FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2078941335> ?p ?o ?g. }

• W2078941335 endingPage "20205" @default.
• W2078941335 startingPage "20197" @default.
• W2078941335 abstract "Affinity-purified polyclonal antibodies recognizing the most highly acetylated forms of histones H3 and H4 were used in immunoprecipitation assays with chromatin fragments derived from 15-day chicken embryo erythrocytes by micrococcal nuclease digestion. The distribution of hyperacetylated H4 and H3 was mapped at the housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and the tissue-specific gene, carbonic anhydrase (CA). H3 and H4 acetylation was found targeted to the CpG island region at the 5′ end of both these genes, falling off in the downstream direction. In contrast, at the βA-globin gene, both H3 and H4 are highly acetylated throughout the gene and at the downstream enhancer, with a maximum at the promoter. Low level acetylation was observed at the 5′ end of the inactive ovalbumin gene. Run-on assays to measure ongoing transcription showed that theGAPDH and CA genes are transcribed at a much lower rate than the adult βA-globin gene. The extensive high level acetylation at the βA-globin gene correlates most simply with its high rate of transcription. The targeted acetylation of histones H3 and H4 at the GAPDH andCA genes is consistent with a role in transcriptional initiation and implies that transcriptional elongation does not necessarily require hyperacetylation. Affinity-purified polyclonal antibodies recognizing the most highly acetylated forms of histones H3 and H4 were used in immunoprecipitation assays with chromatin fragments derived from 15-day chicken embryo erythrocytes by micrococcal nuclease digestion. The distribution of hyperacetylated H4 and H3 was mapped at the housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and the tissue-specific gene, carbonic anhydrase (CA). H3 and H4 acetylation was found targeted to the CpG island region at the 5′ end of both these genes, falling off in the downstream direction. In contrast, at the βA-globin gene, both H3 and H4 are highly acetylated throughout the gene and at the downstream enhancer, with a maximum at the promoter. Low level acetylation was observed at the 5′ end of the inactive ovalbumin gene. Run-on assays to measure ongoing transcription showed that theGAPDH and CA genes are transcribed at a much lower rate than the adult βA-globin gene. The extensive high level acetylation at the βA-globin gene correlates most simply with its high rate of transcription. The targeted acetylation of histones H3 and H4 at the GAPDH andCA genes is consistent with a role in transcriptional initiation and implies that transcriptional elongation does not necessarily require hyperacetylation. kilobase pair(s) base pair(s) locus control region histone acetyltransferase glyceraldehyde 3-phosphate dehydrogenase gene carbonic anhydrase gene acetic acid/urea/Triton immunoprecipitation chromatin immunoprecipitation reverse transcriptase-polymerase chain reaction phosphate-buffered saline The association of core histone acetylation, particularly of H3 and H4, with transcriptionally active genes is by now a familiar story (1Allfrey V.G. Faulkner R. Mirsky A.E. Proc. Natl. Acad. Sci. U. S. A. 1964; 51: 786-794Crossref PubMed Scopus (1728) Google Scholar, 2Hebbes T.R. Thorne A.W. Crane-Robinson C. EMBO J. 1988; 7: 1395-1402Crossref PubMed Scopus (705) Google Scholar, 3Jeppeson P. Turner B.M. Cell. 1993; 74: 281-289Abstract Full Text PDF PubMed Scopus (597) Google Scholar, 4Grunstein M. Nature. 1997; 389: 349-352Crossref PubMed Scopus (2381) Google Scholar, 5Struhl K. Genes Dev. 1998; 12: 599-606Crossref PubMed Scopus (1541) Google Scholar, 6Workman J.L. Kingston R.E. Annu. Rev. Biochem. 