FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2078475797> ?p ?o ?g. }

• W2078475797 endingPage "8515" @default.
• W2078475797 startingPage "8506" @default.
• W2078475797 abstract "The activity of the transcription factor NF-κB can be modulated by members of the Rho family of small GTPases (Perona, R., Montaner, S., Saniger, L., Sánchez-Pérez, I., Bravo, R., and Lacal, J. C. (1997) Genes Dev. 11, 463–475). Ectopic expression of RhoA, Rac1, and Cdc42Hs proteins induces the translocation of NF-κB dimers to the nucleus, triggering the transactivation of the NF-κB-dependent promoter from the human immunodeficiency virus. Here, we demonstrate that activation of NF-κB by RhoA does not exclusively promote its nuclear translocation and binding to the specific κB sequences. NF-κB is also involved in the regulation of the transcriptional activity of the c-fosserum response factor (SRF), since the activation of a SRE-dependent promoter by RhoA can be efficiently interfered by the double mutant IκBαS32A/S36A, an inhibitor of the NF-κB activity. We also present evidence that RelA and p50 NF-κB subunits cooperate with the transcription factor C/EBPβ in the transactivation of the 4 × SRE-CAT reporter. Furthermore, RhoA increases the levels of C/EBPβ protein, facilitating the functional cooperation between NF-κB, C/EBPβ, and SRF proteins. These results strengthen the pivotal importance of the Rho family of small GTPases in signal transduction pathways which modulate gene expression and reveal that NF-κB and C/EBPβ transcription factors are accessory proteins for the RhoA-linked regulation of the activity of the SRF. The activity of the transcription factor NF-κB can be modulated by members of the Rho family of small GTPases (Perona, R., Montaner, S., Saniger, L., Sánchez-Pérez, I., Bravo, R., and Lacal, J. C. (1997) Genes Dev. 11, 463–475). Ectopic expression of RhoA, Rac1, and Cdc42Hs proteins induces the translocation of NF-κB dimers to the nucleus, triggering the transactivation of the NF-κB-dependent promoter from the human immunodeficiency virus. Here, we demonstrate that activation of NF-κB by RhoA does not exclusively promote its nuclear translocation and binding to the specific κB sequences. NF-κB is also involved in the regulation of the transcriptional activity of the c-fosserum response factor (SRF), since the activation of a SRE-dependent promoter by RhoA can be efficiently interfered by the double mutant IκBαS32A/S36A, an inhibitor of the NF-κB activity. We also present evidence that RelA and p50 NF-κB subunits cooperate with the transcription factor C/EBPβ in the transactivation of the 4 × SRE-CAT reporter. Furthermore, RhoA increases the levels of C/EBPβ protein, facilitating the functional cooperation between NF-κB, C/EBPβ, and SRF proteins. These results strengthen the pivotal importance of the Rho family of small GTPases in signal transduction pathways which modulate gene expression and reveal that NF-κB and C/EBPβ transcription factors are accessory proteins for the RhoA-linked regulation of the activity of the SRF. Gene expression is regulated by the interplay of different transcription factors which bind to specific DNA recognition motifs and cooperate with the basal machinery to initiate transcription. During the last few years, an emerging body of evidence is revealing the importance of crossed interactions between members of distinct families of transcription factors to form higher complexes, enabling the accurate regulation of this process. The serum response element (SRE) 1The abbreviations used are:SRE, serum response element; SRF, serum response factor; TCF, ternary complex factor; LPA, lysophosphatidic acid; NF-κB, nuclear factor-κB; DMEM, Dulbecco's modified Eagle's medium; HIV, human immunodeficiency virus; CAT, chloramphenicol acetyltransferase; β-gal, β-galactosidase; PAGE, polyacrylamide gel electrophoresis; CMV, cytomegalovirus. is a specific DNA sequence which is found in the promoter of several immediate-early genes (2Treisman R. Curr. Opin. Genet. Dev. 1994; 4: 96-101Crossref PubMed Scopus (604) Google Scholar). The prototypic c-fos SRE binds a ternary complex composed of a homodimer of p67SRF (serum response factor) and a third subunit, p62TCF (ternary complex factor), which belongs to the Ets family