FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2078470010> ?p ?o ?g. }

• W2078470010 endingPage "33309" @default.
• W2078470010 startingPage "33301" @default.
• W2078470010 abstract "Many human diseases result from the influence of the nutritional environment on gene expression. The environment interacts with the genome by altering the epigenome, including covalent modification of nucleosomal histones. Here, we report a novel and dramatic influence of diet on the phenotype and survival of mice in which histone deacetylase 3 (Hdac3) is deleted postnatally in heart and skeletal muscle. Although embryonic deletion of myocardial Hdac3 causes major cardiomyopathy that reduces survival, we found that excision of Hdac3 in heart and muscle later in development leads to a much milder phenotype and does not reduce survival when mice are fed normal chow. Remarkably, upon switching to a high fat diet, the mice begin to die within weeks and display signs of severe hypertrophic cardiomyopathy and heart failure. Down-regulation of myocardial mitochondrial bioenergetic genes, specifically those involved in lipid metabolism, precedes the full development of cardiomyopathy, suggesting that HDAC3 is important in maintaining proper mitochondrial function. These data suggest that loss of the epigenomic modifier HDAC3 causes dietary lethality by compromising the ability of cardiac mitochondria to respond to changes of nutritional environment. In addition, this study provides a mouse model for diet-inducible heart failure. Many human diseases result from the influence of the nutritional environment on gene expression. The environment interacts with the genome by altering the epigenome, including covalent modification of nucleosomal histones. Here, we report a novel and dramatic influence of diet on the phenotype and survival of mice in which histone deacetylase 3 (Hdac3) is deleted postnatally in heart and skeletal muscle. Although embryonic deletion of myocardial Hdac3 causes major cardiomyopathy that reduces survival, we found that excision of Hdac3 in heart and muscle later in development leads to a much milder phenotype and does not reduce survival when mice are fed normal chow. Remarkably, upon switching to a high fat diet, the mice begin to die within weeks and display signs of severe hypertrophic cardiomyopathy and heart failure. Down-regulation of myocardial mitochondrial bioenergetic genes, specifically those involved in lipid metabolism, precedes the full development of cardiomyopathy, suggesting that HDAC3 is important in maintaining proper mitochondrial function. These data suggest that loss of the epigenomic modifier HDAC3 causes dietary lethality by compromising the ability of cardiac mitochondria to respond to changes of nutritional environment. In addition, this study provides a mouse model for diet-inducible heart failure. Obesity is strongly associated with cardiac morbidity and mortality (1Wong C. Marwick T.H. Nat. Clin. Pract. Cardiovasc. Med. 2007; 4: 436-443Crossref PubMed Scopus (162) Google Scholar, 2Alpert M.A. Am. J. Med. Sci. 2001; 321: 225-236Abstract Full Text Full Text PDF PubMed Scopus (579) Google Scholar). A growing body of evidence suggests that derangement of myocardial energy metabolism is a major factor in the pathogenesis of heart diseases (3Abel E.D. Litwin S.E. Sweeney G. Physiol. Rev. 2008; 88: 389-419Crossref PubMed Scopus (508) Google Scholar, 4Lopaschuk G.D. Ussher J.R. Folmes C.D. Jaswal J.S. Stanley W.C. Physiol. Rev. 2010; 90: 207-258Crossref PubMed Scopus (1316) Google Scholar, 5Neubauer S. N. Engl. J. Med. 2007; 356: 1140-1151Crossref PubMed Scopus (1622) Google Scholar). Metabolism of dietary lipids and carbohydrates is executed by metabolic enzymes that are subject to regulation by environmental factors at the transcriptional level through chromatin remodeling (6Desvergne B. Michalik L. Wahli W. Physiol. Rev. 2006; 86: 465-514Crossref PubMed Scopus (636) Google Scholar, 7Hock M.B. Kralli A. Annu. Rev. Physiol. 2009; 71: 177-203Crossref PubMed Scopus (451) Google Scholar). This includes changes in a variety of modifications on DNA and nucleosomal histones, such as histone acetylation (8Campos E.I. Reinberg D. Annu. Rev. Genet. 