FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2078485743> ?p ?o ?g. }

• W2078485743 endingPage "37697" @default.
• W2078485743 startingPage "37689" @default.
• W2078485743 abstract "β-Amyloid precursor protein apparently undergoes at least three major cleavages, γ-, ϵ-, and the newly identified ζ-cleavage, within its transmembrane domain to produce secreted β-amyloid protein (Aβ). However, the roles of ϵ- and ζ-cleavages in the formation of secreted Aβ and the relationship among these three cleavages, namely ϵ-, ζ-, and γ-cleavages, remain elusive. We investigated these issues by attempting to determine the formation and turnover of the intermediate products generated by these cleavages, in the presence or absence of known γ-secretase inhibitors. By using a differential inhibition strategy, our data demonstrate that Aβ46 is an intermediate precursor of secreted Aβ. Our co-immunoprecipitation data also reveal that, as an intermediate, Aβ46 is tightly associated with presenilin in intact cells. Furthermore, we identified a long Aβ species that is most likely the long sought after intermediate product, Aβ49, generated by ϵ-cleavage, and this Aβ49 is further processed by ζ- and γ-cleavages to generate Aβ46 and ultimately the secreted Aβ40/42. More interestingly, our data demonstrate that γ-cleavage not only occurs last but also depends on ζ-cleavage occurring prior to it, indicating that ζ-cleavage is crucial for the formation of secreted Aβ. Thus, we conclude that the C terminus of secreted Aβ is most likely generated by a series of sequential cleavages, namely first ϵ-cleavage which is then followed by ζ- and γ-cleavages, and that Aβ46 produced by ζ-cleavage is the precursor of secreted Aβ40/42. β-Amyloid precursor protein apparently undergoes at least three major cleavages, γ-, ϵ-, and the newly identified ζ-cleavage, within its transmembrane domain to produce secreted β-amyloid protein (Aβ). However, the roles of ϵ- and ζ-cleavages in the formation of secreted Aβ and the relationship among these three cleavages, namely ϵ-, ζ-, and γ-cleavages, remain elusive. We investigated these issues by attempting to determine the formation and turnover of the intermediate products generated by these cleavages, in the presence or absence of known γ-secretase inhibitors. By using a differential inhibition strategy, our data demonstrate that Aβ46 is an intermediate precursor of secreted Aβ. Our co-immunoprecipitation data also reveal that, as an intermediate, Aβ46 is tightly associated with presenilin in intact cells. Furthermore, we identified a long Aβ species that is most likely the long sought after intermediate product, Aβ49, generated by ϵ-cleavage, and this Aβ49 is further processed by ζ- and γ-cleavages to generate Aβ46 and ultimately the secreted Aβ40/42. More interestingly, our data demonstrate that γ-cleavage not only occurs last but also depends on ζ-cleavage occurring prior to it, indicating that ζ-cleavage is crucial for the formation of secreted Aβ. Thus, we conclude that the C terminus of secreted Aβ is most likely generated by a series of sequential cleavages, namely first ϵ-cleavage which is then followed by ζ- and γ-cleavages, and that Aβ46 produced by ζ-cleavage is the precursor of secreted Aβ40/42. The mechanism of the formation of the β-amyloid protein (Aβ) 2The abbreviations used are: Aβamyloid βpeptide;APPβamyloid precursor proteinAPPswSwedish mutant APPAICDAPP intracellular domainCTFC-terminal fragmentCMconditioned mediumPSpresenilinDAPTN-[N-(3,5-difluorophenacetyl)-l-alanyl]-(S)-phenylglycine t-butyl esterDAPMN-[N-(3,5-difluorophenacetyl)-l-alanyl]-(S)-phenylglycine methyl ester31CWPE-III-31CTGNtrans-Golgi networkCHAPSO3-[(3-cholamidopropyl)dimethylammonio]-2-hydroxy-1-propanesulfonic acidPIPES1,4-piperazinediethanesulfonic acidBicineN,N-bis(2-hydroxyethyl)glycineMOPS4-morpholinepropanesulfonic acidfAPPfull-length APP is the central issue in Alzheimer disease research, not only because Aβ is the major constituent of senile plaques, one of the neuropathological hallmarks of Alzheimer disease, but also because Aβ formation may be a causative event in the disease (1Selkoe D.J. Physiol. Rev. 2001; 81: 741-766Crossref PubMed Scopus (5170) Google Scholar). Aβ is proteolytically derived from a large single transmembrane protein, the β-amyloid precursor protein (APP), as a result of sequential cleavages by β- and γ-secretases (1Selkoe D.J. Physiol. Rev. 2001; 81: 741-766Crossref PubMed Scopus (5170) Google Scholar). β-Secretase has been identified as a type I membrane aspartyl protease (2Vassar R. Bennett B.D. Babu-Khan S. Kahn S. Mendiaz E.A. Denis P. Teplow D.B. Ross S. Amarante P. Loeloff R. Luo Y. Fisher S. Fuller J. Edenson S. Lile J. Jarosinski M.A. Biere A.L. Curran E. Burgess T. Louis J.C. Collins F. Treanor J. Rogers G. Citron M. Science. 