078461132 crossrefType "journal-article" @default.
• W2078461132 hasAuthorship W2078461132A5035681257 @default.
• W2078461132 hasAuthorship W2078461132A5078804936 @default.
• W2078461132 hasAuthorship W2078461132A5091306061 @default.
• W2078461132 hasBestOaLocation W20784611321 @default.
• W2078461132 hasConcept C104317684 @default.
• W2078461132 hasConcept C111936080 @default.
• W2078461132 hasConcept C149240914 @default.
• W2078461132 hasConcept C153911025 @default.
• W2078461132 hasConcept C184235292 @default.
• W2078461132 hasConcept C185592680 @default.
• W2078461132 hasConcept C2779064019 @default.
• W2078461132 hasConcept C55493867 @default.
• W2078461132 hasConcept C71315377 @default.
• W2078461132 hasConcept C86339819 @default.
• W2078461132 hasConcept C86803240 @default.
• W2078461132 hasConcept C94966510 @default.
• W2078461132 hasConcept C95444343 @default.

• next