of accessory proteins. These TCF factors have the ability to bind a purine-rich motif 5′ to the SRF-binding site, known as the Ets recognition domain, only when SRF is bound to DNA, and include Elk-1, SAP-1, and SAP-2/ERP/NET proteins. The formation of this SRE binding-ternary complex requires the conserved B-box motif of the Ets subunits and sequences located in the core domain of the SRF protein (coreSRF), which is a region that is also responsible of its DNA binding and dimerization capabilities (2Treisman R. Curr. Opin. Genet. Dev. 1994; 4: 96-101Crossref PubMed Scopus (604) Google Scholar, 3Mueller C.G.F. Nordheim A. EMBO J. 1991; 10: 4219-4229Crossref PubMed Scopus (103) Google Scholar, 4Janknecht R. Nordheim A. Nucleic Acids Res. 1992; 20: 3317-3324Crossref PubMed Google Scholar, 5Dalton S. Treisman R. Cell. 1992; 68: 597-612Abstract Full Text PDF PubMed Scopus (524) Google Scholar, 6Shaw P.E. EMBO J. 1992; 11: 3011-3019Crossref PubMed Scopus (71) Google Scholar, 7Treisman R. Marais R. Wynne J. EMBO J. 1992; 11: 4631-4640Crossref PubMed Scopus (134) Google Scholar, 8Shore P. Sharrocks A.D. Mol. Cell. Biol. 1994; 14: 3283-3291Crossref PubMed Scopus (132) Google Scholar). The SRE has shown to be necessary and sufficient for the rapid induction of the c-fos proto-oncogen in response to different external stimuli such as serum, growth factors, and phorbol esters (2Treisman R. Curr. Opin. Genet. Dev. 1994; 4: 96-101Crossref PubMed Scopus (604) Google Scholar, 9Johansen F.-E. Prywes R. Biochem. Biophys. Acta. 1995; 1242: 1-10Crossref PubMed Scopus (0) Google Scholar). Furthermore, this DNA motif is a point of convergence of different signal transduction cascades activated by an extensive range of agonists. The regulation of the activity of the SRE is mediated by two different signaling pathways. The first mechanism is elicited by the multiple phosphorylation of TCFs within their C-terminal transactivation domain. Such phosphorylation can be triggered by distinct families of mitogen-activated protein kinases. Actually, whereas the classical Ras-Raf-MEK-ERK cascade is responsible of the phosphorylation of TCFs proteins after growth factors or phorbol esters stimulation (2Treisman R. Curr. Opin. Genet. Dev. 1994; 4: 96-101Crossref PubMed Scopus (604) Google Scholar, 10Gille H. Sharrocks A.D. Shaw P.E. Nature. 1992; 358: 414-417Crossref PubMed Google Scholar, 11Marais R. Wynne J. Treisman R. Cell. 1993; 73: 381-393Abstract Full Text PDF PubMed Scopus (1075) Google Scholar, 12Janknecht R. Ernst W.H. Pingoud V. Nordheim A. EMBO J. 1993; 12: 5097-5104Crossref PubMed Scopus (490) Google Scholar, 13Kortenjann M. Thornae O. Shaw P.E. Mol. Cell. Biol. 1994; 14: 4815-4824Crossref PubMed Scopus (163) Google Scholar, 14Gille H. Kortenjann M. Thomae O. Moomaw C. Slaughter C. Cobb M.H. Shaw P.E. EMBO J. 1995; 14: 951-962Crossref PubMed Scopus (555) Google Scholar), JNK/SAPK and p38 have also been shown to phosphorylate TCFs in response to certain cytokines and environmental stress conditions (15Whitmarsh A.J. Shore P. Sharrocks A.D. Davis R.J. Science. 1995; 269: 403-407Crossref PubMed Google Scholar, 16Whitmarsh A.J. Yang S.-H. Su M.S.-S. Sharrocks A.D. Davis R.J. Mol. Cell. Biol. 1997; 17: 2360-2371Crossref PubMed Google Scholar, 17Janknecht R. Hunter T. EMBO J. 1997; 16: 1620-1627Crossref PubMed Scopus (199) Google Scholar). The second signaling pathway which controls an efficient transcriptional activation through the SRE site is mediated by the SRF. Hill et al. (18Hill C.S. Wynne J. Treisman R. Cell. 1995; 81: 1159-1170Abstract Full Text PDF PubMed Scopus (1162) Google Scholar) showed that this TCF-independent regulation is modulated by members of the Rho family of small GTPases, RhoA, Rac1, and Cdc42Hs. Indeed, stimulation of the transcriptional activity of the SRF induced by serum, lysophosphatidic acid (LPA), and AlF4- (an activator of heterotrimeric G proteins) is signaled by RhoA in NIH 3T3 cells, since the expression of the C3 component of the Clostridium botulinum toxin efficiently blocks this effect. Fromm et al. (19Fromm C. Coso O.A. Montaner S. Xu N. Gutkind J.S. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 10098-10103Crossref PubMed Scopus (189) Google Scholar) have also found that the Gα12 subfamily of heterotrimeric G protein α subunits is able to induce the SRE activity by a RhoA-dependent pathway. On the other hand, Rac1 GTPase plays an essential role in the activation of the c-fos SRE induced by certain agents such as the epidermal growth factor and hydrogen peroxide (20Kim B.-C. Kim J.-H. FEBS Lett. 1997; 407: 7-12Crossref PubMed Scopus (14) Google Scholar, 21Kim J.-H. Kwack H.-J. Choi S.-E. Kim B.-C. Kim Y.-S. Kang I.-J. Kumar C.C. FEBS Lett. 1997; 496: 93-96Crossref Scopus (14) Google Scholar). Whereas Hillet al. (18Hill C.S. Wynne J. Treisman R. Cell. 1995; 81: 1159-1170Abstract Full Text PDF PubMed Scopus (1162) Google Scholar) have described that Rac1 and Cdc42Hs GTPases can activate the SRF in a RhoA-independent manner, other authors have found a link between these signaling cascades (22Kim B.C. Lim C.-J. Kim J.-H. FEBS Lett. 1997; 415: 325-328Crossref PubMed Scopus (25) Google Scholar). The precise mechanism by which Rho proteins can modulate the transcriptional activation through the c-fos SRE is ill defined. It has been proposed that this regulation may be targeted by a second, unknown accessory protein, distinct from TCFs, which could interact with the DNA-bound p67SRF (3Mueller C.G.F. Nordheim A. EMBO J. 1991; 10: 4219-4229Crossref PubMed Scopus (103) Google Scholar, 18Hill C.S. Wynne J. Treisman R. Cell. 1995; 81: 1159-1170Abstract Full Text PDF PubMed Scopus (1162) Google Scholar, 23Johansen F.-E. Prywes R. Mol. Cell. Biol. 1994; 14: 5920-5928Crossref PubMed Google Scholar, 24Hill C.S. Wynne J. Treisman R. EMBO J. 1994; 13: 5421-5432Crossref PubMed Scopus (134) Google Scholar). As other results suggest that the SRF contains different sequences which can inhibit its own transactivation capability (25Johansen F.-E. Prywes R. Mol. Cell. Biol. 1993; 13: 4640-4647Crossref PubMed Scopus (111) Google Scholar), it is possible that such interaction could relieve the transactivation domain from this inhibitory effect. And, moreover, this putative recognition factor should be a critical target for Rho family-mediated signal transduction pathways. Our group has recently demonstrated that the Rho family of small GTPases can efficiently induce the transcriptional activity of the nuclear factor-κB (NF-κB) (1Perona R. Montaner S. Saniger L. Sánchez-Pérez I. Bravo R. Lacal J.C. Genes Dev. 1997; 11: 463-475Crossref PubMed Google Scholar, 26Montaner S. Perona R. Saniger L. Lacal J.C. J. Biol. Chem. 1998; 273: 12779-12785Abstract Full Text Full Text PDF PubMed Scopus (199) Google Scholar). The NF-κB complex is mainly composed of two subunits of 50 and 65 kDa which are retained in the cytoplasm by a third protein, IκB. These IκB inhibitory proteins block the ability of the dimer to translocate to the nucleus and activate gene expression (27Miyamoto S. Verma I.M. Adv. Cancer Res. 1995; 66: 255-292Crossref PubMed Google Scholar, 28Verma I.M. Stevenson J.K. Schwarz E.M. van Antwerp D. Miyamoto S. Genes Dev. 1995; 9: 2723-2735Crossref PubMed Google Scholar, 29Baldwin Jr., A.S. Annu. Rev. Immunol. 1996; 14: 649-691Crossref PubMed Scopus (5285) Google Scholar). This transcription factor has shown to play a relevant role in the control of cell growth and apoptosis, along with different aspects of the immune and inflammatory responses (30Baldwin Jr., A.S. Azizkhan J.C. Jensen D.E. Beg A.A. Coodly L.R. Mol. Cell. Biol. 1991; 11: 4943-4951Crossref PubMed Google Scholar, 31Abbadie C. Kabrun N. Bouali F. Smardova J. Stéhelin D. Vandenbunder B. Enrietto P.J. Cell. 1993; 75: 899-912Abstract Full Text PDF PubMed Google Scholar, 32Beg A.A. Sha W.C. Bronson R.T. Ghosh S. Baltimore D. Nature. 1995; 376: 167-170Crossref PubMed Google Scholar, 33Beg A.A. Baltimore D. Science. 1996; 274: 782-784Crossref PubMed Scopus (2850) Google Scholar, 34Van Antwerp D.J. Martin S.J. Kafri T. Green D.R. Verma I.M. Science. 1996; 274: 787-789Crossref PubMed Scopus (2374) Google Scholar, 35Wang C.-Y. Mayo M.W. Baldwin Jr., A.S. Science. 1996; 274: 784-787Crossref PubMed Scopus (2430) Google Scholar, 36Grimm S. Bauer M.K.A. Baeuerle P.A. Schulze-Osthoff K. J. Cell Biol. 1996; 134: 13-23Crossref PubMed Scopus (331) Google Scholar, 37Grilli M. Pizzi M. Mermo M. Spano P. Science. 