2009; 43: 559-599Crossref PubMed Scopus (627) Google Scholar). Histone acetylation is governed by histone acetyltransferases and histone deacetylases (HDACs), 2The abbreviations used are: HDAChistone deacetylaseMCKmuscle creatine kinaseMHCmyosin heavy chainHFDhigh fat dietANPatrial natriuretic peptideBNPB-type natriuretic peptideERRestrogen-related receptor. which are recruited to specific genomic locations by DNA sequence-specific transcription factors (9Struhl K. Genes Dev. 1998; 12: 599-606Crossref PubMed Scopus (1531) Google Scholar). In general, histone acetylation is associated with active gene expression, and many transcriptional coactivators contain histone acetyltransferase activity. Conversely, histone deacetylation is associated with gene repression (10Shahbazian M.D. Grunstein M. Annu. Rev. Biochem. 2007; 76: 75-100Crossref PubMed Scopus (1167) Google Scholar, 11Eberharter A. Becker P.B. EMBO Rep. 2002; 3: 224-229Crossref PubMed Scopus (656) Google Scholar). HDACs have been grouped into class I, class II, class IV, and sirtuins based on their sequence homology and catalytic mechanism (12Yang X.J. Seto E. Nat. Rev. Mol. Cell Biol. 2008; 9: 206-218Crossref PubMed Scopus (943) Google Scholar, 13Sauve A.A. Wolberger C. Schramm V.L. Boeke J.D. Annu. Rev. Biochem. 2006; 75: 435-465Crossref PubMed Scopus (564) Google Scholar). histone deacetylase muscle creatine kinase myosin heavy chain high fat diet atrial natriuretic peptide B-type natriuretic peptide estrogen-related receptor. Class I HDACs exist in multiprotein nuclear corepressor complexes. HDAC1 and -2 are found in the NuRD (nucleosome remodeling and deacetylating) complex, the Sin3 complex, and the CoREST (corepressor for element-1-silencing transcription factor) complex (12Yang X.J. Seto E. Nat. Rev. Mol. Cell Biol. 2008; 9: 206-218Crossref PubMed Scopus (943) Google Scholar). HDAC3, another class I HDAC, exists in a different set of complexes that contain NCoR (nuclear receptor corepressor) and/or SMRT (silencing mediator of retinoic and thyroid receptors), which function as activating subunits of the HDAC3 enzyme (14Guenther M.G. Lane W.S. Fischle W. Verdin E. Lazar M.A. Shiekhattar R. Genes Dev. 2000; 14: 1048-1057PubMed Google Scholar, 15Wen Y.D. Perissi V. Staszewski L.M. Yang W.M. Krones A. Glass C.K. Rosenfeld M.G. Seto E. Proc. Natl. Acad. Sci. U.S.A. 2000; 97: 7202-7207Crossref PubMed Scopus (297) Google Scholar, 16Li J. Wang J. Wang J. Nawaz Z. Liu J.M. Qin J. Wong J. EMBO J. 2000; 19: 4342-4350Crossref PubMed Scopus (498) Google Scholar, 17Guenther M.G. Barak O. Lazar M.A. Mol. Cell. Biol. 2001; 21: 6091-6101Crossref PubMed Scopus (477) Google Scholar). Class II HDACs are dynamic in nucleocytoplasmic trafficking and are regulated by several kinase signaling pathways (12Yang X.J. Seto E. Nat. Rev. Mol. Cell Biol. 2008; 9: 206-218Crossref PubMed Scopus (943) Google Scholar). Sirtuins are HDACs that are dependent upon NAD (13Sauve A.A. Wolberger C. Schramm V.L. Boeke J.D. Annu. Rev. Biochem. 2006; 75: 435-465Crossref PubMed Scopus (564) Google Scholar). HDACs have critical roles in cardiac development and function, as revealed by many genetic animal models. For example, mice lacking HDAC5 and HDAC9, class II HDACs, are sensitized to cardiac stress signals and develop severe cardiac hypertrophy in response to pressure overload (18Zhang C.L. McKinsey T.A. Chang S. Antos C.L. Hill J.A. Olson E.N. Cell. 2002; 110: 479-488Abstract Full Text Full Text PDF PubMed Scopus (799) Google Scholar, 19Chang S. Young B.D. Li S. Qi X. Richardson J.A. Olson E.N. Cell. 2006; 126: 321-334Abstract Full Text Full Text PDF PubMed Scopus (356) Google Scholar), whereas mice lacking HDAC2, a class I HDAC, are resistant to hypertrophic stress (20Trivedi C.M. Luo Y. Yin Z. Zhang M. Zhu W. Wang T. Floss T. Goettlicher M. Noppinger P.R. Wurst W. Ferrari V.A. Abrams C.S. Gruber P.J. Epstein J.A. Nat. Med. 2007; 13: 324-331Crossref PubMed Scopus (373) Google Scholar). Deficiency of sirtuin 1, sirtuin 3, or sirtuin 7 also results in specific cardiac defects (21Finkel T. Deng C.X. Mostoslavsky R. Nature. 2009; 460: 587-591Crossref PubMed Scopus (1149) Google Scholar, 22Sundaresan N.R. Gupta M. Kim G. Rajamohan S.B. Isbatan A. Gupta M.P. J. Clin. Invest. 