1999; 286: 735-741Crossref PubMed Scopus (3308) Google Scholar, 3Yan R. Bienkowski M.J. Shuck M.E. Miao H. Tory M.C. Pauley A.M. Brashier J.R. Stratman N.C. Mathews W.R. Buhl A.E. Carter D.B. Tomasselli A.G. Parodi L.A. Heinrikson R.L. Gurney M.E. Nature. 1999; 402: 533-537Crossref PubMed Scopus (1339) Google Scholar). Although the exact nature of γ-secretase is still a matter of debate, accumulating evidence supports the idea that γ-secretase is a multiple molecular complex composed of, at least, presenilins, nicastrin, Aph-1, and Pen-2 and that presenilin may function as the catalytic subunit (4Kimberly W.T. Wolfe M.S. J. Neurosci. Res. 2003; 74: 353-360Crossref PubMed Scopus (91) Google Scholar). amyloid βpeptide; βamyloid precursor protein Swedish mutant APP APP intracellular domain C-terminal fragment conditioned medium presenilin N-[N-(3,5-difluorophenacetyl)-l-alanyl]-(S)-phenylglycine t-butyl ester N-[N-(3,5-difluorophenacetyl)-l-alanyl]-(S)-phenylglycine methyl ester WPE-III-31C trans-Golgi network 3-[(3-cholamidopropyl)dimethylammonio]-2-hydroxy-1-propanesulfonic acid 1,4-piperazinediethanesulfonic acid N,N-bis(2-hydroxyethyl)glycine 4-morpholinepropanesulfonic acid full-length APP In understanding the mechanism by which the C termini of secreted Aβ are generated during the processing of APP, three major intramembranous cleavages have been established. The first one is the cleavage now specifically referred to as γ-cleavage (5Weidemann A. Eggert S. Reinhard F.B. Vogel M. Paliga K. Baier G. Masters C.L. Beyreuther K. Evin G. Biochemistry (Mosc.). 2002; 41: 2825-2835Crossref Scopus (319) Google Scholar), which produces the C termini of most of the secreted Aβ species that end at amino acids 40 (Aβ40) or 42 (Aβ42) of the Aβ sequence. The second one is the ϵ-cleavage occurring between Aβ residues 49 and 50, which produces the N terminus of most of the APP intracellular domain (AICD) (5Weidemann A. Eggert S. Reinhard F.B. Vogel M. Paliga K. Baier G. Masters C.L. Beyreuther K. Evin G. Biochemistry (Mosc.). 2002; 41: 2825-2835Crossref Scopus (319) Google Scholar, 6Gu Y. Misonou H. Sato T. Dohmae N. Takio K. Ihara Y. J. Biol. Chem. 2001; 276: 35235-35238Abstract Full Text Full Text PDF PubMed Scopus (269) Google Scholar, 7Sastre M. Steiner H. Fuchs K. Capell A. Multhaup G. Condron M.M. Teplow D.B. Haass C. EMBO Rep. 2001; 2: 835-841Crossref PubMed Scopus (430) Google Scholar, 8Yu C. Kim S.H. Ikeuchi T. Xu H. Gasparini L. Wang R. Sisodia S.S. J. Biol. Chem. 2001; 276: 43756-43760Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar). The identification of this ϵ-cleavage site raises a question as to whether this ϵ-cleavage is obligatory for the generation of the C terminus of Aβ, and this also raises a question as to the relationship between ϵ- and γ-cleavages, i.e. whether they are independent of each other or sequential. One of the obstacles in addressing these questions is that neither the intermediate Aβ peptide, which ends at the ϵ-cleavage site, nor the C-terminal fragment, which starts with an N terminus generated by γ-cleavage, has ever been detected. In a recent study, we reported the identification of an intracellular long Aβ species, namely Aβ46, and this led to the discovery of the third major cleavage site, the ζ-cleavage site at Aβ46 between the known γ- and ϵ-cleavage sites (9Zhao G. Mao G. Tan J. Dong Y. Cui M.-Z. Kim S.-H. Xu X. J. Biol. Chem. 2004; 279: 50647-50650Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). The presence of ζ-cleavage site at Aβ46 is further supported by a very recent study showing that Aβ46 is the predominant form among the longer Aβ species detected intracellularly (10Qi-Takahara Y. Morishima-Kawashima M. Tanimura Y. Dolios G. Hirotani N. Horikoshi Y. Kametani F. Maeda M. Saido T.C. Wang R. Ihara Y. J. Neurosci. 