FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2078679462> ?p ?o ?g. }

• W2078679462 endingPage "40291" @default.
• W2078679462 startingPage "40283" @default.
• W2078679462 abstract "Intense hyperleptinemia completely depletes adipocyte fat of normal rats within 14 days. To determine the mechanism, epididymal fat pads from normal wild-type (+/+) and obese (fa/fa) Zucker Diabetic Fatty (ZDF) donor rats were transplanted into normal +/+ and fa/fa ZDF recipients. Hyperleptinemia induced by adenovirus-leptin administration depleted all fat from native fat pads and from fat transplants from +/+ donors but not from transplants from ZDFfa/fa donors with defective leptin receptors. In both native and transplanted +/+ fat pads, large numbers of mitochondria were apparent, and genes involved in fatty acid oxidation were up-regulated. However, +/+ fat pads transplanted into fa/fa recipients did not respond to hyperleptinemia, suggesting lack of an essential leptin-stimulated cohormone(s). In +/+ but not in fa/fa rats, plasma catecholamine levels rose, and both P-STAT3 and P-CREB increased in adipose tissue, suggesting that both direct and indirect (hypothalamic) leptin receptor-mediated actions of hyperleptinemia are involved in depletion of adipocyte fat. Intense hyperleptinemia completely depletes adipocyte fat of normal rats within 14 days. To determine the mechanism, epididymal fat pads from normal wild-type (+/+) and obese (fa/fa) Zucker Diabetic Fatty (ZDF) donor rats were transplanted into normal +/+ and fa/fa ZDF recipients. Hyperleptinemia induced by adenovirus-leptin administration depleted all fat from native fat pads and from fat transplants from +/+ donors but not from transplants from ZDFfa/fa donors with defective leptin receptors. In both native and transplanted +/+ fat pads, large numbers of mitochondria were apparent, and genes involved in fatty acid oxidation were up-regulated. However, +/+ fat pads transplanted into fa/fa recipients did not respond to hyperleptinemia, suggesting lack of an essential leptin-stimulated cohormone(s). In +/+ but not in fa/fa rats, plasma catecholamine levels rose, and both P-STAT3 and P-CREB increased in adipose tissue, suggesting that both direct and indirect (hypothalamic) leptin receptor-mediated actions of hyperleptinemia are involved in depletion of adipocyte fat. In normal lean rodents, the induction of hyperleptinemia by administration of recombinant adenovirus containing the leptin cDNA (AdCMV-leptin) causes all visible fat to melt away within 7 days (1Chen G. Koyama K. Yuan X. Lee Y. Zhou Y.T. O'Doherty R. Newgard C.B. Unger R.H. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 14795-14799Crossref PubMed Scopus (285) Google Scholar). In what is probably the most striking effect of this hormone, white adipocytes are transformed into fatless cells filled with small mitochondria (2Orci L. Cook W.S. Ravazzola M. Wang M.Y. Park B.H. Montesano R. Unger R.H. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 2058-2063Crossref PubMed Scopus (207) Google Scholar). In addition, genes such as ucp-1 (uncoupling protein-1) and pgc-1α (peroxisome proliferator-activated receptor-γ-coactivator-1-α), normally expressed in brown but not white adipocytes, are expressed at high levels, whereas adipocyte markers, such as leptin and aP2, are profoundly down-regulated (2Orci L. Cook W.S. Ravazzola M. Wang M.Y. Park B.H. Montesano R. Unger R.H. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 2058-2063Crossref PubMed Scopus (207) Google Scholar). Despite their similarities to brown adipocytes, these transformed white adipocytes differ sufficiently to warrant designation as a novel derivative cell, the “post-adipocyte” (2Orci L. Cook W.S. Ravazzola M. Wang M.Y. Park B.H. Montesano R. Unger R.H. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 2058-2063Crossref PubMed Scopus (207) Google Scholar). Although fat depletion of adipocytes by hyperleptinemia occurs only in lean and not in obese rodents, understanding of its mechanisms may have implications for the treatment of obesity. The fat depletion induced by experimental hyperleptinemia differs from that of naturally occurring catabolic states, such as starvation and insulin deficiency, in which free fatty acids are released from the adipocytes and oxidized in the liver. The fat depletion of experimental hyperleptinemia is unaccompanied by an increase in plasma free fatty acids or ketones (3Shimabukuro M. Koyama K. Chen G. Wang M.Y. Trieu F. Lee Y. Newgard C.B. Unger R.H. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 4637-4641Crossref PubMed Scopus (618) Google Scholar, 4Wang M.Y. Lee Y. Unger R.H. J. Biol. Chem. 1999; 274: 17541-17544Abstract Full Text Full Text PDF PubMed Scopus (302) Google Scholar), and the molecular and morphologic changes (2Orci L. Cook W.S. Ravazzola M. Wang M.Y. Park B.H. Montesano R. Unger R.H. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 2058-2063Crossref PubMed Scopus (207) Google Scholar) imply that the oxidation takes place within the transformed adipocytes. The pathway by which hyperleptinemia induces transformation of adipocytes to post-adipocytes has not been clearly identified. We know that leptin-responsive centers in the hypothalamus regulate energy metabolism and feeding behavior (3Shimabukuro M. Koyama K. Chen G. Wang M.Y. Trieu F. Lee Y. Newgard C.B. Unger R.H. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 4637-4641Crossref PubMed Scopus (618) Google Scholar, 4Wang M.Y. Lee Y. Unger R.H. J. Biol. Chem. 1999; 274: 17541-17544Abstract Full Text Full Text PDF PubMed Scopus (302) Google Scholar, 5Maffei M. Fei H. Lee G.H. Dani C. Leroy P. Zhang Y. Proenca R. Negrel R. Ailhaud G. Friedman J.M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 6957-6960Crossref PubMed Scopus (419) Google Scholar, 6Stephens T.W. Basinski M. Bristow P.K. Bue-Valleskey J.M. Burgett S.G. Craft L. Hale J. Hoffmann J. Hsiung H.M. Kriauciunas A. MacKellar W. Rosteck Jr., P.R. Schoner B. Smith D. Tinsley F.C. Zhang X.-Y. Heiman M. Nature. 1995; 377: 530-532Crossref PubMed Scopus (1474) Google Scholar, 7Ahima R.S. Prabakaran D. Mantzoros C. Qu D. Lowell B. Maratos-Flier E. Flier J.S. Nature. 1996; 382: 250-252Crossref PubMed Scopus (2685) Google Scholar, 8Schwartz M.W. Seeley R.J. Campfield L.A. Burn P. Baskin D.G. J. Clin. Investig. 1996; 98: 1101-1106Crossref PubMed Scopus (1372) Google Scholar), but there is also evidence for direct leptin action on adipocytes (9Elmquist J.K. Ahima R.S. Elias C.F. Flier J.S. Saper C.B. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 741-746Crossref PubMed Scopus (329) Google Scholar, 10Rosenbaum M. Goldsmith R. Bloomfield D. Magnano A. Weimer L. Heymsfield S. Gallagher D. Mayer L. Murphy E. Leibel R.L. J. Clin. Investig. 2005; 115: 3579-3586Crossref PubMed Scopus (442) Google Scholar, 11Fruhbeck G. Aguado M. Martinez J.A. Biochem. Biophys. Res. Commun. 1997; 240: 590-594Crossref PubMed Scopus (226) Google Scholar) and on other tissues (12Siegrist-Kaiser C.A. Pauli V. Juge-Aubry C.E. Boss O. Pernin A. Chin W.W. Cusin I. Rohner-Jeanrenaud F. Burger A.G. Zapf J. Meier C.A. J. Clin. Investig. 1997; 100: 2858-2864Crossref PubMed Scopus (333) Google Scholar, 13Kieffer T.J. Heller R.S. Habener J.F. Biochem. Biophys. Res. Commun. 1996; 224: 522-527Crossref PubMed Scopus (315) Google Scholar, 14Emilsson V. Liu Y.L. Cawthorne M.A. Morton N.M. Davenport M. Diabetes. 1997; 46: 313-316Crossref PubMed Scopus (0) Google Scholar, 15Cao G.Y. Considine R.V. Lynn R.B. Am. J. Physiol. 1997; 273: E448-E452PubMed Google Scholar, 16Fei H. Okano H.J. Li C. Lee G.H. Zhao C. Darnell R. Friedman J.M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 7001-7005Crossref PubMed Scopus (655) Google Scholar, 17Kim Y.B. Uotani S. Pierroz D.D. Flier J.S. Kahn B.B. Endocrinology. 2000; 141: 2328-2339Crossref PubMed Scopus (196) Google Scholar). Here we report that the fat-depleting action of hyperleptinemia requires both direct leptin receptor (Lepr) 3The abbreviations used are: Lepr, leptin receptor; ZDF, Zucker Diabetic Fatty; RT, reverse transcription; CREB, cAMP-response element-binding protein; TG, triacylglycerol; FAS, fatty-acid synthase; STAT, signal transduction and activation of transcription. -mediated action on adipocytes coordinated with Lepr-mediated stimulation of sympathetic and perhaps other centers in the hypothalamus. Animals—Male obese ZDF homozygous (fa/fa) and wildtype (+/+) rats were bred in our laboratory and housed in individual cages with a constant temperature and 12 h of light alternating with 12 h of darkness. All were fed standard chow (Teklad mouse/rat diet, Teklad, Madison, WI) and had access to chow and water ad libitum. Experimental