2009; 119: 2758-2771Crossref PubMed Scopus (755) Google Scholar). Inactivation of HDAC2 results in resistance to cardiac hypertrophy, whereas transgenic overexpression of HDAC2 induces cardiac hypertrophy (20Trivedi C.M. Luo Y. Yin Z. Zhang M. Zhu W. Wang T. Floss T. Goettlicher M. Noppinger P.R. Wurst W. Ferrari V.A. Abrams C.S. Gruber P.J. Epstein J.A. Nat. Med. 2007; 13: 324-331Crossref PubMed Scopus (373) Google Scholar). In addition, deletion of HDAC1 and HDAC2 together in heart results in cardiac embryonic defects and lethality (23Montgomery R.L. Davis C.A. Potthoff M.J. Haberland M. Fielitz J. Qi X. Hill J.A. Richardson J.A. Olson E.N. Genes Dev. 2007; 21: 1790-1802Crossref PubMed Scopus (525) Google Scholar). A specific function for HDAC3 in cardiac development and function has been suggested by studies in which mid-gestational cardiac-specific deletion resulted in severe hypertrophic cardiomyopathy and lethality by the age of 4 months (24Montgomery R.L. Potthoff M.J. Haberland M. Qi X. Matsuzaki S. Humphries K.M. Richardson J.A. Bassel-Duby R. Olson E.N. J. Clin. Invest. 2008; 118: 3588-3597Crossref PubMed Scopus (260) Google Scholar). Embryonic gene inactivation in these studies, however, prevents the discrimination of gestational versus postnatal functions of HDAC3 and obscures the potential contributions of gene-environment interactions. Given the availability of many small molecules that can regulate HDAC enzyme activity and their potential value in treating various diseases, including cancer and heart disease, it is of interest and importance to define how postnatal manipulation of individual HDACs would affect the pathogenesis of diseases (25Minucci S. Pelicci P.G. Nat. Rev. Cancer. 2006; 6: 38-51Crossref PubMed Scopus (1919) Google Scholar, 26Drummond D.C. Noble C.O. Kirpotin D.B. Guo Z. Scott G.K. Benz C.C. Annu. Rev. Pharmacol. Toxicol. 2005; 45: 495-528Crossref PubMed Scopus (527) Google Scholar). Here, we report that mice in which HDAC3 is inactivated postnatally in both cardiac and skeletal muscle survive for over a year without obvious cardiac dysfunction when fed normal chow. However, these mice are exquisitely sensitive to their nutritive environment and exhibit severe hypertrophic cardiomyopathy and heart failure leading to death within weeks after switching to a high fat diet. Our work provides a mouse model for diet-inducible heart failure and suggests that HDAC3 is required for maintaining cardiac metabolic balance under lipid overload conditions. To generate mice with conditional HDAC3 null allele, LoxP sites were inserted into Hdac3 gene to flank exons 4–7, which encode a large region required for the catalytic activity of the enzyme. The targeting vector was based on BAC clone from C57BL/6 background, and homologous recombination was performed in C57BL/6 embryonic stem cells. Efficient recombination was confirmed. 3S. E. Mullican, C. A. Gaddis, T. Alenghat, M. G. Nair, P. R. Giacomin, L. Everett, D. Feng, D. J. Steger, J. Schug, and M. A. Lazar, submitted for publication. The HDAC3fl/fl mice were cross-bred with MCK-Cre mice (from the Jackson Laboratory) to generate HDAC3fl/fl/MCK-Cre mice that were referred to as MCH3-KO in this study. The control mice were HDAC3fl/fl that were referred to as wild-type (WT) in this study. Mice were housed under the 12-h-light/12-h-dark cycles (lights on at 7 a.m., lights off at 7 p.m.). All mice used in this study were males. High fat diet (HFD) containing 60 kcal % fat was purchased from Research Diets Inc. (D12492i). For fasting studies, fasting was started before the dark cycle. All the animal care and use procedures followed the guidelines of the Institutional Animal Care and Use Committee of the University of Pennsylvania. For Western blot, tissues were lysed in RIPA buffer (1% Nonidet P-40, 1% sodium deoxycholate, 0.1% SDS, 0.15 m NaCl, 0.01 m sodium phosphate, pH 7.2, 2 mm EDTA) containing protease inhibitors (Roche Applied Science) and 0.5 mm DTT. Lysates containing 80 μg of total protein were resolved by Tris-glycine SDS-PAGE, transferred to PVDF membrane, and blotted with anti-HDAC3 antibody (AbCAM) and anti-HSP90 antibody (Cell Signaling). For tissue triglyceride assay, heart samples were homogenized in tissue lysis buffer (140 mm NaCl, 50 mm Tris and 1% Triton X-100, pH 8.0) first by Tissuemiser (Fisher) and then by TissueLyser (Qiagen) with steel beads. Triglyceride concentration in the lysates was then quantified using LiquiColor triglyceride assay kit (StanBio). Total RNA was extracted from tissue samples using the TRIzol (Invitrogen) and High Pure RNA tissue kit (Roche Applied Science). Reverse transcription and quantitative PCR was performed with High Capacity reverse transcription kit, Power SYBR Green PCR MasterMix, and the PRISM 7500 instrument (Applied Biosystems) using absolute quantification method with standard curves. 