2005; 25: 436-445Crossref PubMed Scopus (312) Google Scholar). However, the finding that the known γ-secretase inhibitors, such as DAPT, DAPM, and compound E, inhibit the formation of secreted Aβ40/42, and on the other hand cause the accumulation of Aβ46, raises the question as to whether Aβ40/42 and Aβ46 are produced by the same enzyme or by different enzymes (9Zhao G. Mao G. Tan J. Dong Y. Cui M.-Z. Kim S.-H. Xu X. J. Biol. Chem. 2004; 279: 50647-50650Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). Moreover, the roles of ϵ- and ζ-cleavages in the formation of secreted Aβ and the relationship among these three cleavages, namely ϵ-, ζ-, and γ-cleavages, also remain elusive. To address these key issues, the objectives of this study were focused on the following: (a) determining precursor and product relationship between Aβ46 and Aβ40/42; and (b) establishing the roles of ϵ- and ζ-cleavages in the formation of secreted Aβ40/42. γ-Secretase inhibitors, DAPT, DAPM, compound E, L-685,458, and WPE-III-31C (31C) were purchased from Calbiochem and dissolved in dimethyl sulfoxide. Aβ40 and Aβ42 were purchased from American Peptide Co. (Sunnyvale, CA). Aβ46, Aβ48, and Aβ49 are customized peptides. Cell Lines and Plasmids—N2a cells stably expressing either wild type presenilin 1 (PS1wt) alone or both PS1wt and Swedish mutant APP (APPsw) were kindly provided by Drs. Sangram S. Sisodia and Seong-Hun Kim (University of Chicago) and were maintained as described previously (11Kim S.H. Leem J.Y. Lah J.J. Slunt H.H. Levey A.I. Thinakaran G. Sisodia S.S. J. Biol. Chem. 2001; 276: 43343-43350Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar). The plasmid APPsw645, which expresses a C-terminal truncated APP ending at the ϵ-cleavage site Aβ49, was constructed using the site-directed mutagenesis kit (Stratagene). APPsw (12Thinakaran G. Teplow D.B. Siman R. Greenberg B. Sisodia S.S. J. Biol. Chem. 1996; 271: 9390-9397Abstract Full Text Full Text PDF PubMed Scopus (282) Google Scholar), kindly provided by Dr. Gopal Thinakaran (University of Chicago), was used as a template. A pair of oligonucleotides (E49, CGTCATCACCTTGTAGATGCTGAAGAAG; E49-r, CTTCTTCAGCATCTACAAGGTGATGACG), which are complementary to each other and contain a stop codon at position 50 of the Aβ sequence, were used as primers. Cell-free Assay—In vitro turnover of Aβ46 by γ-secretase activity was assayed in a cell-free assay system established previously (13Pinnix I. Musunuru U. Tun H. Sridharan A. Golde T. Eckman C. Ziani-Cherif C. Onstead L. Sambamurti K. J. Biol. Chem. 2001; 276: 481-487Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar), following the procedure described previously (7Sastre M. Steiner H. Fuchs K. Capell A. Multhaup G. Condron M.M. Teplow D.B. Haass C. EMBO Rep. 2001; 2: 835-841Crossref PubMed Scopus (430) Google Scholar) with minor modifications. Briefly, N2a cells were cultured in the presence of DAPM for 12 h and harvested in 9 volumes of homogenization buffer (10 mm MOPS, pH 7.0, 10 mm KCl) containing protease inhibitors (Complete, Roche Applied Science) and homogenized by passing through a 20-gauge needle 30 times. After removal of unbroken cells and nuclei by centrifugation at 800 × g at 4 °C for 10 min, membranes were pelleted by centrifugation at 20,000 × g at 4 °C for 30 min. The membranes were washed once with homogenization buffer and resuspended in assay buffer (150 mm sodium citrate pH 6.4, protease inhibitor mixture). Aliquots of equal amounts of membranes were then incubated at either 0 or 37 °C. After 1 h of incubation, aliquots (25 μl) were removed for Western blotting, and the remaining reaction mixtures were subjected to centrifugation at 20,000 × g for 30 min at 4 °C to yield the supernatant and pellet fractions. After addition of an equal volume of IP buffer (50 mm Tris/HCl, pH 7.4, 150 mm NaCl, 0.5% Nonidet P-40, 5 mm EDTA, and protease inhibitor mixture), the supernatant was subjected to immunoprecipitation using 6E10. The pellet fraction was solubilized with 1% Nonidet P-40 in IP buffer. After centrifugation at 20,000 × g at 4 °C for 15 min, the supernatant was diluted with equal amounts of IP buffer to lower the concentration of Nonidet P-40 to 0.5% and then subjected to immunoprecipitation using 6E10. The intracellular Aβ species were immunoprecipitated using 6E10. Both immunoprecipitates were analyzed by 10% Bicine/urea-SDS-PAGE, followed by Western blot analysis using 6E10 as described below. Detection of Aβ49—Note that in all of the experiments throughout this study, Aβ46 was determined by directly analyzing the cell lysates without immunoprecipitation. To determine the presence of the possible Aβ49, cells were cultured in the absence of any inhibitors and lysed with 1% Nonidet P-40 in IP buffer. After centrifugation at 20,000 × g at 4 °C for 15 min, the supernatant was diluted with an equal amount of IP buffer, and the Aβ49 and other intracellular Aβ species were immunoprecipitated using 6E10 in the presence or absence of DAPT. Of note, based on our previous data (9Zhao G. Mao G. Tan J. Dong Y. Cui M.