Procedures—Epididymal fat pads were isolated from 6-week-old ZDF+/+ or ZDFfa/fa rats under ketamine-xy-lazine anesthesia. The fat pads were weighed, washed with saline, and trimmed so that each transplant weighed 300 mg. Fat pads from ZDF+/+ donors were transplanted on top of the right anterior rectus abdominis muscle of the ZDF+/+ recipient rats and fat pads from ZDFfa/fa donors on the left side. The abdominal wound was then closed. In other experiments ZDFfa/fa rats were used as recipients. Ten days later ZDF+/+ rats were infused with 1 × 1012 plaque-forming units of recombinant adenovirus containing either the leptin cDNA (AdCMV-leptin) or, as an inactive control, the β-galactosidase cDNA (AdCMV-β-gal). Most animals were sacrificed 14 days after the virus injection or in some cases 3 or 7 days after the virus injection. The abdominal wound was reopened, and the transplanted epididymal fat pad grafts were photographed in situ and then excised for weighing. The specimens were divided, and one portion was fixed for morphological studies, and the other was stored in liquid nitrogen for real time RT-PCR analysis. Microscopy—Fat tissue was fixed with 2% glutaraldehyde in cacodylate buffer, post-fixed in osmium tetroxide, stained en bloc with uranyl acetate, dehydrated in graded ethanols, and embedded in Epon 812. Semithin (1-μm-thick) and thin sections were cut with an LKB ultramicrotome (Amersham Biosciences). Semithin sections were photographed under phase contrast using a Zeiss photomicroscope. Thin sections were stained with uranyl acetate and lead citrate and examined in a Philips CM10 electron microscope. Quantitative Real Time RT-PCR—Total RNA was extracted by the Trizol isolation method according to the manufacturer's protocol (Invitrogen). Total RNA (2 μg) was treated with RNase-free DNase (Invitrogen), and first-strand cDNA was generated with the random hexamer primer in the first strand cDNA synthesis kit (Applied Biosystems, Foster City, CA). Specific primers were designed using primer express software (Applied Biosystems), and their primer sequences were as follows: ACCα, TCGAAGAGCTTATATCGCCTATGA (forward) and GGGCAGCATGAACTGAAATTC (reverse); FAS, GGAGGAGGCGGCTTCTGT (forward) and GCTGAATACGACCACGCACTAC (reverse); SCD-1, CGCTCCGCCACACTTGAT and reverse GTGGTCGTGTAGGAACTGGAGAT; and PGC-1α, forward GCGCCAGCCAACACTCA and reverse TGGGTGTGGTTTGCATGGT. The sequence for the control 18 S ribosomal RNA was purchased from Applied Biosystems and used as the invariant control. The real time RT-PCR contained in a final volume of 10 μl, 10 ng of reverse-transcribed total RNA, 167 nm forward and reverse primers, and 2× PCR master mix. PCR was carried out in 384-well plates using the ABI Prism 7900HT Sequence Detection System (Applied Biosystems). All reactions were done in triplicate. Determination of TG Content of Adipose Tissue—A portion of the fat was dissected from the native epididymal fat pad and transplants. Tissues were placed in 2 ml of homogenizing buffer containing 18 mm Tris-HCl (pH 7.4), 300 mm of d-mannitol, and 50 mm EGTA and 1 mm phenylmethylsulfonyl fluoride and were homogenized by using a Polytron for 30 s. Homogenates were treated with 4 ml of a 2:1 chloroform/methanol mixture for 1 h with occasional vortexing. 100 μl of homogenates was used for protein assay, and lipid was further extracted. TG content was measured with TG diagnostic kit (Sigma). Immunoblotting—Total cell extracts prepared from fat tissues of rats or mice were resolved by SDS-PAGE and transferred to polyvinylidene difluoride membrane (Amersham Biosciences). The blotted membrane was blocked in 1× Trisbuffered saline containing 0.1% Tween and 5% nonfat dry milk (TBST-MLK) for 1 h at room temperature with gentle, constant agitation. After incubation with rabbit primary antibodies to phospho-STAT3 (Tyr-705), STAT3, phospho-CREB (Ser-133), and CREB (Cell Signaling Technology, Beverly, MA) in freshly prepared TBST-MLK at 4 °C overnight with agitation, the membrane was washed twice with TBST buffer followed by incubating with goat anti-rabbit horseradish peroxidase-conjugated IgG in TBST-MLK for 1 h at room temperature with agitation. The membrane was then washed three times with TBST buffer, and the proteins of interest on immunoblots were detected using an enhanced chemiluminescence detection system (Amersham Biosciences). γ-Tubulin was