1980; 67: 545-579Crossref Scopus (965) Google Scholar, 7Imhof A. Wolffe A.P. Curr. Biol. 1998; 8: R422-4Abstract Full Text Full Text PDF PubMed Google Scholar, 8Kuo M.-H. Allis C.D. Bioessays. 1998; 8: 615-626Crossref Scopus (1061) Google Scholar, 9Strahl B.D. Allis C.D. Nature. 2000; 403: 41-45Crossref PubMed Scopus (6533) Google Scholar). However, apparent inconsistencies have arisen between promoter/enhancer-specific acetylation and more widespread acetylation. Mapping the modification at the chicken β-globin locus in 15-day erythrocytes showed 33 kb1 of acetylated chromatin, having boundaries coincident with the limits of open chromatin (10Hebbes T.R. Clayton A.L. Thorne A.W. Crane-Robinson C. EMBO J. 1994; 13: 1823-1830Crossref PubMed Scopus (481) Google Scholar). Furthermore, the inactive embryonic ε−globin was hyperacetylated as well as the active adult βA-globin gene (11Hebbes T.R. Thorne A.W. Clayton A.L. Crane-Robinson C. Nucleic Acids Res. 1992; 20: 1017-1022Crossref PubMed Scopus (100) Google Scholar). This implied that core histone acetylation was a precondition for transcription, a view supported by the observation that acetylation at the inducible PDGFβ gene was not enhanced upon induction (12Clayton A.L. Hebbes T.R. Thorne A.W. Crane-Robinson C. FEBS Lett. 1993; 336: 23-26Crossref PubMed Scopus (43) Google Scholar) and the modification might therefore be related to the formation or maintenance of accessible chromatin. In a study analyzing the basis of aberrant transcription of c-myc genes linked to an enhancer-LCR from the 3′ end of the human immunoglobulin heavy chain (IgH) locus (modeling a well known translocation in Burkitt's lymphoma), widespread hyperacetylation was observed both upstream and downstream of the transcriptional start site, with little concentration in the region of the c-myc promoter (13Madisen L. Krumm A. Hebbes T.R. Groudine M. Mol. Cell. Biol. 1998; 18: 6281-6292Crossref PubMed Scopus (75) Google Scholar). More recently, analysis of H3 and H4 acetylation at the human β-globin locus in MEL cells containing a complete human chromosome 11, has also shown locus-wide acetylation, particularly of H4. Hyperacetylation of H3 was also widespread but more concentrated at Dnase I-hypersensitive sites and at the active β-gene (14Schubeler D. Francastel C. Cimbora D.M. Reik A. Martin D.I.K. Groudine M. Genes Dev. 2000; 14: 940-950PubMed Google Scholar). The possibility of direct linkage between core histone acetylation and the passage of RNA polymerase II, thereby generating widespread modification, was raised by the observation that the elongator complex contains a subunit having HAT activity (15Wittschieben B.O. Otero G. de Bizemont T. Fellows J. Erdjument- Bromage H. Ohba R. Li Y. Allis C.D. Tempst P. Svejstrup J.Q. Mol. Cell. 1999; 4: 123-128Abstract Full Text Full Text PDF PubMed Scopus (390) Google Scholar). Tracking-mediated chromatin modification has recently been discussed (16Travers A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 13634-13637Crossref PubMed Scopus (81) Google Scholar). Such widespread acetylation contrasts with the “directed” or “targeted” acetylation implied by observations that gene activation is often accompanied by the recruitment to promoters/enhancers of protein complexes that include subunits having histone acetyltransferase (HAT) activity (17Brownell J.E. Zhou J. Ranalli T. Kobayashi R. Edmondson D.G. Roth S.Y. Allis C.D. Cell. 1996; 84: 843-851Abstract Full Text Full Text PDF PubMed Scopus (1281) Google Scholar, 18Yang X.J. Orgyzko V.V. Nashikama J.L. Howard B. Nakatani Y. Nature. 