-Z. Kim S.-H. Xu X. J. Biol. Chem. 2004; 279: 50647-50650Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar) and unpublished data, 3G. Zhao and X. Xu, unpublished data. it was found that all the tested nontransition state inhibitors, such as DAPT, DAPM, and compound E, cause intracellular accumulation of Aβ46 in the same fashion. However, in comparison with DAPM, the inhibitory effects of DAPT and compound E last longer, and this is probably because the enzyme binding activity of the latter two is stronger than that of DAPM. Therefore, DAPT and compound E were used in the in vitro assay and during the immunoprecipitation procedure. DAPM was used to cause the accumulation of Aβ46 in cells that would be used for determining the turnover of Aβ46 either in intact cells or in a cell-free system in which the inhibitor used for causing the accumulation of Aβ46 needs to be removed. Immunoprecipitation and Western Blotting—Immunoprecipitation and Western blotting were carried out as described previously (9Zhao G. Mao G. Tan J. Dong Y. Cui M.-Z. Kim S.-H. Xu X. J. Biol. Chem. 2004; 279: 50647-50650Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar) with the exception that in some cases the immunoprecipitation was carried out in the presence of 500 nm DAPT as indicated in the figure legends. Briefly, 24 h after splitting, cells were treated with inhibitors at various concentrations or with vehicle only as a control. Eight hours after treatment, cells were harvested and lysed in Western blot lysis buffer (50 mm Tris-HCl, pH 6.8, 8 m urea, 5% β-mercaptoethanol, 2% SDS, and protease inhibitors). Secreted Aβ was immunoprecipitated from conditioned media using a monoclonal Aβ-specific antibody 6E10 (Senetek). The immunoprecipitates were analyzed by 10% Bicine/urea-SDS-PAGE and transferred to a polyvinylidene fluoride membrane (Immobilon-P, Millipore). The membranes were then probed with 6E10, and the immunoreactivity bands were visualized using ECL-Plus (Amersham Biosciences). Fractionation and Co-immunoprecipitation—In order to determine the formation of the possible complex of Aβ46 and presenilin, the following procedure, which was originally described in a previous study (14Farmery M.R. Tjernberg L.O. Pursglove S.E. Bergman A. Winblad B. Naslund J. J. Biol. Chem. 2003; 278: 24277-24284Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar), was employed with slight modification. Briefly, N2a cells expressing APPsw695/PS1wt cultured in the presence of 3 nm compound E (or 500 nm L-685,458; see Fig. 4B) for 10-12 h were harvested and then homogenized in homogenization buffer A (20 mm HEPES, pH 7.4, 50 mm KCl, 2 mm EGTA, 10% glycerol, protease inhibitor mixture (Roche Applied Science)) containing 10 nm compound E (or 2.5 μm L-685,458) by passing through a 20-gauge needle 30 times. The homogenized samples were subjected to centrifugation at 800 × g for 10 min to remove the unbroken cells and nuclei. The postnuclear supernatant was further centrifuged at 20,000 × g for 1 h resulting in the supernatant and the pellet fractions. The resultant pellet, which contains both Aβ46 and PS1 (Fig. 4A), was solubilized in buffer B (50 mm PIPES, pH 7.0, 150 mm KCl, 5 mm MgCl2, 5 mm CaCl2, and protease inhibitor mixture)) (15Li Y.M. Lai M.T. Xu M. Huang Q. DiMuzio-Mower J. Sardana M.K. Shi X.P. Yin K.C. Shafer J.A. Gardell S.J. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 6138-6143Crossref PubMed Scopus (499) Google Scholar) containing 1% CHAPSO and 10 nm compound E (or 2.5 μm L-685,458), for 1 h at 4 °C and then subjected to centrifugation again at 20,000 × g for 25 min to remove the insoluble materials. The supernatant was diluted with an equal volume of solubilization buffer B to adjust CHAPSO to a final concentration of 0.5%. After pre-clearing with protein A-Sepharose beads for 3 h, the supernatant was incubated with anti-PS1N, a rabbit polyclonal antibody raised against the N terminus of PS1 (9Zhao G. Mao G. Tan J. Dong Y. Cui M.