employed throughout as a loading control. Radioimmunoassays—Plasma leptin was measured by leptin radioimmunoassay kit (Linco Research Immunoassay, St. Charles, MO). Plasma catecholamines were measured with Bi-CAT radioimmunoassay kit (ALPCO Diagnostics, Windham, NH). Statistics—The results in this study are presented as means ± S.D. and were evaluated with Student's t test for two groups. Direct Lepr-mediated Action on Adipocytes Is Necessary for Depletion of Fat Stores by Hyperleptinemia—To determine whether normal Leprs on adipocytes are required for the fat-depleting action of hyperleptinemia in vivo, we transplanted into 6-week-old normal, lean ZDF+/+ recipients a fat pad resected from a 5-6-week-old normal lean wild-type (+/+) ZDF donor rat with functioning Leprs and a fat pad from an obese ZDFfa/fa rat with a loss-of-function mutation in the Lepr gene (18Phillips M.S. Liu Q. Hammond H.A. Dugan V. Hey P.J. Caskey C.J. Hess J.F. Nat. Genet. 1996; 13: 18-19Crossref PubMed Scopus (759) Google Scholar). Both fat transplants were readily visible and palpable throughout the first 10 post-operative days. If the fat-depleting effects of hyperleptinemia on adipocytes require normal Leprs on white adipocytes, fat will disappear from the three fat pads with functioning Leprs, i.e. from both native +/+ fat pads of the recipients and from the +/+ transplant but not from the fa/fa transplant. Alternatively, if these effects are mediated by neurotransmitted signals from leptin-responsive hypothalamic centers, only the two intact fat pads will lose their fat. At 10 days after the surgery, the recipients received an intravenous injection of recombinant adenovirus containing either the leptin cDNA (AdCMV-leptin) or the β-galactosidase cDNA (AdCMV-β-gal). The diet of the latter control rats was matched to that of the AdCMV-leptin-treated group. Plasma leptin levels rose in the AdCMV-leptin-treated group from 1.0 ± 0.2 to 81 ± 35 ng/ml during the 1st week, food intake declined by 43%, and body weight of the +/+ recipients fell within 14 days from 267 ± 33 before AdCMV-leptin treatment to 223 ± 27 g 10 days after treatment. On external inspection and palpation, transplants from +/+ donors shrank progressively in parallel with loss of body weight, whereas those from the fa/fa donors did not change (Fig. 1A). By contrast, in AdCMV-β-gal-treated control recipients that had been diet-matched to the hyperleptinemic rats, plasma leptin did not rise and no change in the size of either +/+ or fa/fa transplants or in the native intact fat pads (Fig. 1B) was observed (Fig. 1D). On dissection of the AdCMV-leptin-treated +/+ recipients, fat tissue could not be identified in either the +/+ transplant, the native fat pads, or anywhere else in the body other than in the fa/fa transplant (Fig. 1C). The native epididymal fat pads appeared as slender strands of vascular tissue devoid of visible fat, whereas the ∼300 mg +/+ fat transplant was reduced to a flat hypervascular red patch resembling the remnant of fat-depleted native fat pads (Fig. 1C). Only 67 ± 13 mg or 22% of the original weight of +/+ transplants could be recovered from their transplantion sites (Table 1, part A). By contrast, in the normoleptinemic AdCMV-β-gal-treated control rats pair-fed to the leptinized rats, 273 ± 16 mg or 91% of the +/+ transplants was recovered (Table 1, part A). The TG/protein ratio of the various transplants corresponded to the change in the weight of the transplant (Table 1, part A). Thus, hyperleptinemic fat depletion in the denervated +/+ fat pad transplants with normal Lepr seemed to parallel that in the intact +/+ native fat pads with normal Lepr and intact neurocircuitry (Fig. 1C).TABLE 1Effects of hyperleptinemia on epididymal fat transplantsTransplantRecipientsPlasma leptinBody weight change+/+ donorsfa/fa donorsWeightTg/proteinWeightTg/proteinng/mlgmgmgA. ZDF+/+AdCMV-leptin81 ± 35↓ 44 ± 1167 ± 13ap < 0.01 versus ZDFfa/fa and AdCMV-leptin.,bp < 0.01 versus ZDFfa/fa and AdCMV-β-gal.20 ± 4ap < 0.01 versus ZDFfa/fa and AdCMV-leptin.,bp < 0.01 versus ZDFfa/fa and AdCMV-β-gal.224 ± 24404 ± 178(↓ 78%)(↓ 25%)(n = 15)(n = 6)(n = 15)(n = 6)AdCMV-β-gal1.1 ± 0.2↑ 5 ± 5273 ± 16438 ± 384253 ± 33329 ± 57(↓ 9%)(↓ 16%)(n = 8)(n = 6)(n = 8)(n = 6)B. ZDFfa/faAdCMV-leptin122 ± 12↑ 88 ± 2570 ± 56cp < 0.01 versus ZDFfa/fa.585 ± 169283 ± 38329 ± 57(↑ 190%)(↓ 