36B4 (Arbp) was used as the housekeeping control. Primer sequences were as follows: HDAC3, TTGGTATCCTGGAGCTGCTT and GACCCGGTCAGTGAGGTAGA; ANP, GCTTCCAGGCCATATTGGAGCAAA and TGACCTCATCTTCTACCGGCATCT; BNP, AATGGCCCAGAGACAGCTCTTGAA and CTTGTGCCCAAAGCAGCTTGAGAT; and 36B4, CTGGGACGATGAATGAGGAT and AGCAGCTGGCACCTAAACAG. For microarray (GEO accession number GSE31251), hearts were harvested from four MCH3-KO mice and four control mice at the age of 6 weeks. The total of eight RNA samples was individually processed with the Ambion WT expression kit and GeneChip WT terminal labeling and controls kit (Affymetrix) and hybridized to the Mouse Gene 1.0 ST array (Affymetrix). The array was then read by GCS3000 laser scanner (Affymetrix), and microarray image analysis was carried out by Penn Microarray Core using Partek Genomics Suite software. Subsequent analysis was carried out using BioConductor. Data from the eight samples were subjected to background subtraction, quantile normalization, log2 transformation, and probe set summarization using the Robust Multichip Average algorithm (27Irizarry R.A. Hobbs B. Collin F. Beazer-Barclay Y.D. Antonellis K.J. Scherf U. Speed T.P. Biostatistics. 2003; 4: 249-264Crossref PubMed Scopus (8307) Google Scholar). Only the probe sets that interrogate genes were retained, and those meant for quality control and normalization purposes were excluded from further analysis. The Significance Analysis of Microarrays procedure (28Tusher V.G. Tibshirani R. Chu G. Proc. Natl. Acad. Sci. U.S.A. 2001; 98: 5116-5121Crossref PubMed Scopus (9648) Google Scholar) was then used to obtain multiple test corrected q values for differential expression of genes between the hearts from MCH3-KO mice and control. Genes up-regulated or down-regulated in MCH3-KO hearts were selected with a maximum q value of 0.05 and a minimum absolute fold-change of 1.2. Gene ontology analysis was performed in David Informatics Resources 6.7 with GO BP-FAT (29Huang da W. Sherman B.T. Lempicki R.A. Nat. Protoc. 2009; 4: 44-57Crossref PubMed Scopus (24210) Google Scholar). For Oil Red O staining, 5-μm frozen sections were prepared from snap-frozen heart tissues and fixed in 10% buffered formalin for 3 min. The sections were then stained in 0.5% Oil Red O in propylene glycerol and then in hematoxylin for nucleus for 5 s. The procedures were performed by the Morphology Core in the Pennsylvania Center for Molecular Studies in Digestive and Liver Diseases. For H&E and trichrome staining, tissues were fixed in 4% paraformaldehyde for overnight, dehydrated, and paraffin-embedded, and 5-μm sections were prepared. Staining was performed according to standard procedures by Histology and Gene Expression Core in the Pennsylvania Cardiovascular Institute. Wheat germ agglutinin staining was performed on paraffin-embedded cross-sections of ventricles, using tetramethylrhodamine isothiocyanate-conjugated wheat germ agglutinin (20 μg/ml in PBS) (Sigma L5226). Quantification of myocyte diameter was performed in a blinded manner using ImageJ software. Myocyte diameter for each heart was calculated based on six random ×20 fields of view. The average diameter of the group was calculated from three WT and five KO hearts. The muscle strength in the forelimbs was measured with a grip meter (TSE; Bad Hamburg, Germany). Briefly, mice were trained to grasp a horizontal metal bar while being pulled by their tail, and the force was detected by a sensor. Ten measurements were determined for each mouse and averaged. The procedure was performed by Mouse Phenotyping, Physiology, and Metabolism Core in the Pennsylvania Diabetes and Endocrinology Research Center. The Vevo 770 ultrasound system (VisualSonics Inc) was used with an attached Integrated Rail System III for imaging acquisition. Mice were anesthetized with 1–2% isoflurane mixed with 100% oxygen through an