-Z. Kim S.-H. Xu X. J. Biol. Chem. 2004; 279: 50647-50650Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar) in the presence of compound E (or L-685,458) with rotation at 4 °C for 3-4 h, and then an appropriate amount of protein A-Sepharose beads was added and incubated overnight. After washing twice with solubilization buffer B containing 0.5% CHAPSO and γ-secretase inhibitors, and then twice with PBS, the immunocomplex was eluted with SDS-PAGE Sample loading buffer and separated by 10-18% SDS-PAGE followed by Western blotting using 6E10 to detect the co-immunoprecipitated Aβ46 and CTFβ. L-685,458 Inhibits the Formation of Aβ46—In our recent study, we have shown that treatment of cells with nontransition state γ-secretase inhibitors, such as DAPT, DAPM, and compound E, caused an increase in the accumulation of intracellular Aβ46, indicating that these inhibitors have no effect, or little effect, on the newly identified ζ-cleavage. On the other hand, when the cells were cultured in the presence of transition state analogs, such as L-685,458 and 31C, Aβ46 was not detectable, strongly suggesting that these inhibitors inhibit the ζ-cleavage and block the formation of Aβ46 (9Zhao G. Mao G. Tan J. Dong Y. Cui M.-Z. Kim S.-H. Xu X. J. Biol. Chem. 2004; 279: 50647-50650Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). However, it cannot be ruled out that the absence of Aβ46 in cells treated with L-685,458 may be due to the inability of this inhibitor to block the turnover of Aβ46. To address these issues, N2a cells expressing both PS1wt and APPsw were treated with DAPT, compound E, and L-685,458, either individually or in combination. Both the cell lysate and the secreted Aβ40/42 immunoprecipitated from conditioned medium (CM) were analyzed by 10% Bicine/urea-SDS-PAGE as described previously (16Wiltfang J. Smirnov A. Schnierstein B. Kelemen G. Matthies U. Klafki H.W. Staufenbiel M. Huther G. Ruther E. Kornhuber J. Electrophoresis. 1997; 18: 527-532Crossref PubMed Scopus (121) Google Scholar), followed by Western blotting using 6E10. As shown in Fig. 1, treatment with 0.5 μm DAPT (lane 2)or 5nm compound E (lane 3) caused a marked decrease in secreted Aβ40/42 (lower panel) and an accumulation of intracellular Aβ46 (upper panel). Fig. 1, lanes 12-15 and lanes 16-19, shows the dose-dependent effects of compound E and DAPM on the reduction of secreted Aβ40/42 and the concomitant accumulation of intracellular Aβ46, respectively. Of note, by directly analyzing the cell lysate, Aβ46 can also be detected in cells not treated with any inhibitor after prolonged exposure of the Western blot (Fig. 1, lane 11), as has been shown in our recent study (9Zhao G. Mao G. Tan J. Dong Y. Cui M.-Z. Kim S.-H. Xu X. J. Biol. Chem. 2004; 279: 50647-50650Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). On the other hand, treatment with L-685,458, at a range of concentrations from 0.5 to 2.5 μm, completely abolished the formation of secreted Aβ40/42 in the CM (Fig. 1, lanes 4-6, lower panel), whereas it did not cause the accumulation of intracellular Aβ46 (upper panel). To determine whether the absence of Aβ46 was a result of the failure of L-685,458 to block the turnover of Aβ46, cells were treated with L-685,458 plus 0.5 μm DAPT or plus 5 nm compound E, both of which have been shown to block the turnover of Aβ46 (9Zhao G. Mao G. Tan J. Dong Y. Cui M.-Z. Kim S.-H. Xu X. J. Biol. Chem. 2004; 279: 50647-50650Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar), see also Fig. 1, lanes 2 and 3. As shown in Fig. 1, the addition of DAPT (lanes 7 and 8) or compound E (lanes 9 and 10) did not lead to the accumulation of Aβ46 in the presence of L-685,458. This result clearly indicates that the absence of Aβ46, in cells treated with L-685,458, is due solely to its inhibition of the formation of Aβ46, rather than its failure to block the turnover of Aβ46. Aβ46 Is Processed into Aβ40/42 in Vitro—As reported in our recent study (9Zhao G. Mao G. Tan J. Dong Y. Cui M.-Z. Kim S.