1996; 382: 319-324Crossref PubMed Scopus (1311) Google Scholar, 19Orgyzko V.V. Schiltz R.L. Russanova V. Howard B. Nakatani Y. Cell. 1996; 87: 953-959Abstract Full Text Full Text PDF PubMed Scopus (2377) Google Scholar, 20Mizzen C.A. Yang X.J. Kobuko T. Brownell J.E. Bannister A.J. Owen-Hughes T. Workman J. Berger S.L. Kouzarides T. Nakatani Y. Allis C.D. Cell. 1996; 87: 1261-1270Abstract Full Text Full Text PDF PubMed Scopus (617) Google Scholar, 21Bannister A.J. Kouzarides T. Nature. 1996; 384: 641-643Crossref PubMed Scopus (1526) Google Scholar); gene repression frequently results in the recruitment to promoters/enhancers of protein complexes containing components with histone deacetylase activity (22Taunton J. Hassig C.A. Schreiber S.L. Science. 1996; 272: 408-411Crossref PubMed Scopus (1527) Google Scholar, 23Heinzel T. Lavinsky R.M. Mullen T.-M. Söderström M. Laherty C.D. Torchia J. Yang W.-M. Brard G. Ngo S.D. Davie J.R. Seto E. Eisenman R.N. Rose D.W. Glass C.K. Rosenfeld M.G. Nature. 1997; 387: 43-48Crossref PubMed Scopus (1080) Google Scholar, 24Alland L. Muhle R. Hou Jr H. Potes J. Chin L. Schreiber-Agus N. DePinho R.A. Nature. 1997; 387: 49-55Crossref PubMed Scopus (733) Google Scholar, 25Hassig C.A. Fleischer T.C. Billin A.N. Schreiber S.L. Ayer D.E. Cell. 1997; 89: 341-347Abstract Full Text Full Text PDF PubMed Scopus (656) Google Scholar, 26Laherty C.D. Yang W.M. Sun J.M. Davie J.R. Seto E. Eisenman R.N. Cell. 1997; 89: 349-356Abstract Full Text Full Text PDF PubMed Scopus (839) Google Scholar, 27Zhang Y. Iratnl R. Erdjument-Bromage H. Tempst P Reinberg D. Cell. 1997; 89: 357-364Abstract Full Text Full Text PDF PubMed Scopus (499) Google Scholar, 28Kadosh D. Struhl K. Cell. 1997; 89: 365-371Abstract Full Text Full Text PDF PubMed Scopus (457) Google Scholar, 29Nagy L. Kao H.Y. Chakravati D. Lin R.J. Hassig C.A. Ayer D.E. Schreiber S.L. Evans R.M. Cell. 1997; 89: 373-380Abstract Full Text Full Text PDF PubMed Scopus (1102) Google Scholar). Several papers provide experimental support for targeted acetylation. Using a serum response factor-controlled reporter gene construct in mouse NIH3T3 cells, it was shown that extracellular stimulation of gene activation induced rapid acetylation of H4, but not H3, in the region of the serum response element (30Alberts A.S. Geneste O. Treisman R. Cell. 1998; 92: 475-487Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar). InSaccharomyces cerevisiae, promoter-specific hyperacetylation of histone H3 was observed in GCN5-mediated transcription (31Kuo M.-H. Zhou J. Jambeck P. Churchill M.E.A. Allis C.D. Genes Dev. 1998; 12: 627-639Crossref PubMed Scopus (398) Google Scholar), whereas promoter-specific hypoacetylation of histone H4 was found for Sin3/Rpd3-mediated repression (32Kadosh D. Struhl K. Mol. Cell. Biol. 1998; 18: 5121-5127Crossref PubMed Scopus (267) Google Scholar). A concentration of H4 and H3 acetylation covering only about 3 nucleosomes in the region of the enhanceosome is induced by viral induction of the human interferon-β gene in HeLa cells (33Parekh B.S. Maniatis T. Mol. Cell. 1999; 3: 125-129Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar). Mapping of this induced acetylation showed it to extend only marginally into the (rather short) coding sequences. Hyperacetylation of histones H4 and H3 was also noted at the hormone response elements of several estrogen receptor target genes in human MCF-7 cells following induction with hormone (34Chen H. Lin R.J. Xie W. Wilpitz D. Evans R.M. Cell. 1999; 98: 675-686Abstract Full Text Full Text PDF PubMed Scopus (559) Google Scholar) and at the LCR of the human growth hormone locus (35Elefant F. Cooke N.E. Liebhaber S.A. J. Biol. Chem. 2000; 275: 13827-13834Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar). Acetylation of histone H4 at K16 by MOF, a Drosophila dosage compensation protein, has been shown to activate transcription when targeted to a his3reporter gene promoter in yeast (36Akhtar A. Becker P.B. Mol. Cell. 2000; 5: 367-375Abstract Full Text Full Text PDF PubMed Scopus (370) Google Scholar). In a recent in vitroassay using purified components, SAGA and NuA4 HAT complexes targeted by Gal4-VP16 produced a more restricted region of H3 acetylation than that of H4 (37Vignali M. Steger D.J. Neely K.E. Workman J.L. EMBO J. 2000; 19: 2629-2640Crossref PubMed Scopus (105) Google Scholar). Two mechanisms have been proposed for the consequences of acetylation in the tail regions of core histones. 