1996; 274: 1383-1385Crossref PubMed Scopus (725) Google Scholar, 38Wu M. Arsura M. Bellas R.E. Fitzgerald M.J. Lee H. Schauer S.L. Sherr D.H. Sonenshein G.E. Mol. Cell. Biol. 1996; 16: 5015-5025Crossref PubMed Google Scholar, 39Wu M. Lee H. Bellas R.E. Schauer S.L. Arsura M. Katz D. Fitzgerald M.J. Rothstein T.L. Sherr D.H. Sonenshein G.E. EMBO J. 1996; 17: 4682-4690Crossref Scopus (543) Google Scholar, 40Liu Z. Hsu H. Goeddel D.V. Karin M. Cell. 1996; 87: 565-576Abstract Full Text Full Text PDF PubMed Scopus (1743) Google Scholar, 41Bash J. Zong W.-X. Gélinas C. Mol. Cell. Biol. 1997; 17: 6526-6536Crossref PubMed Google Scholar). RhoA, Rac1, and Cdc42Hs are able to trigger the transactivation of the NF-κB dependent-HIV promoter in different cell lines. The mechanism involved is the conventional nuclear translocation of RelA/p50 and p50/p50 dimers, by a mechanism that involves the phosphorylation and proteolytic degradation of the inhibitory subunit IκBα. Moreover, this activation is independent of that induced by H-Ras/Raf cascade (1Perona R. Montaner S. Saniger L. Sánchez-Pérez I. Bravo R. Lacal J.C. Genes Dev. 1997; 11: 463-475Crossref PubMed Google Scholar, 26Montaner S. Perona R. Saniger L. Lacal J.C. J. Biol. Chem. 1998; 273: 12779-12785Abstract Full Text Full Text PDF PubMed Scopus (199) Google Scholar). Different interactions of the NF-κB dimers with other families of transcription factors have been widely reported (reviewed in Ref. 27Miyamoto S. Verma I.M. Adv. Cancer Res. 1995; 66: 255-292Crossref PubMed Google Scholar). It has been described that RelA can act as an accessory protein for the SRF and a physical association between both subunits have been demonstrated in vitro (42Franzoso G. Carlson L. Brown K. Daucher M.B. Bressler P. Siebenlist U. EMBO J. 1996; 15: 3403-3412Crossref PubMed Scopus (51) Google Scholar). The formation of this complex seems to be mediated through the Rel homology domain of RelA and the DNA-binding domain of SRF, which has shown to exert a negative effect on its transactivation ability. Furthermore, RelA functionally synergizes with SRF in the transactivation of a reporter construct dependent only on the SRE site, indicating that the direct or facilitated interaction between both proteins may neutralize the inhibitory functions of the core domain of SRF. In the present study, we have investigated the implications of RhoA-dependent activation of NF-κB in the regulation of p67SRF function. We demonstrate that NF-κB modulates the transcriptional activity of the SRF induced by this GTPase. Furthermore, this mechanism may also involve a cross-talking of RelA and p50 NF-κB subunits with the transcription factor C/EBPβ, which is also able to bind to the SRF and regulate its transactivation activity (43Sealy L. Malone D. Pawlak M. Mol. Cell. Biol. 1997; 17: 1744-1755Crossref PubMed Google Scholar). Therefore, members of the NF-κB and C/EBP families of transcription factors can interact and behave as accessory proteins in the modulation of the transcriptional activity of the SRF induced by the small GTPase RhoA. Simian COS-7 fibroblast-like cells were cultured in Dulbeccos′s modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum and 1 mmglutamine. Murine NIH 3T3 fibroblasts were grown in DMEM with 10% newborn calf serum. For transient expression assays, cells were transfected in 60-mm dishes by the calcium phosphate method as described (44Perona R. Esteve P. Jiménez B. Ballestero R.P. Ramón y Cajal S. Lacal J.C. Oncogene. 1993; 8: 1285-1292PubMed Google Scholar). The amount of plasmidic DNA was kept constant at 9–10 μg/plate with the corresponding empty vector. The total amount of DNA was kept at 30 μg/100-mm plate with calf thymus DNA (Boehringer Mannheim). After the precipitate was removed, cells were incubated in DMEM, 0.5% fetal calf serum for the next 24 h. Cells were stimulated during the last 5 h of culture where indicated and harvested for the different assays. Transfection efficiency was normalized by co-transfection of the plasmid pCMV-β-gal, and the β-galactosidase assay as described previously (1Perona R. Montaner S. Saniger L. Sánchez-Pérez I. Bravo R. Lacal J.C. Genes Dev. 1997; 11: 463-475Crossref PubMed Google Scholar). pCDNAIIIB plasmid (Invitrogen) and derived expression vectors encoding for constitutively activated RhoA (QL), Rac1 (QL), and Cdc42Hs (QL) proteins have been described previously (45Coso O.A. Chiariello M. Yu J.