-H. Xu X. J. Biol. Chem. 2004; 279: 50647-50650Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar), at a low range of concentrations, DAPM, DAPT, and compound E cause a dose-dependent decrease in secreted Aβ40/42 and a concomitant increase in intracellular Aβ46 (see also Fig. 1), suggesting a possible precursor-product relationship between Aβ46 and Aβ40/42. This hypothesis is also supported by the facts that Aβ46 contains the γ-cleavage site at Aβ40/42 and that Aβ46 is detectable in living cells in the absence of any inhibitors (Fig. 1, lanes 1 and 11), which suggests that ζ-cleavage occurs prior to γ-cleavage, otherwise the ζ-cleavage product Aβ46 would not have had a chance of being formed. To explore the possible precursor-product relationship between Aβ46 and Aβ40/42, we first determined whether Aβ46 is processed into Aβ40/42. To address this issue, a system that contains pre-existing Aβ46 is required. For this purpose, a cell-free system, which has been established and used in many previous studies to assay the in vitro γ-secretase activity (7Sastre M. Steiner H. Fuchs K. Capell A. Multhaup G. Condron M.M. Teplow D.B. Haass C. EMBO Rep. 2001; 2: 835-841Crossref PubMed Scopus (430) Google Scholar, 13Pinnix I. Musunuru U. Tun H. Sridharan A. Golde T. Eckman C. Ziani-Cherif C. Onstead L. Sambamurti K. J. Biol. Chem. 2001; 276: 481-487Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar), was employed. Cells were cultured in the presence of 100 nm DAPM, which has been shown to cause the accumulation of Aβ46 (Fig. 1), and the membranes were prepared as described under “Materials and Methods.” As shown in Fig. 2, the membranes were then incubated in the absence of inhibitors (lanes 5 and 6), in the presence of DAPT (lane 7), and in the presence of L-685,458 (lane 8) at 37 °C. The sample in Fig. 2, lane 5, was incubated at 0 °C. After 1 h of incubation, reaction mixtures were centrifuged at 20,000 × g, and the resulting supernatants and pellets were subjected to immunoprecipitation by using 6E10. As shown in Fig. 2, top panel, Aβ40/42 was not immunoprecipitated from the pellet of membranes incubated at 0 °C (lane 5). However, Aβ40/42 was indeed immunoprecipitated from the pellet of membranes incubated at 37 °C with a concomitant decrease in Aβ46 (Fig. 2, compare lane 6 with lane 5), clearly indicating that Aβ46 was processed into Aβ40/42. Most interestingly, Aβ40/42 was also immunoprecipitated from the pellet of membranes incubated at 37 °C, in the presence of L-685,458 (Fig. 2, lane 8) but not from the pellet of membranes incubated in the presence of DAPT (lane 7). Note that in Fig. 2, lane 6, both pre-accumulated Aβ46 (top panel) and CTFβ (middle panel) decreased in comparison with those of the control in lane 5, suggesting that the Aβ40/42 detected in the absence of inhibitor (lane 6) is the sum of the Aβ40/42 produced from both accumulated Aβ46 and CTFβ. To confirm further that in the absence of inhibitor, CTFβ was processed by γ-secretase, aliquots of the reaction mixtures corresponding to samples in Fig. 2, lanes 5-8 in the middle panel, were separated by 10-18% regular SDS-PAGE and probed with antibody C15, an APP C-terminal specific antibody (9Zhao G. Mao G. Tan J. Dong Y. Cui M.-Z. Kim S.-H. Xu X. J. Biol. Chem. 2004; 279: 50647-50650Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). As shown in Fig. 2, bottom panel, in contrast to the basal level of AICD detected in samples in the presence of DAPT and L-685,458 (lanes 7 and 8), a significant amount of AICD was detected in the absence of inhibitor with a concomitant decrease in CTFβ and CTFα (lane 6). This result provides further support for the conclusion that γ-secretase-mediated processing of CTFβ contributes to the Aβ40/42 detected in Fig. 2, lane 6 (middle panel). The fact that CTFβ remains unchanged, in the presence of L-685,458 (compare Fig. 2, lane 8 with lane 5, middle and bottom panels), but that the pre-accumulated Aβ46 decreased with the concomitant production of Aβ40/42 indicates that the Aβ40/42 detected in Fig. 2, lane 8, is produced solely from the pre-accumulated Aβ46. This also explains why the amount of Aβ40/42 detected in Fig. 2, lane 8, is slightly less than that detected in lane 6. The fact that in the presence of L-685,458, the reduction of Aβ46 is similar to that of a membrane incubated in the absence of any inhibitors (compare lane 8 with lane 6, top panel) indicates that L-685,458 has no effect on the turnover of Aβ46. It was noted that only a trace amount of detectable Aβ40/42 was immunoprecipitated from the