1) The modification disrupts inter-nucleosomal interactions mediated by core histone tails, thereby opening up higher order structure and rendering the chromatin accessible to the transcriptional apparatus. This mechanism can be fitted logically to the widespread acetylation (often of H4) found, for example, at globin genes (10Hebbes T.R. Clayton A.L. Thorne A.W. Crane-Robinson C. EMBO J. 1994; 13: 1823-1830Crossref PubMed Scopus (481) Google Scholar, 14Schubeler D. Francastel C. Cimbora D.M. Reik A. Martin D.I.K. Groudine M. Genes Dev. 2000; 14: 940-950PubMed Google Scholar). It has recently been proposed that transcriptional elongation is required to form, and core histone acetylation to maintain, the open chromatin structure (38Walia H. Chen H.Y. Sun J.-M. Hoth L.T. Davie J.R. J. Biol. Chem. 1998; 273: 14516-14522Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). 2) The modification has also been shown to facilitate the access of transcription factors to their DNA recognition sequences in individual nucleosomes at promoters/enhancers/LCRs (39Lee D.Y. Hayes J.J. Pruss D. Wolffe A.P. Cell. 1993; 72: 73-84Abstract Full Text PDF PubMed Scopus (959) Google Scholar, 40Vettese-Dadey M. Grant P.A. Hebbes T.R. Crane-Robinson C. Allis C.D. Workman J.L. EMBO J. 1996; 15: 2508-2518Crossref PubMed Scopus (375) Google Scholar, 41Vitolo J.M. Thiriet C. Hayes J.J. Mol. Cell. Biol. 2000; 20: 2167-2175Crossref PubMed Scopus (57) Google Scholar). Although this mechanism can provide an explanation for the concentration of acetylation (often of H3) in promoter regions, HAT-containing complexes are generally assumed to be recruited by already bound primary transcription factors. Defining the order of binding events is thus crucial to understanding the role of promoter/enhancer/LCR-specific acetylation (42Ito T. Ikehara T. Nakagawa T. Kraus W.L. Muramatsu M. Genes Dev. 2000; 14: 1899-1907PubMed Google Scholar). To further explore the distinction between localized and locus-wide histone acetylation, we have mapped the acetylation of histones H3 and H4 at a housekeeping gene (GAPDH) and a tissue-specific gene (CA) in the same cells as used for acetylation mapping at the β-globin locus, i.e. 15-day chicken embryo erythrocytes. The mapping of acetylated histones at housekeeping genes was in part provoked by the observation of Tazi and Bird (43Tazi J. Bird A. Cell. 1990; 60: 909-920Abstract Full Text PDF PubMed Scopus (367) Google Scholar) that chromatin derived from CpG islands is highly enriched in hyperacetylated histone H4, indicating a concentration of the modification in such regions. At the β-globin locus, where the adult gene does not have a CpG island but the embryonic ρ-gene does, no correlation of acetylation with the presence or absence of a CpG island was observed (10Hebbes T.R. Clayton A.L. Thorne A.W. Crane-Robinson C. EMBO J. 1994; 13: 1823-1830Crossref PubMed Scopus (481) Google Scholar). However, all housekeeping genes and about one-half of tissue-specific genes have CpG islands; therefore, the enrichment seen by Tazi and Bird (43Tazi J. Bird A. Cell. 1990; 60: 909-920Abstract Full Text PDF PubMed Scopus (367) Google Scholar) could be predominantly from housekeeping genes. The present results show a concentration of H4 and H3 acetylation in the upstream