6%)(n = 3)(n = 3)(n = 3)(n = 3)AdCMV-β-gal24 ± 6↑ 115 ± 12725 ± 104cp < 0.01 versus ZDFfa/fa.577 ± 155290 ± 48319 ± 117(↑ 242%)(↓ 3%)(n = 4)(n = 4)(n = 4)(n = 4)a p < 0.01 versus ZDFfa/fa and AdCMV-leptin.b p < 0.01 versus ZDFfa/fa and AdCMV-β-gal.c p < 0.01 versus ZDFfa/fa. Open table in a new tab By contrast, the Lepr-defective fa/fa fat pads transplanted into +/+ recipients did not respond to hyperleptinemia. The rounded, elevated mass that was visible and palpable through the abdominal wall immediately postoperatively was still present (Fig. 1C). When excised, the weight of fa/fa transplants averaged 224 ± 24 mg or 75% of the original weight. Again the TG content of the transplants corresponded to their weight (Table 1, part A). These results indicate that depletion of TG in adipocytes requires the presence of functioning Lepr in the fat tissue. To exclude the possibility that the unresponsiveness of the adipocytes from obese, age-matched fa/fa rats to hyperleptinemia was the nonspecific result of their much larger size, we transplanted into +/+ recipients fat pads from pre-obese 4-weekold fa/fa donor rats in which adipocyte diameters approximated those of 6-week-old lean rats. These fat pads also failed to respond to hyperleptinemia, evidence that receptor dysfunction, rather than adipocyte size, was the cause of the unresponsiveness (data not shown). Comparison of Morphologic Transformation of Adipocytes to Post-adipocytes by Hyperleptinemia in Transplanted +/+ and fa/fa Fat Pads—Microscopic examination of the native and transplanted fat pads in +/+ recipient rats made hyperleptinemic by AdCMV-leptin treatment 14 days earlier confirmed the impression gained by gross examination. Phase contrast views of semithin sections of the intact native +/+ fat pads (Fig. 2A) and fat pads transplanted from lean ZDF+/+ donors (Fig. 2B) revealed in both the same fatless, shrunken post-adipocytes in the intact native fat pads of hyperleptinemic +/+ rats described in detail previously (2Orci L. Cook W.S. Ravazzola M. Wang M.Y. Park B.H. Montesano R. Unger R.H. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 2058-2063Crossref PubMed Scopus (207) Google Scholar). At the ultrastructural level both native (Fig. 2C) and transplanted cells (Fig. 2D) contained the same apparent abundance of distinctive mitochondria with an electron-dense matrix (Fig. 2D, inset). By contrast, phase contrast views of semithin sections of fa/fa fat transplants in hyperleptinemic +/+ recipients contained normal-appearing white adipocytes with a typical lipid droplet (Fig. 2E), as did +/+ fat pads transplanted into normoleptinemic +/+ control recipients that had been treated with AdCMV-β-gal instead of AdCMV-leptin, and diet-matched to the leptinized rats (Fig. 2F). In addition, the molecular changes observed in the +/+ transplants and in the native +/+ fat pads of hyperleptinemic rats (Fig. 3) were not present in these normoleptinemic controls (data not shown). The foregoing findings demonstrate that the action of hyperleptinemia on the fat metabolism of white adipocytes in lean rats requires the presence of wild-type (+/+) Lepr on adipocytes but does not require neural connections to the hypothalamus.FIGURE 3The effect of hyperleptinemia on the mRNA of relevant genes in native +/+ fat pads of +/+ recipients and in fat transplants from +/+ and fa/fa donors. Hyperleptinemia was induced by AdCMV-leptin administration (▪). AdCMV-β-gal was administered to control animals (□), which were then diet-matched to the hyperleptinemic group. mRNA levels are normalized for 18 S mRNA. ACC, acetyl-CoA carboxylase; SCD-1, stearoyl desaturase-1; PGC-1α, peroxisome proliferator-activated receptor-γ-coactivator 1α. *, p < 0.05; **, p < 0.01; n = 4 or 5).View Large Image Figure ViewerDownload Hi-res image Download (PPT) Molecular Responses to Hyperleptinemia in Intact Versus Transplanted Fat—We reported previously that the transformation of white adipocytes induced by hyperleptinemia was accompanied by an equally striking array of molecular changes (2Orci L. Cook W.S. Ravazzola M. Wang M.Y. Park B.H. Montesano R. Unger R.H. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 2058-2063Crossref PubMed Scopus (207) Google Scholar). For example, pgc-1α, a gene that regulates mitochondrial biosynthesis in brown adipocytes (19Wu Z. Puigserver P. Andersson U. Zhang C. Adelmant G. Mootha V. Troy A. Cinti S. Lowell B. Scarpulla R.C. Cell. 1999; 98: 115-124Abstract Full Text Full Text PDF PubMed Scopus (3192) Google Scholar), but is not normally expressed in white adipocytes, is greatly up-regulated by hyperleptinemia, whereas the normally high expression level of lipogenic enzymes, such as acetyl-CoA carboxylase-2 (ACC2), fatty-acid synthase (FAS), and stearoyl-CoA desaturase-1 (SCD-1), is profoundly suppressed in adipose tissue after hyperleptinemia (2Orci L. Cook W.S. Ravazzola M. Wang M.Y. Park B.H. Montesano R. Unger R.H. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 2058-2063Crossref PubMed Scopus (207) Google Scholar). To determine whether the hyperleptinemia-induced expression profile in the fat pads transplanted from normal rats matched that of intact fat pads, we compared the mRNA of ACC2 FAS, SCD-1, and PGC-1α by means of real time RT-PCR (Fig. 3). PGC-1α was increased, and ACC2, FAS, and SCD-1 were reduced in both the intact native fat pads and in the wild-type fat transplants from hyperleptinemic wild-type rats but not in fa/fa fat pads from Lepr-defective obese ZDFfa/fa rats. However, the magnitude of the PGC-1α response in the +/+ transplant fat was less than in the native +/+ fat pad, possibly reflecting the loss of normal innervation and circulation. Phospho-CREB and Phospho-STAT3 Are Both Increased in Fat Tissue during Fat Depletion by Hyperleptinemia—Lepr-mediated leptin signaling is transduced by STAT3 (20Ghilardi N. Ziegler S. Wiestner A. Stoffel R. Heim M.H. Skoda R.C. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6231-6235Crossref PubMed Scopus (734) Google Scholar), whereas catecholamine signaling is transduced by CREB (21Brindle P.K. Montminy M.R. Curr. Opin. Genet. Dev. 1992; 2: 199-204Crossref PubMed Scopus (259) Google Scholar). To determine at the tissue level if both direct leptin-mediated and indirect catecholamine-mediated actions on adipocytes could be involved in hyperleptinemic fat depletion, we compared the activation of the respective transcription factors during fat depletion of intact native adipose tissue of normal mice and rats. We observed a major increase in P-STAT3 to a peak at 3 days after induction of hyperleptinemia, followed by a decline at 7 days (Fig. 4, A and B), consistent with direct leptin action. P-CREB remained at base-line levels at 3 days but was markedly increased at day 7 (Fig. 4, A and B), consistent with indirect leptin action via hypothalamic sympathetic centers. At day 7 no adipocyte fat was detected microscopically in the fat pads (Fig. 4C). STAT3 and CREB activation was also observed in fat transplants from normal rats with hyperleptinemia (Fig. 4A, center panels) but not in fa/fa rats (Fig. 4A, right panels). However, the increases in P-STAT3 and P-CREB/CREB ratio were less than in the intact fat pads, perhaps reflecting the surgical disruption of the normal circulation. This combination of up-regulation of the adipose tissue oxidative machinery, in concert with adrenergic enhancement of lipolysis, could explain how fat stores are depleted by hyperleptinemia without the increase in plasma free fatty acid levels that characterizes other forms of fat depletion (11Fruhbeck G. Aguado M. Martinez J.A. Biochem. Biophys. Res. Commun. 1997; 240: 590-594Crossref PubMed Scopus (226) Google Scholar, 13Kieffer T.J. Heller R.S. Habener J.F. Biochem. Biophys. Res. Commun. 1996; 224: 522-527Crossref PubMed Scopus (315) Google Scholar). Fat Pads from +/+ Donors Do Not Respond to Hyperleptinemia When Transplanted into Obese fa/fa Recipients—The foregoing results indicate that direct Lepr-mediated action of leptin on adipose tissue is necessary for fat depletion, but they do not indicate whether or not direct action is sufficient for the effect. To determine whether leptin action on the regulatory centers of the hypothalamus might also be required, we repeated the foregoing transplantation experiments using leptin-unresponsive, obese ZDFfa/fa rats as recipients. When +/+ fat pads were transplanted into fa/fa recipient rats, equivalent hyperleptinemia had no fat-depleting action; in fact, they accumulated more TG than the fa/fa transplants (Table 1, part B, and Fig. 5A). Their unresponsiveness could signify either lack of a required cohormone normally stimulated by leptin (22Commins S.P. Marsh D.J. Thomas S.A. Watson P.M. Padgett M.A. Palmiter R. Gettys T.W. Endocrinology. 