-C. Teramoto H. Crespo P. Xu N. Miki T. Gutkind J.S. Cell. 1995; 81: 1137-1146Abstract Full Text PDF PubMed Scopus (1524) Google Scholar). (−453/+80)HIV-LUC contains the NF-κB sites of the HIV enhancer/promoter and ΔNF-κB HIV-LUC contains a 3-base pair substitution in each of the NF-κB-binding sites (46Nabel G. Baltimore D. Nature. 1987; 326: 711-713Crossref PubMed Google Scholar, 47Devary Y. Rosette C. DiDonato J.A. Karin M. Science. 1993; 261: 1442-1445Crossref PubMed Scopus (557) Google Scholar). The promoters of the different reporters contain the following specific motifs: 4 × SRE-CAT, (4X) (AGGATGTCCATATTAGGACATCT) the sequence of the SRE-binding site of the human c-fos gene 5′ from a minimum promoter harboring the TATA box (54König H. Ponta H. Rahmsdorf U. Büscher M. Schönthal A. Rahmsdorf H.J. Herrlich P. EMBO J. 1989; 8: 2559-2566Crossref PubMed Scopus (154) Google Scholar); SREMUT-CAT promoter contains the mutations (AGGATGTCAATACTAGGACATCT) that prevents binding of the SRF, as previously reported (1Perona R. Montaner S. Saniger L. Sánchez-Pérez I. Bravo R. Lacal J.C. Genes Dev. 1997; 11: 463-475Crossref PubMed Google Scholar); SRE-β-gal, the sequence of the SRE-binding site of the human c-fos gene 5′ from a minimum promoter containing the TATA box; and 3D.A.CAT, a minimal c-fos promoter SRE with a TCF-defective binding site inserted 5′ to a Xenopus γ-actin TATA box (18Hill C.S. Wynne J. Treisman R. Cell. 1995; 81: 1159-1170Abstract Full Text PDF PubMed Scopus (1162) Google Scholar). pMEX-RelA(p65) and pMEX-p50 were provided by Dr. Bravo. pMSV-C/EBPβ was generously provided by Dr. Pérez-Castillo and contains the rat C/EBPβ gene. pMSV-LIP was obtained by deletion of the 5′ coding region of the C/EBPβ gene, digested with the NcoI enzyme (48Descombes P. Schibler U. Cell. 1991; 67: 569-579Abstract Full Text PDF PubMed Google Scholar). The following plasmids have been previously described: pMEX derived vector encoding for a truncated Vav protein (PJC7) (49Coppola J. Bryant S. Koda T. Conway D. Barbacid M. Cell Growth Differ. 1991; 2: 95-105PubMed Google Scholar); PCEV27 derived vector encoding for a truncated Ost protein (50Horii Y. Beeler J.F. Sakaguchi K. Tachibana M. Miki T. EMBO J. 1994; 13: 4776-4786Crossref PubMed Scopus (183) Google Scholar); and EXV-RasVal-12 (51del Peso L. Lucas L. Esteve P. Lacal J.C. Biochem. J. 1997; 322: 519-528Crossref PubMed Scopus (25) Google Scholar) and pRcCMV-IκBαS32A/S36A (52Whiteside S.T. Ernst M.K. LeBail O. Laurent-Winter C. Rice N. Israël A. Mol. Cell. Biol. 1995; 15: 5339-5345Crossref PubMed Google Scholar). Analysis of the NF-κB activity was performed by transfection of the reporter containing the wild-type κB sites of the HIV enhancer/promoter, (−453/+80)HIV-LUC, and the one containing 3-base pair substitutions in each NF-κB site, ΔNF-κB HIV-LUC. Cells were harvested 24 h after transfection and the protein extracts were prepared by three consecutive cycles of freezing and thawing. The total amount of protein was determined with a commercial kit based on the Bradford method (Bio-Rad). 2 μg of protein were assayed for luciferase activity using a commercial kit (Promega). For the SRE-binding site, both 4 × SRE-CAT and 3D.A.CAT reporters were used in this study. Protein extracts were prepared and 10–50 μg were assayed for the chloramphenicol acetyltransferase (CAT) activity as described previously (53Gorman C.M. Moffat L.F. Howard B.H. Mol. Cell. Biol. 1982; 2: 1044-1051Crossref PubMed Google Scholar). Transfection efficiencies were corrected by the ratio of the luciferase or CAT activity and the β-gal activity obtained in the same sample by co-transfection of the pCMV-β-gal plasmid. None of the proteins used in this study affected considerably the levels of transcriptional activation of pCMV-β-gal because similar levels were always observed when compared with the respective empty plasmids. Measurement of the activation of the chromosomal SRE-β-gal plasmid was performed as follows: NIH 3T3 cells were transfected with the pSV2Neo vector along with a SRE-β-gal plasmid and selected for G418 resistance. Approximately 200 colonies obtained by serial dilution were tested for β-galactosidase activity after serum stimulation. Four selected clones were then transfected