CpG island regions of both theGAPDH and CA genes, in contrast to the βA-globin gene for which the modification extends throughout the gene and into the 3′ enhancer. Anti-hyperacetylated histone H4 serum was prepared by immunizing rabbits with chemically acetylated H4, and antibodies were affinity-purified over a column of immunogen, immobilized on agarose beads (2Hebbes T.R. Thorne A.W. Crane-Robinson C. EMBO J. 1988; 7: 1395-1402Crossref PubMed Scopus (705) Google Scholar, 10Hebbes T.R. Clayton A.L. Thorne A.W. Crane-Robinson C. EMBO J. 1994; 13: 1823-1830Crossref PubMed Scopus (481) Google Scholar, 44Hebbes T.R. Turner C.H. Thorne A.W. Crane-Robinson C. Mol. Immunol. 1989; 26: 865-873Crossref PubMed Scopus (30) Google Scholar, 45Crane-Robinson C. Hebbes T.R. Clayton A.L. Thorne A.W. Methods Comp. Methods Enzymol. 1997; 12: 48-56Crossref Scopus (28) Google Scholar). The anti-acetylated histone H3 peptide serum was obtained by immunizing rabbits with peptide 1–27 of H3, acetylated at residues 9, 14, 18, and 23, chemically synthesized as multiple antigenic peptides (MAPs). Antibodies were affinity-purified over a column of the same H3 peptide immobilized on controlled-pore glass beads (Alta Bioscience) using elution conditions as detailed in Ref. 44Hebbes T.R. Turner C.H. Thorne A.W. Crane-Robinson C. Mol. Immunol. 1989; 26: 865-873Crossref PubMed Scopus (30) Google Scholar. Acid-extracted histones from butyrate-treated HeLa cells were resolved by 15% AUT-polyacrylamide gel electrophoresis (50Bonner W.M. West M.H. Stedman J.D. Eur. J. Biochem. 1980; 109: 17-23Crossref PubMed Scopus (194) Google Scholar) and after equilibration in transfer buffer (15 mm glycine, 20 mm Tris, 0.1% SDS, and 20% methanol) were electrophoretically transferred to nitrocellulose using a Bio-Rad transblot apparatus (400 mA, 90 min at 4 °C). Membranes were blocked in 5% (w/v) Marvel in 1× PBS for 1 h, washed in 1× PBS, 0.1% (v/v) Tween 20, and incubated with 1:2000 diluted serum for 1 h. After further washing with 1× PBS, 0.1% Tween, chemiluminescent detection was performed using an ECL kit (Amersham Pharmacia Biotech). Salt-soluble chromatin from 15-day chicken embryo erythrocytes was prepared essentially as described in Ref. 2Hebbes T.R. Thorne A.W. Crane-Robinson C. EMBO J. 1988; 7: 1395-1402Crossref PubMed Scopus (705) Google Scholar. In brief, a 5-mg DNA/ml suspension of nuclei was digested with MNase at 37 °C for 10 min in digestion buffer (10 mm Tris-HCl, pH 7.4, 10 mm butyrate, 3 mm MgCl2, 1 mm phenylmethylsulfonyl fluoride, 1 mm benzamidine). Digestion was terminated by the addition of EDTA to a final concentration of 10 mm. Released chromatin was recovered from supernatant S1 after centrifugation (13000 × g, 1 min). The pellet was resuspended in lysis buffer (0.25 mm EDTA, 10 mm Tris-HCl, 10 mm sodium butyrate) to release further material. which was recovered in supernatant S2 after centrifugation. S1 and S2 were pooled, and H1/H5-containing chromatin was precipitated by the addition of NaCl to 100 mm. Following centrifugation, the supernatant was layered onto 5–30% exponential sucrose gradients in lysis buffer. Di- and tri-nucleosomal fractions were pooled and used as the input chromatin for the experiments because probing with βA-globin and housekeeping sequences showed them to be well represented in this chromatin size class. ChIP assays were performed as described in Ref. 10Hebbes T.R. Clayton A.L. Thorne A.W. Crane-Robinson C. EMBO J. 1994; 13: 1823-1830Crossref PubMed Scopus (481) Google Scholar. Typically, 400 μg of input chromatin (as DNA) was mixed with 100 μg of affinity-purified antibody in immunoprecipitation (IP) buffer (10 mm Tris-HCl, pH 7.5, 50 mm NaCl, 1 mm EDTA, 10 mm butyrate, 0.1 mm phenylmethylsulfonyl fluoride, 0.1 mmbenzamidine) and