supernatants (Fig. 2, lanes 2 and 4, upper panel). One possibility is that the secretion of Aβ40/42 from the living cells might be an energy-dependent procedure. Therefore, the secretion of Aβ40/42 from the membrane of a cell-free system is not as efficient as in the living cells. Notably, small amounts of Aβ46, CTFβ, and full-length APP were also detected in these supernatants. It is possible that the Aβ40/42, as well as other APP derivatives detected in the supernatants, may be associated with the low density membranes contained in the supernatant fraction. The other possibility is that once the Aβ40/42 is released from the membrane, or more precisely from the γ-secretase complex, it might be rapidly degraded by the proteases released, during resuspension and incubation, from the membrane, which contains many kinds of protease-containing vesicles. In contrast, the Aβ40/42, which still remains in the membrane or, more precisely, before being released from the γ-secretase complex, was protected from the degradation. In this regard, it has been reported that the association of CTFβ with PS1 protects CTFβ from random degradation (17Pitsi D. Octave J.N. J. Biol. Chem. 2004; 279: 25333-25338Abstract Full Text Full Text PDF PubMed Scopus (19) Google Scholar). This degradation of Aβ40/42 released from the membrane may also account for the fact that the amount of Aβ40/42 detected is smaller than expected, compared with the decrease in precursor Aβ46. Aβ46 Is Processed into Aβ40/42 in Living Cells in the Presence of L-685,458—As shown in Fig. 2, Aβ46 was indeed processed into Aβ40/42 in a cell-free system. Data presented in Fig. 2 also clearly demonstrate that L-685,458, the transition state analog, did not block the turnover of Aβ46 into Aβ40/42 in a cell-free system, indicating that L-685,458 has no detectable effect on γ-cleavage that produces Aβ40/42 from Aβ46. The finding that the γ-cleavage and the new ζ-cleavage can be differentially inhibited by different inhibitors made it possible to determine the relationship between Aβ46 and Aβ40/42 and the role of the new ζ-cleavage in the formation of secreted Aβ40/42 in a living cell system. As shown in Fig. 3A, 24 h after splitting, cells were treated with either 100 nm DAPM (lanes 3-5 and 7) or 0.5 μm L-685,458 (lane 6) for 12 h. Fig. 3A, lanes 1 and 2, were the controls incubated with the vehicle dimethyl sulfoxide (Me2SO) only. As shown in Fig. 1, at the specified concentrations, DAPM completely blocked the formation of secreted Aβ40/42 and caused marked accumulation of Aβ46 (Fig. 1, lane 18), and L-685,458 completely blocked the formation of Aβ40/42 and Aβ46 (Fig. 1, lane 4). After 12 h of incubation, L-685,458 (0.5 μm) was added to the cells in Fig. 3A, lane 2. L-685,458 was also added to the cells in Fig. 3A, lanes 5 and 7, in addition to the existing DAPM, and was continuously incubated for 40 min to completely stop the generation of new Aβ46 in these cells, because at this concentration, L-685,458 blocked the formation of Aβ46 (Fig. 1, lane 4). Since L-685,458 has no effect on the turnover of Aβ46 (Fig. 2), this treatment also allows the complete turnover of the Aβ46 possibly existing in the cells of lane 2 of Fig. 3A. As a control, cells in Fig. 3A, lane 1, were cultured in the presence of Me2SO throughout the course of the experiment. All cells were then washed twice with fresh medium containing the appropriate inhibitor, which was to be used in the next incubation step, and cultured for an additional 2 h either in the presence or absence of inhibitors as indicated. Aβ40/42 was immunoprecipitated" @default.
• W2078485743 created "2016-06-24" @default.
• W2078485743 creator A5005730255 @default.
• W2078485743 creator A5013977026 @default.
• W2078485743 creator A5037787297 @default.
• W2078485743 creator A5039734860 @default.
• W2078485743 creator A5059777512 @default.
• W2078485743 creator A5062624262 @default.
• W2078485743 creator A5076111165 @default.
• W2078485743 date "2005-11-01" @default.
• W2078485743 modified "2023-10-18" @default.
• W2078485743 title "γ-Cleavage Is Dependent on ζ-Cleavage during the Proteolytic Processing of Amyloid Precursor Protein within Its Transmembrane Domain" @default.
• W2078485743 cites W1480987708 @default.
• W2078485743 cites W1495136850 @default.
• W2078485743 cites W1502785574 @default.
• W2078485743 cites W1554824558 @default.