with the pCDNAIIIB-derived expression vectors encoding for the constitutively activated Rho proteins and cells were incubated in DMEM, 0.5% fetal calf serum for the next 24 h. Cells were fixed in 1% glutaraldehyde and incubated at 37 °C for β-gal activity staining, using 5-bromo-4-chloro-3-indoyl β-d-galactoside as substrate. Efficiency of transfections were normalized by parallel transfections using the pCMV-β-gal plasmid. For protein expression assays, cells were transfected with the corresponding plasmids and incubated in DMEM, 0.5% fetal calf serum for the next 24 h. The lysis was performed in buffer containing 50 mm Tris-HCl, pH 7.5, 5 mm EDTA, 0.5% Triton X-100, 0.5% sodium deoxycholate, 10 mm Na4P2O7, 50 mm sodium fluoride, 20 μg/ml leupeptin, 20 μg/ml aprotinin, and 1 mm phenylmethylsulfonyl fluoride. The total amount of protein was determined with a commercial kit based on the Bradford method (Bio-Rad). Lysates were obtained in 1 × SDS Laemmli buffer. Thirty micrograms of total protein were analyzed by SDS-electrophoresis on 10% polyacrylamide gels (SDS-PAGE). After transferring to nitrocellulose, the blots were incubated with the corresponding rabbit antiserum (p50, RelA(p65), C/EBPβ) (Santa Cruz Laboratories). Immunocomplexes were visualized by enhanced chemiluminescence detection (Amersham) using a biotinylated anti-rabbit antibody and streptavidin peroxidase. Rho proteins are able to activate the transcription factor NF-κB in diverse cell systems (1Perona R. Montaner S. Saniger L. Sánchez-Pérez I. Bravo R. Lacal J.C. Genes Dev. 1997; 11: 463-475Crossref PubMed Google Scholar) and the serum response factor in NIH 3T3 fibroblasts (18Hill C.S. Wynne J. Treisman R. Cell. 1995; 81: 1159-1170Abstract Full Text PDF PubMed Scopus (1162) Google Scholar). We aimed to investigate whether activation of NF-κB by Rho proteins was functionally related to the activation of the SRE-dependent transcriptional activity. We first identified a suitable cell system to carry out both assays, NF-κB activation and SRE-dependent transcription, under similar conditions. The NF-κB-dependent (−453/+80)HIV-luciferase (HIV-LUC) plasmid was used (47Devary Y. Rosette C. DiDonato J.A. Karin M. Science. 1993; 261: 1442-1445Crossref PubMed Scopus (557) Google Scholar) as a reporter for NF-κB activity. This reporter contains two κB-binding sites within its enhancer region, which are mostly responsible for the transactivation of the HIV LTR. Fibroblast-like COS-7 cells were co-transfected with the cDNAs encoding for the constitutively activated forms of RhoA, Rac1, and Cdc42Hs (QL) proteins along with the HIV-LUC plasmid. As shown in Fig.1 A, an efficient transactivation of the HIV promoter could be readily observed. This effect was dependent on the κB-binding sites since the activation was completely avoided when a HIV-LUC reporter containing 3-base pair substitutions in each κB motif was used (data not shown). Under similar conditions, Rho proteins were also able to induce the transactivation of a 4 × SRE-CAT reporter in the same cell line (Fig. 1 B). The 4 × SRE-CAT plasmid contains the CAT gene under the control of a minimum promoter composed of four copies of the sequence of the SRE of the human c-fos gene along with a TATA box (54König H. Ponta H. Rahmsdorf U. Büscher M. Schönthal A. Rahmsdorf H.J. Herrlich P. EMBO J. 1989; 8: 2559-2566Crossref PubMed Scopus (154) Google Scholar). Similar results were obtained when both constitutively activated forms of two Rho family related exchange factors, Vav and Ost (55Cerione R.A. Zheng Y. Curr. Opin. Cell Biol. 1996; 8: 216-222Crossref PubMed Scopus (455) Google Scholar), were overexpressed (Fig. 1 B). Although there is a clearly positive and reproducible response with a 3–4-fold induction by serum, this is reduced compared with other cell systems. We also were able to demonstrate a more than 10-fold activation by serum when the NIH 3T3 cell system was used instead of the COS-7 cell sytem using the same reporter vectors (data not shown). These results demonstrate that these three members of the Rho family of GTPases mediate in the signal transduction pathways implicated in the activation of the transcription factor NF-κB and in the up-regulation of intracellular cascades which promote gene expression through