inhalation tube. Core body temperature of the mouse was monitored by a rectal temperature probe and maintained at 37–38 °C by a tensor lamp throughout the procedure. The chest area was depilated to improve contact for the ultrasound transducer. The electrocardiographic signal was obtained from the electrode platform. Two-dimensional images were obtained at 180 frames/s using a 30-MHz probe (RMV 707B, Visual Sonics) in the parasternal long and short axis views to guide M-mode analysis at the midventricular level. Left ventricular fractional shortening, ejection fraction, and wall dimensions were computed from M-mode measurements using the Vevo 770 standard measurement package. Image measurement and analysis were performed by researchers who were blinded to the mouse genotype. For all the analysis except microarray, Student's t test was performed to determine significance of differences between two groups with each containing multiple samples from different individual mice. A previous study utilized myosin heavy chain α (MHCα)-Cre to delete cardiac HDAC3 at approximately embryonic day 9.5 (E9.5) (24Montgomery R.L. Potthoff M.J. Haberland M. Qi X. Matsuzaki S. Humphries K.M. Richardson J.A. Bassel-Duby R. Olson E.N. J. Clin. Invest. 2008; 118: 3588-3597Crossref PubMed Scopus (260) Google Scholar, 30Tessari A. Pietrobon M. Notte A. Cifelli G. Gage P.J. Schneider M.D. Lembo G. Campione M. Circ. Res. 2008; 102: 813-822Crossref PubMed Scopus (66) Google Scholar, 31McFadden D.G. Barbosa A.C. Richardson J.A. Schneider M.D. Srivastava D. Olson E.N. Development. 2005; 132: 189-201Crossref PubMed Scopus (246) Google Scholar). To conditionally delete HDAC3 in muscle tissues at later developmental stages, HDAC3fl/fl mice on C57BL/6 background (32Feng D. Liu T. Sun Z. Bugge A. Mullican S.E. Alenghat T. Liu X.S. Lazar M.A. Science. 2011; 331: 1315-1319Crossref PubMed Scopus (495) Google Scholar)3 were bred to transgenic C57BL/6 mice expressing Cre recombinase under the control of the muscle creatine kinase (MCK) promoter (33Brüning J.C. Michael M.D. Winnay J.N. Hayashi T. Hörsch D. Accili D. Goodyear L.J. Kahn C.R. Mol. Cell. 1998; 2: 559-569Abstract Full Text Full Text PDF PubMed Scopus (931) Google Scholar). This resulted in efficient deletion of HDAC3 from both heart and skeletal muscle of adult mice (Fig. 1, A and B). Consistent with a previous report (34He Y. Hakvoort T.B. Köhler S.E. Vermeulen J.L. de Waart D.R. de Theije C. ten Have G.A. van Eijk H.M. Kunne C. Labruyere W.T. Houten S.M. Sokolovic M. Ruijter J.M. Deutz N.E. Lamers W.H. J. Biol. Chem. 2010; 285: 9516-9524Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar), the recombination mediated by MCK-Cre did not occur until ∼7 days after birth (Fig. 1C). To distinguish these mice from the mice in which HDAC3 was deleted using MHCα-Cre (24Montgomery R.L. Potthoff M.J. Haberland M. Qi X. Matsuzaki S. Humphries K.M. Richardson J.A. Bassel-Duby R. Olson E.N. J. Clin. Invest. 2008; 118: 3588-3597Crossref PubMed Scopus (260) Google Scholar), the HDAC3fl/fl/MCK-Cre mice will be referred to as MCH3-KO. MCH3-KO mice were born in Mendelian ratios and exhibited no obvious abnormalities when fed normal chow. They survived in equal numbers with control littermates to at least the age of 14 months and had normal body weight (Fig. 2, A and B). This is in contrast to mice in which HDAC3 was deleted from the heart in mid-gestation, which resulted in lethality by the age of 4 months (24Montgomery R.L. Potthoff M.J. Haberland M. Qi X. Matsuzaki S. Humphries K.M. Richardson J.A. Bassel-Duby R. Olson E.N. J. Clin. Invest. 2008; 118: 3588-3597Crossref PubMed Scopus (260) Google Scholar). Indeed, at 4 months of age, MCH3-KO hearts did not show obvious abnormalities by gross appearance (Fig. 2C), although heart weight to tibia length ratios were modestly increased, suggesting mild cardiac hypertrophy (Fig. 2D). Cardiac expression of ANP and BNP, markers of heart failure, were unchanged relative to control HDAC3fl/fl mice (Fig. 2E). Histology of MCH3-KO hearts appeared normal at the age of 4 months (supplemental Fig. S1A) and electrocardiography (ECG) revealed no evidence of arrhythmia (supplemental Fig. S1B). By 8 months of age, MCH3-KO hearts exhibited only very mild fatty infiltration (Fig. 2F). To functionally