• W2078485743 cites W1606891122 @default.
• W2078485743 cites W1967566501 @default.
• W2078485743 cites W1984204850 @default.
• W2078485743 cites W1989040424 @default.
• W2078485743 cites W1991678120 @default.
• W2078485743 cites W2032232498 @default.
• W2078485743 cites W2056790763 @default.
• W2078485743 cites W2057709960 @default.
• W2078485743 cites W2074438246 @default.
• W2078485743 cites W2084449734 @default.
• W2078485743 cites W2085797715 @default.
• W2078485743 cites W2087254373 @default.
• W2078485743 cites W2088857961 @default.
• W2078485743 cites W2088881960 @default.
• W2078485743 cites W2094842946 @default.
• W2078485743 cites W2097750046 @default.
• W2078485743 cites W2128084592 @default.
• W2078485743 cites W2133019124 @default.
• W2078485743 cites W2138416159 @default.
• W2078485743 cites W2140503956 @default.
• W2078485743 cites W2158509547 @default.
• W2078485743 cites W2162815565 @default.
• W2078485743 cites W2169152986 @default.
• W2078485743 doi "https://doi.org/10.1074/jbc.m507993200" @default.
• W2078485743 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16157587" @default.
• W2078485743 hasPublicationYear "2005" @default.
• W2078485743 type Work @default.
• W2078485743 sameAs 2078485743 @default.
• W2078485743 citedByCount "126" @default.
• W2078485743 countsByYear W20784857432012 @default.
• W2078485743 countsByYear W20784857432013 @default.
• W2078485743 countsByYear W20784857432014 @default.
• W2078485743 countsByYear W20784857432015 @default.
• W2078485743 countsByYear W20784857432016 @default.
• W2078485743 countsByYear W20784857432017 @default.
• W2078485743 countsByYear W20784857432018 @default.
• W2078485743 countsByYear W20784857432019 @default.
• W2078485743 countsByYear W20784857432020 @default.
• W2078485743 countsByYear W20784857432021 @default.
• W2078485743 countsByYear W20784857432022 @default.
• W2078485743 crossrefType "journal-article" @default.
• W2078485743 hasAuthorship W2078485743A5005730255 @default.
• W2078485743 hasAuthorship W2078485743A5013977026 @default.
• W2078485743 hasAuthorship W2078485743A5037787297 @default.
• W2078485743 hasAuthorship W2078485743A5039734860 @default.
• W2078485743 hasAuthorship W2078485743A5059777512 @default.
• W2078485743 hasAuthorship W2078485743A5062624262 @default.
• W2078485743 hasAuthorship W2078485743A5076111165 @default.
• W2078485743 hasBestOaLocation W20784857431 @default.
• W2078485743 hasConcept C118892022 @default.
• W2078485743 hasConcept C12554922 @default.
• W2078485743 hasConcept C142724271 @default.
• W2078485743 hasConcept C151730666 @default.
• W2078485743 hasConcept C170493617 @default.
• W2078485743 hasConcept C175156509 @default.
• W2078485743 hasConcept C181199279 @default.
• W2078485743 hasConcept C185592680 @default.
• W2078485743 hasConcept C24530287 @default.
• W2078485743 hasConcept C2779134260 @default.
• W2078485743 hasConcept C2781307694 @default.
• W2078485743 hasConcept C31705614 @default.
• W2078485743 hasConcept C36103677 @default.
• W2078485743 hasConcept C41625074 @default.
• W2078485743 hasConcept C43369102 @default.
• W2078485743 hasConcept C502032728 @default.
• W2078485743 hasConcept C55493867 @default.
• W2078485743 hasConcept C71924100 @default.
• W2078485743 hasConcept C86803240 @default.
• W2078485743 hasConcept C95444343 @default.
• W2078485743 hasConceptScore W2078485743C118892022 @default.
• W2078485743 hasConceptScore W2078485743C12554922 @default.
• W2078485743 hasConceptScore W2078485743C142724271 @default.
• W2078485743 hasConceptScore W2078485743C151730666 @default.
• W2078485743 hasConceptScore W2078485743C170493617 @default.
• W2078485743 hasConceptScore W2078485743C175156509 @default.
• W2078485743 hasConceptScore W2078485743C181199279 @default.
• W2078485743 hasConceptScore W2078485743C185592680 @default.
• W2078485743 hasConceptScore W2078485743C24530287 @default.
• W2078485743 hasConceptScore W2078485743C2779134260 @default.
• W2078485743 hasConceptScore W2078485743C2781307694 @default.
• W2078485743 hasConceptScore W2078485743C31705614 @default.
• W2078485743 hasConceptScore W2078485743C36103677 @default.

• next