the SRE-binding site in the simian fibroblast-like COS-7 cells. Artificious regulation of the SRE-driven transcription due to the characteristic episomal replication of a transfection system based on COS-7 cells could affect the results. In order to eliminate this possibility we also investigated whether SRE-dependent transcription could be stimulated by Rho proteins in cells stably transfected with a plasmid carrying the SRE-binding site in a non-episomal vector. NIH 3T3 cells were stably transfected with the pSV2Neo vector along with the SRE-β-gal plasmid and selected for G418 resistance. Over 200 different resistant colonies obtained by serial dilution were isolated and tested for β-galactosidase activity after serum stimulation. Four of them that scored close to 100% staining when stimulated by serum were selected for further analysis. Cells were transiently transfected with the pCDNAIIIB-derived expression vectors encoding for the constitutively activated forms of RhoA, Rac1, and Cdc42Hs GTPases and cells expressing the β-galactosidase were scored as positive. Efficiency of transfection for each plasmid preparation was normalized by parallel transfections using the β-galactosidase gene placed under control of the CMV promoter, allowing for constitutive expression of the β-galactosidase enzyme. As shown in Fig. 1 C, the three GTPases were able to promote transactivation through the chromosomal SRE site in one of the selected clones by at least 2-fold. Cdc42Hs was much more efficient, suggesting additional signaling pathways activated by Cdc42 to those activated by RhoA and Rac1, in agreement with the results reported by Albertset al. (56Alberts A.S. Geneste O. Treisman R. Cell. 1998; 92: 475-487Abstract Full Text Full Text PDF PubMed Scopus (193) Google Scholar). Similar results were observed when the other three independent clones were used (data not shown). Thus, these results provide a strong support to the implication of Rho GTPases in signal transduction pathways which determine the activation of transcription due to the SRE sequences under physiological conditions and establishes that the COS-7 cell system is appropriate to carry out the proposed experiments. It has been previously reported that the different Rel/NF-κB proteins are able to interact physically and functionally with members of other families of transcription factors such as AP1, Sp1, Stat6, ATF, HMG/Y, the glucocorticoid receptor, TBP, TFIIB, and C/EBP (57LeClair K.P. Blanar M.A. Sharp P.A. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 8145-8149Crossref PubMed Google Scholar, 58Perkins N.D. Edwards N.L. Duckett C.S. Agranoff A.B. Schmid R.M. Nabel G.J. EMBO J. 1993; 12: 3551-3558Crossref PubMed Scopus (381) Google Scholar, 59Stein B. Cogswell P.C. Baldwin Jr., A.S. Mol. Cell. Biol. 1993; 13: 3964-3974Crossref PubMed Google Scholar, 60Stein B. Baldwin Jr., A.S. Ballard D.W. Greene W.C. Angel P. Herrlich P. EMBO J. 1993; 12: 3879-3891Crossref PubMed Scopus (547) Google Scholar, 61Kaszubska W. Hooft van Huijsduijnen R. Ghersa P. DeRaemy-Schenk A.-M. Chen B.P.C. Hai T. DeLamarter J.F. Whelan J. Mol. Cell. Biol. 1993; 13: 7180-7190Crossref PubMed Google Scholar, 62Xu X. Prorock C. Ishikawa H. Maldonado E. Ito Y. Gélinas C. Mol. Cell. Biol. 1993; 13: 6733-6741Crossref PubMed Scopus (95) Google Scholar, 63Kerr L.D. Ransone L.J. Wamsley P. Schmitt M.J. Boyer T.G. Zhou Q. Berk A. Verma I.M. Nature. 1993; 365: 412-419Crossref PubMed Scopus (129) Google Scholar, 64Scheinman R.I. Gualberto A. Jewell C.M. Cidlowski J.A. Baldwin Jr., A.S. Mol. Cell. Biol. 1995; 15: 943-953Crossref PubMed Google Scholar, 65Shen C.-H. Stavnezer J. Mol. Cell. Biol. 1998; 18: 3395-3404Crossref PubMed Google Scholar, 66Hirano F. Tanaka H. Hirano Y. Hiramoto M. Handa H. Makino I. Scheidereit C. Mol. Cell. Biol. 1998; 18: 1266-1274Crossref PubMed Google Scholar). Cross-talkling between subunits of different families of transcription factors seems to be a relevant general event in the regulation of gene expression. In particular, previous studies suggested that NF-κB might also participate in the regulation of the transcriptional activity of the serum response factor (p67SRF), and a physical interaction between RelA and this protein had been observed in vitro (42Franzoso G. C" @default.