characterize hearts of the MCH3-KO mice, echocardiography was performed on 4-month-old mice. MCH3-KO hearts showed thickening of ventricular walls and interventricular septae, as well as enlarged atria, but cardiac contractile function was preserved (Fig. 3A). MCH3-KO hearts exhibited slightly enhanced systolic function, as evidenced by increased fraction shortening and ejection fraction (Fig. 3B). In addition, skeletal muscle from MCH3-KO mice had normal grip strength and weight (Fig. 4, A and B), with no overt histological abnormalities at 8 months (Fig. 4C). Thus, postnatal muscle-specific deletion of HDAC3 did not reduce survival when mice were fed normal chow. Cardiac contractile function was preserved with only mild cardiohypertrophy, and skeletal muscles show no obvious alterations.FIGURE 4No significant alteration of function or morphology of HDAC3-deficient skeletal muscles. A, grip strength measurement on 8-month-old mice. n = 5. B, extensor digitorum longus (EDL) and soleus (Sol) muscle weight to tibia length ratio of 8-month-old mice. n = 5. Error bar, S.E. C, H&E stain of gastrocnemius (Gastroc) muscle from 8-month-old mice.View Large Image Figure ViewerDownload Hi-res image Download (PPT) We performed microarray analysis of gene expression in myocardium from 6-week-old mice prior to the development of cardiac hypertrophy (supplemental Fig. S2 and supplemental Table S1). Gene ontology analysis showed that genes down-regulated in MCH3-KO myocardium were substantially enriched in mitochondrial bioenergetic processes and lipid metabolism, whereas genes up-regulated in MCH3-KO myocardium were enriched in immune responses (supplemental Fig. S3). Further pathway analysis showed that many differentially expressed genes encode enzymes that are involved in mitochondrial electron transport, ATP synthesis, tricarboxylic acid cycle, fatty acid metabolism, glycerolipid, and phospholipid metabolism (Table 1). Myocardial triglycerides were significantly elevated in the MCH3-KO hearts after 24 h of fasting (Fig. 5, A and B), consistent with abnormal lipid metabolism and bioenergetics in the HDAC3-deficient myocardium.TABLE 1Genes differentially expressed in KO versus WT myocardiumProcessGeneGene nameFold-change KO vs. WTq valueElectron transport chain and ATP synthesisAtp5g1ATP synthase, H+-transporting, mitochondrial F0 complex, subunit C1−1.550.022Atp5g2ATP synthase, H+-transporting, mitochondrial F0 complex, subunit C2−1.310.036Atp5lATP synthase, H+-transporting, mitochondrial F0 complex, subunit g−1.280.025Atp5sATP synthase, H+-transporting, mitochondrial F0 complex, subunit s−1.210.044Cox15COX15 homolog, cytochrome c oxidase assembly protein (yeast)−1.300.024Cox19COX19 cytochrome c oxidase assembly homolog (Saccharomyces cerevisiae)−1.250.030Ndufs1NADH dehydrogenase (ubiquinone) Fe-S protein 1−1.300.021Ndufaf4NADH dehydrogenase (ubiquinone) 1α subcomplex, af 4−1.260.027Ndufs2NADH dehydrogenase (ubiquinone) Fe-S protein 2−1.240.025Ndufs8NADH dehydrogenase (ubiquinone) Fe-S protein 8−1.230.029Ndufv1NADH dehydrogenase (ubiquinone) flavoprotein 1−1.200.040TCA cycleAco1Aconitase 1−1.310.022Fh1Fumarate hydratase 1−1.310.021Idh1Isocitrate dehydrogenase 1 (NADP+), soluble−1.210.042Mdh2Malate dehydrogenase 2, NAD (mitochondrial)−1.290.024OgdhlOxoglutarate dehydrogenase-like−3.670.019Pdha1Pyruvate dehydrogenase E1α1−1.210.027SdhbSuccinate dehydrogenase complex, subunit B, iron sulfur (Ip)−1.200.027SdhaSuccinate dehydrogenase complex, subunit A, flavoprotein (Fp)−1.190.029Fatty acid metabolismCpt1bCarnitine palmitoyltransferase 1b, muscle−1.490.020EhhadhEnoyl-coenzyme A, hydratase−1.260.039AcadsAcyl-coenzyme A dehydrogenase, short chain−1.550.020Acad8Acyl-coenzyme A dehydrogenase family, member 8−1.360.021CrotCarnitine O-octanoyltransferase−1.330.023PeciPeroxisomal Δ3,Δ2-enoyl-coenzyme A isomerase−1.270.026Acss1Acyl-CoA synthetase short chain family member 1−1.380.021Acsl5acyl-CoA synthetase long-chain family member 5+1.340.026Acot2Acyl-CoA thioesterase 2−1.550.020Glycerolipid metabolismAgpat91-Acylglycerol-3-phosphate O-acyltransferase 9−1.340.022Akr1b10Aldo-keto reductase family 1, member B10 (aldose reductase)−2.200.019Dgat1Diacylglycerol O-acyltransferase 1−1.580.020GykGlycerol kinase−1.390.020Other metabolic processUcp2Uncoupling protein 2 (mitochondrial, proton carrier)+2.060.019Ucp3Uncoupling protein 3 (mitochondrial, proton carrier)+1.960.020G6pdxGlucose-6-phosphate dehydrogenase X-linked+1.410.022Me3Malic enzyme 3, NADP(+)-dependent, mitochondrial−1.190.033Pdk1Pyruvate dehydrogenase kinase, isoenzyme 1−1.260.027Pfkfb16-Phosphofructo-2-kinase−2.060.019Transcription regulationPpargc1bPeroxisome proliferative-activated receptor, γ, coactivator 1β−1.260.044MlxiplMLX interacting protein-like−1.530.020Ireb2Iron-responsive element-binding protein 2−1.210.029 Open table in a new tab The altered gene expression profiles of MCH3-KO hearts led us to test the hypothesis that MCH3-KO mice might be susceptible to cardiomyopathy when fed a HFD. Remarkably, when placed on a diet containing 60% fat by kilocalorie at 1 month of age, MCH3-KO mice began to die within weeks, with most dying between 3 and 4 months on the HFD and none surviving beyond the age of 6 months (Fig. 6A). By contrast, 100% of control HDAC3fl/fl mice were alive on the same dietary regimen (Fig. 6A). Until shortly before death, MCH3-KO and control HDAC3fl/fl mice gained similar amounts of weight (Fig. 6B and data not shown). We next characterized cardiac morphology, architecture, and function of 4-month-old mice fed for 3 months on HFD. Hearts from HFD-fed MCH3-KO hearts were enlarged with significantly elevated heart weight to tibia length ratios when compared with control HDAC3fl/fl mice (Fig. 6, C and D). Myocardial expression of ANP and BNP was significantly elevated, suggesting the existence of heart failure (Fig. 6E). Moreover, cardiac histology and trichrome staining revealed widespread fibrosis throughout the ventricles (Fig. 6F). Wheat germ agglutinin staining of cross-sections of ventricles showed significantly increased cardiomyocyte diameter in MCH3-KO hearts, suggesting that myocyte hypertrophy, rather than hyperplasia, underlies the cardiohypertrophy (Fig. 6G). Echocardiography demonstrated severe hypertrophic cardiomyopathy, with marked thickening of left and right ventricular walls and the interventricular septum (Fig. 7, A and C). MCH3-KO hearts at 4 months after HFD exhibited significant ventricular systolic dysfunction, as evidenced by impaired fractional shortening and ejection fraction (Fig. 7, B and C). Increased isovolumic relaxation time and the markedly enlarged left atrium suggest that diastolic function of the left ventricle was also substantially impaired (Fig. 7, A and B). Short axis echocardiographic video clips showed obvious motion abnormality of the ventricle wall (supplemental video clips A and B). Taken together, loss of cardiac HDAC3 in the presence of lipid overload and obesity caused severe cardiac contractile dysfunction and hypertrophic cardiomyopathy that lead to heart failure and lethality. We have shown that MCH3-KO mice, with postnatal cardiac and skeletal muscle-specific deletion of HDAC3, do not exhibit significant myocardial dysfunction on normal chow, but develop severe hypertrophic cardiomyopathy, fibrosis, and heart failure leading to death when fed a high fat diet. These findings underscore the importance of gene-diet interactions that can powerfully impact cardiovascular health. It is of great interest to compare our results with the report of Montgomery et al. (24Montgomery R.L. Potthoff M.J. Haberland M. Qi X. Matsuzaki S. Humphries K.M. Richardson J.A. Bassel-Duby R. Olson E.N. J. Clin. Invest. 2008; 118: 3588-3597Crossref PubMed Scopus (260) Google Scholar) that described heart failure and complete lethality by the age of 4 months in normal chow-fed mice whose cardiac HDAC3 was deleted using αMHC-Cre that is active during mid-gestation (30Tessari A. Pietrobon M. Notte A. Cifelli G. Gage P.J. Schneider M.D. Lembo G. Campione M. Circ. Res. 2008; 102: 813-822Crossref PubMed Scopus (66) Google Scholar, 31McFadden D.G. Barbosa A.C. Richardson J.A. Schneider M.D. Srivastava D. Olson E.N. Development. 2005; 132: 189-201Crossref PubMed Scopus (246) Google Scholar). By" @default.
• W2078470010 created "2016-06-24" @default.
• W2078470010 creator A5000486412 @default.
• W2078470010 creator A5018169292 @default.
• W2078470010 creator A5027475930 @default.
• W2078470010 creator A5042689320 @default.
• W2078470010 creator A5057280899 @default.
• W2078470010 creator A5067506039 @default.