1999; 140: 4772-4778Crossref PubMed Google Scholar, 23Levin B.E. Triscari J. Sullivan A.C. Brain Res. 1981; 224: 353-366Crossref PubMed Scopus (29) Google Scholar, 24Haynes W.G. Morgan D.A. Walsh S.A. Mark A.L. Sivitz W.I. J. Clin. Investig. 1997; 100: 270-278Crossref PubMed Scopus (884) Google Scholar, 25Satoh N. Ogawa Y. Katsuura G. Numata Y. Tsuji T. Hayase M. Ebihara K. Masuzaki H. Hosoda K. Yoshimasa Y. Diabetes. 1999; 48: 1787-1793Crossref PubMed Scopus (196) Google Scholar) via hypothalamic sympathetic centers, such as catecholamines, and/or a blockade of the direct action of leptin on the +/+ fat pad transplant by a circulating factor present in the plasma of the fa/fa recipients. The greater accumulation of fat in +/+ fat pads could reflect the fact that normal adipocytes are able to undergo hypertrophy when transplanted into a hyperlipidemic environment, whereas the obese adipocytes from hyperlipidemic fa/fa donors had already undergone maximum hypertrophy before transplantation. We next examined the P-STAT3 and P-CREB in the unresponsive +/+ fat pads transplanted into the fa/fa recipients, treated with AdCMV-leptin. As expected, neither STAT3 nor CREB in native intact fat pads or in fa/fa transplants were activated by hyperleptinemia (Fig. 5B). The lack of an increase in P-STAT3 in the +/+ fat transplants was unexpected and could signify a circulating blocker of direct leptin action on adipocytes in the plasma of the fa/fa recipients. The lack of an increase in P-CREB was expected and is attributed to leptin unresponsiveness of hypothalamic sympathetic nuclei in fa/fa recipients. Catecholamines as Cohormones for Hyperleptinemic Fat Depletion—The hyperleptinemia-induced increase in P-CREB in +/+ fat tissue suggested that catecholamines could play a cohormonal role in the fat depletion observed in normal rats by stimulating lipolysis to provide substrate for the leptin-up-regulated oxidative machinery of the white adipocytes (2Orci L. Cook W.S. Ravazzola M. Wang M.Y. Park B.H. Montesano R. Unger R.H. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 2058-2063Crossref PubMed Scopus (207) Google Scholar). If so, leptin-stimulated catecholamine levels in plasma of lean +/+ rats should be higher than in leptin-unresponsive obese fa/fa rats. In fact, we observed that hyperleptinemia stimulated an increase in plasma levels of both norepinephrine and epinephrine in +/+ rats but not in fa/fa rats (Table 2), confirming earlier work by others (22Commins S.P. Marsh D.J. Thomas S.A. Watson P.M. Padgett M.A. Palmiter R. Gettys T.W. Endocrinology. 1999; 140: 4772-4778Crossref PubMed Google Scholar, 23Levin B.E. Triscari J. Sullivan A.C. Brain Res. 1981; 224: 353-366Crossref PubMed Scopus (29) Google Scholar, 24Haynes W.G. Morgan D.A. Walsh S.A. Mark A.L. Sivitz W.I. J. Clin. Investig. 1997; 100: 270-278Crossref PubMed Scopus (884) Google Scholar, 25Satoh N. Ogawa Y. Katsuura G. Numata Y. Tsuji T. Hayase M. Ebihara K. Masuzaki H. Hosoda K. Yoshimasa Y. Diabetes. 1999; 48: 1787-1793Crossref PubMed Scopus (196) Google Scholar). Nevertheless, basal norepinephrine levels in the fa/fa rats were higher than leptin-stimulated levels in the +/+ rats. It is not clear why this was not accompanied by a higher basal level of P-CREB.TABLE 2Effect of adenovirus-induced (AdCMV-leptin) hyperleptinemia on plasma epinephrine and norepinephrine levels (ng/ml) in+/+ and fa/fa ZDF rats (n=4)AdCMV-βgalAdCMV-leptinp value+/+Epinephrine10 ± 4.621.2 ± 7.90.05+/+Norepinephrine13.3 ± 2.125.4 ± 9.60.05fa/faEpinephrine6.8 ± 4.65.5 ± 1.40.61fa/faNorepinephrine31.2 ± 11.426.7 ± 6.50.52 Open table in a new tab Circulating Blockers of Hyperleptinemia—T" @default.
• W2078679462 created "2016-06-24" @default.
• W2078679462 creator A5009796876 @default.
• W2078679462 creator A5034171652 @default.
• W2078679462 creator A5043358893 @default.
• W2078679462 creator A5046538435 @default.
• W2078679462 creator A5047843177 @default.
• W2078679462 creator A5065735316 @default.
• W2078679462 creator A5073391022 @default.
• W2078679462 date "2006-12-01" @default.
• W2078679462 modified "2023-10-14" @default.
• W2078679462 title "Combined Leptin Actions on Adipose Tissue and Hypothalamus Are Required to Deplete Adipocyte Fat in Lean Rats" @default.
• W2078679462 cites W1967078210 @default.