• W2078475797 created "2016-06-24" @default.
• W2078475797 creator A5006477586 @default.
• W2078475797 creator A5028089976 @default.
• W2078475797 creator A5051520058 @default.
• W2078475797 creator A5054941477 @default.
• W2078475797 date "1999-03-01" @default.
• W2078475797 modified "2023-10-02" @default.
• W2078475797 title "Activation of Serum Response Factor by RhoA Is Mediated by the Nuclear Factor-κB and C/EBP Transcription Factors" @default.
• W2078475797 cites W1426173733 @default.
• W2078475797 cites W1492606093 @default.
• W2078475797 cites W1494401713 @default.
• W2078475797 cites W1497061219 @default.
• W2078475797 cites W1507020270 @default.
• W2078475797 cites W1516457342 @default.
• W2078475797 cites W1564274931 @default.
• W2078475797 cites W1701546247 @default.
• W2078475797 cites W1796314406 @default.
• W2078475797 cites W1813044481 @default.
• W2078475797 cites W1888783223 @default.
• W2078475797 cites W1915074145 @default.
• W2078475797 cites W1964842789 @default.
• W2078475797 cites W1966732663 @default.
• W2078475797 cites W1970581527 @default.
• W2078475797 cites W1971639626 @default.
• W2078475797 cites W1973060929 @default.
• W2078475797 cites W1973901790 @default.
• W2078475797 cites W1974497444 @default.
• W2078475797 cites W1974653642 @default.
• W2078475797 cites W1982062664 @default.
• W2078475797 cites W1983123481 @default.
• W2078475797 cites W1991545343 @default.
• W2078475797 cites W1991743392 @default.
• W2078475797 cites W1991987237 @default.
• W2078475797 cites W1992557615 @default.
• W2078475797 cites W1996068610 @default.
• W2078475797 cites W1999157780 @default.
• W2078475797 cites W2000082154 @default.
• W2078475797 cites W2002282120 @default.
• W2078475797 cites W2003124067 @default.
• W2078475797 cites W2005019916 @default.
• W2078475797 cites W2018415739 @default.
• W2078475797 cites W2018812790 @default.
• W2078475797 cites W2025122344 @default.
• W2078475797 cites W2028287297 @default.
• W2078475797 cites W2034200840 @default.
• W2078475797 cites W2034856894 @default.
• W2078475797 cites W2036602491 @default.
• W2078475797 cites W2037915962 @default.
• W2078475797 cites W2042130821 @default.
• W2078475797 cites W2042584344 @default.
• W2078475797 cites W2047743989 @default.
• W2078475797 cites W2047842452 @default.
• W2078475797 cites W2051628416 @default.
• W2078475797 cites W2053257956 @default.
• W2078475797 cites W2055181868 @default.
• W2078475797 cites W2065257477 @default.
• W2078475797 cites W2068878178 @default.
• W2078475797 cites W2070853191 @default.
• W2078475797 cites W2074181772 @default.
• W2078475797 cites W2075946395 @default.
• W2078475797 cites W2077792958 @default.
• W2078475797 cites W2080590768 @default.
• W2078475797 cites W2082575834 @default.
• W2078475797 cites W2086008721 @default.
• W2078475797 cites W2088493593 @default.
• W2078475797 cites W2089478514 @default.
• W2078475797 cites W2091695331 @default.
• W2078475797 cites W2098586771 @default.
• W2078475797 cites W2099729324 @default.
• W2078475797 cites W2123898551 @default.
• W2078475797 cites W2126909895 @default.
• W2078475797 cites W2133853086 @default.
• W2078475797 cites W2139440574 @default.
• W2078475797 cites W2142504336 @default.
• W2078475797 cites W2143001254 @default.
• W2078475797 cites W2143756790 @default.
• W2078475797 cites W2146055738 @default.
• W2078475797 cites W2149439788 @default.
• W2078475797 cites W2149640683 @default.
• W2078475797 cites W2158110584 @default.
• W2078475797 cites W2158708535 @default.
• W2078475797 cites W2159674010 @default.
• W2078475797 cites W2164573438 @default.
• W2078475797 cites W2165465921 @default.
• W2078475797 cites W2166710017 @default.
• W2078475797 cites W2166781237 @default.
• W2078475797 cites W2168091755 @default.
• W2078475797 cites W2170005346 @default.
• W2078475797 cites W2320359800 @default.
• W2078475797 cites W2427880780 @default.
• W2078475797 cites W24759224 @default.
• W2078475797 cites W315803869 @default.
• W2078475797 cites W6484253 @default.
• W2078475797 cites W78317913 @default.
• W2078475797 cites W912507531 @default.
• W2078475797 cites W93066617 @default.
• W2078475797 cites W95988660 @default.

• next