• W2078470010 creator A5069064126 @default.
• W2078470010 creator A5075882004 @default.
• W2078470010 creator A5078290287 @default.
• W2078470010 date "2011-09-01" @default.
• W2078470010 modified "2023-09-29" @default.
• W2078470010 title "Diet-induced Lethality Due to Deletion of the Hdac3 Gene in Heart and Skeletal Muscle" @default.
• W2078470010 cites W1874881634 @default.
• W2078470010 cites W1968659767 @default.
• W2078470010 cites W1968715224 @default.
• W2078470010 cites W1972531835 @default.
• W2078470010 cites W1976658071 @default.
• W2078470010 cites W1986622643 @default.
• W2078470010 cites W1986775928 @default.
• W2078470010 cites W1987205813 @default.
• W2078470010 cites W1990579890 @default.
• W2078470010 cites W1992217162 @default.
• W2078470010 cites W1993477468 @default.
• W2078470010 cites W1996395636 @default.
• W2078470010 cites W1998585946 @default.
• W2078470010 cites W2005471059 @default.
• W2078470010 cites W2020126297 @default.
• W2078470010 cites W2025555937 @default.
• W2078470010 cites W2026694991 @default.
• W2078470010 cites W2030016364 @default.
• W2078470010 cites W2034797189 @default.
• W2078470010 cites W2044064996 @default.
• W2078470010 cites W2049961455 @default.
• W2078470010 cites W2053127486 @default.
• W2078470010 cites W2054848045 @default.
• W2078470010 cites W2072793384 @default.
• W2078470010 cites W2074542314 @default.
• W2078470010 cites W2079796426 @default.
• W2078470010 cites W2080536099 @default.
• W2078470010 cites W2082442359 @default.
• W2078470010 cites W2092349389 @default.
• W2078470010 cites W2098103685 @default.
• W2078470010 cites W2099192357 @default.
• W2078470010 cites W2099803844 @default.
• W2078470010 cites W2100188776 @default.
• W2078470010 cites W2102458112 @default.
• W2078470010 cites W2102526205 @default.
• W2078470010 cites W2106900373 @default.
• W2078470010 cites W2115446838 @default.
• W2078470010 cites W2118650392 @default.
• W2078470010 cites W2121466366 @default.
• W2078470010 cites W2125861412 @default.
• W2078470010 cites W2128557475 @default.
• W2078470010 cites W2128606426 @default.
• W2078470010 cites W2134284348 @default.
• W2078470010 cites W2138331679 @default.
• W2078470010 cites W2140523553 @default.
• W2078470010 cites W2152390180 @default.
• W2078470010 cites W2153819921 @default.
• W2078470010 cites W2154751897 @default.
• W2078470010 cites W2158217645 @default.
• W2078470010 cites W2158747282 @default.
• W2078470010 cites W2160909177 @default.
• W2078470010 cites W2165016093 @default.
• W2078470010 cites W2168448928 @default.
• W2078470010 cites W2170989872 @default.
• W2078470010 cites W2172295707 @default.
• W2078470010 cites W4253244719 @default.
• W2078470010 cites W4294107304 @default.
• W2078470010 doi "https://doi.org/10.1074/jbc.m111.277707" @default.
• W2078470010 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3190900" @default.
• W2078470010 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/21808063" @default.
• W2078470010 hasPublicationYear "2011" @default.
• W2078470010 type Work @default.
• W2078470010 sameAs 2078470010 @default.
• W2078470010 citedByCount "86" @default.
• W2078470010 countsByYear W20784700102012 @default.
• W2078470010 countsByYear W20784700102013 @default.
• W2078470010 countsByYear W20784700102014 @default.
• W2078470010 countsByYear W20784700102015 @default.
• W2078470010 countsByYear W20784700102016 @default.
• W2078470010 countsByYear W20784700102017 @default.
• W2078470010 countsByYear W20784700102018 @default.
• W2078470010 countsByYear W20784700102019 @default.
• W2078470010 countsByYear W20784700102020 @default.
• W2078470010 countsByYear W20784700102021 @default.
• W2078470010 countsByYear W20784700102022 @default.
• W2078470010 countsByYear W20784700102023 @default.
• W2078470010 crossrefType "journal-article" @default.
• W2078470010 hasAuthorship W2078470010A5000486412 @default.
• W2078470010 hasAuthorship W2078470010A5018169292 @default.
• W2078470010 hasAuthorship W2078470010A5027475930 @default.
• W2078470010 hasAuthorship W2078470010A5042689320 @default.
• W2078470010 hasAuthorship W2078470010A5057280899 @default.
• W2078470010 hasAuthorship W2078470010A5067506039 @default.
• W2078470010 hasAuthorship W2078470010A5069064126 @default.

• next