• W2078679462 cites W1971082641 @default.
• W2078679462 cites W1972139227 @default.
• W2078679462 cites W1987519198 @default.
• W2078679462 cites W2001300907 @default.
• W2078679462 cites W2011437165 @default.
• W2078679462 cites W2012067617 @default.
• W2078679462 cites W2013389272 @default.
• W2078679462 cites W2020971663 @default.
• W2078679462 cites W2021895570 @default.
• W2078679462 cites W2041504277 @default.
• W2078679462 cites W2041872947 @default.
• W2078679462 cites W2044153433 @default.
• W2078679462 cites W2051553082 @default.
• W2078679462 cites W2053965920 @default.
• W2078679462 cites W2061340727 @default.
• W2078679462 cites W2065171552 @default.
• W2078679462 cites W2075019242 @default.
• W2078679462 cites W2075353539 @default.
• W2078679462 cites W2077453058 @default.
• W2078679462 cites W2080649034 @default.
• W2078679462 cites W2091087465 @default.
• W2078679462 cites W2094481749 @default.
• W2078679462 cites W2100404884 @default.
• W2078679462 cites W2104657159 @default.
• W2078679462 cites W2109311297 @default.
• W2078679462 cites W2109742508 @default.
• W2078679462 cites W2111232488 @default.
• W2078679462 cites W2111732109 @default.
• W2078679462 cites W2114343773 @default.
• W2078679462 cites W2116843182 @default.
• W2078679462 cites W2144219438 @default.
• W2078679462 cites W2148844770 @default.
• W2078679462 cites W2154935464 @default.
• W2078679462 cites W2170404804 @default.
• W2078679462 cites W2320642210 @default.
• W2078679462 doi "https://doi.org/10.1074/jbc.m607545200" @default.
• W2078679462 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17038325" @default.
• W2078679462 hasPublicationYear "2006" @default.
• W2078679462 type Work @default.
• W2078679462 sameAs 2078679462 @default.
• W2078679462 citedByCount "25" @default.
• W2078679462 countsByYear W20786794622012 @default.
• W2078679462 countsByYear W20786794622013 @default.
• W2078679462 countsByYear W20786794622015 @default.
• W2078679462 crossrefType "journal-article" @default.
• W2078679462 hasAuthorship W2078679462A5009796876 @default.
• W2078679462 hasAuthorship W2078679462A5034171652 @default.
• W2078679462 hasAuthorship W2078679462A5043358893 @default.
• W2078679462 hasAuthorship W2078679462A5046538435 @default.
• W2078679462 hasAuthorship W2078679462A5047843177 @default.
• W2078679462 hasAuthorship W2078679462A5065735316 @default.
• W2078679462 hasAuthorship W2078679462A5073391022 @default.
• W2078679462 hasBestOaLocation W20786794621 @default.
• W2078679462 hasConcept C126322002 @default.
• W2078679462 hasConcept C134018914 @default.
• W2078679462 hasConcept C171089720 @default.
• W2078679462 hasConcept C185592680 @default.
• W2078679462 hasConcept C2776175234 @default.
• W2078679462 hasConcept C2777003273 @default.
• W2078679462 hasConcept C2780613262 @default.
• W2078679462 hasConcept C511355011 @default.
• W2078679462 hasConcept C71924100 @default.
• W2078679462 hasConcept C86803240 @default.
• W2078679462 hasConceptScore W2078679462C126322002 @default.
• W2078679462 hasConceptScore W2078679462C134018914 @default.
• W2078679462 hasConceptScore W2078679462C171089720 @default.
• W2078679462 hasConceptScore W2078679462C185592680 @default.
• W2078679462 hasConceptScore W2078679462C2776175234 @default.
• W2078679462 hasConceptScore W2078679462C2777003273 @default.
• W2078679462 hasConceptScore W2078679462C2780613262 @default.
• W2078679462 hasConceptScore W2078679462C511355011 @default.
• W2078679462 hasConceptScore W2078679462C71924100 @default.
• W2078679462 hasConceptScore W2078679462C86803240 @default.
• W2078679462 hasIssue "52" @default.
• W2078679462 hasLocation W20786794621 @default.
• W2078679462 hasOpenAccess W2078679462 @default.
• W2078679462 hasPrimaryLocation W20786794621 @default.
• W2078679462 hasRelatedWork W1976946227 @default.
• W2078679462 hasRelatedWork W2022716990 @default.
• W2078679462 hasRelatedWork W2027357022 @default.
• W2078679462 hasRelatedWork W2074115578 @default.
• W2078679462 hasRelatedWork W2074825053 @default.
• W2078679462 hasRelatedWork W2099969362 @default.
• W2078679462 hasRelatedWork W2106570883 @default.
• W2078679462 hasRelatedWork W2114343773 @default.

• next