incubated for 2 h at 4 °C with constant agitation. Immunocomplexes were immobilized using 50 mg of protein A-Sepharose equilibrated in IP buffer, and the suspension was incubated for an additional hour at 4 °C. Unbound chromatin was recovered from the filtrate by centrifugation (6000 rpm, 30 s) through a 0.45-μm Spin-X filter (Sigma). After a repeat washing with IP buffer, the resin pellet was resuspended in 150 μl of IP buffer containing 1.5% SDS, incubated for 15 min at room temperature, and centrifuged to release antibody-bound chromatin in the filtrate. The resin pellet was resuspended in 150 μl of IP buffer containing 0.5% SDS and re-centrifuged, and the two “Bound” filtrates pooled. The histones and DNA from the input, unbound, and bound fractions were recovered as described in Ref. 10Hebbes T.R. Clayton A.L. Thorne A.W. Crane-Robinson C. EMBO J. 1994; 13: 1823-1830Crossref PubMed Scopus (481) Google Scholar. Input, unbound, and bound DNA samples were subjected to PCR amplification in the presence of 5 μCi of [32P]dCTP and the appropriate primers. Template concentrations and numbers of cycles were determined for each primer pair so that the products fell within the exponential phase of amplification. Typically, 26–28 cycles were used with templates serially diluted from 8.0 to 0.5 ng. Amplification conditions were: 2-min denaturation at 94 °C followed by n cycles of: denaturation (94 °C for 1 min), annealing (temperature and time optimized for each primer pair), and extension (72 °C for 1 min). Products were analyzed on 6% native acrylamide gels and quantitated using a PhosphorImager. The signal from the correctly sized product derived from the input (I) and bound (B) samples were plotted as a function of template concentration to check for linearity and the B/I value determined as the ratio of the slopes of the two plots in the linear region (data not shown). Comparing the bound signal to the input normalizes for variations in the input signal that arise from differing susceptibilities to MNase at different points in the genome (or within a single gene). B/I ratios >1 represent “fold enrichments” achieved by the immunoprecipitation.B/I values of <1 represent depletions in the bound DNA and are plotted as I/B, “fold depletions.” The following primer pairs were used: A1, GTATGGCGCACTCTGGTATAGA, and A2, GAGCGGCCGTCTGTGTC, 304-bp product; A3, ACCTTCTCCCAACTGTCC, and A4, ATTCCTTTCTCACTATGCT, 258-bp product; A5, AAGCCTAGGAATGTTTCC, and A6, TTAGTGGTACTTGCGAGC, 224-bp product; A7, ACAAAGTGAAGGCTTTAATC, and A8, TTTTAGTTCCAGAACATCATT, 254-bp product; Ga, GCTCTTTGTCCCGCCC, and Gb, CGGGGCGATGCGGCTG, 100-bp product; G1, TCTCGCGCAGGACCGCGTGG, and G2, GTGTTCCTGCGGGGAGAGACCG, 244-bp product; G3, ACCTTTGTGGTGTGGGTGCC, and G4, GCCAGAGAGGACGGCAGCCC, 246-bp product; Gc, GAGTCCACTGGTGTCTTCAC, and Gd, GAGATGATAACACGCTTAGC, 250-bp product; CA1, TCAGTGCGGACACAGAGGAGCATT, and CA2, AGTTGAATCACCACTCCCACGGCT, 273-bp product; CA3, TACGCCAGCCACAACGGTGA, and CA4, CTCAGGCCTGGCATCTCAAGGT, 145-bp product; CA5, ACTGCCTTCTCCAGACACTGC, and CA6, TTTCCAGCACCATTCCCTAAGT, 100-bp product; CA7, CTGGATGGAGTCTACAGG, CA8, GCAAAGCACATCATACCTCTGC, 118-bp product; CA9, CAGCGATGAGTGTGTTAGAA, and CA10, TGTCAGTCGCAGTAAGT, 249-bp product; OvA, TTGTTCTCACTTATGTCCTGCC, and OvB, TTCAGTTACAACCAGATAATGG, 201-bp product; Ov1, ACAGCACCAGGACACAGATAA, and Ov2, AAGTCTACTGGCAAGGCTGAA, 175-bp product; Ov3, AACTCATGGATGAAGGCTTAAGG, and Ov4, TTGTCAGCATAGGAATGGTTGG, 220-bp product. The run-on analysis was performed essentially as described in Refs. 51Rodaway A.R. Teahan C.G. Casimir C.M. Segal A.W. Bentley D.L. Mol. Cell. Biol. 1990; 10: 5388-5396Crossref PubMed Scopus (60) Google Scholar and 52Ashe H.L. Monks J. Wijgerde M. Fraser P. Proudfoot N. Genes Dev. 1997; 11: 2494-2509Crossref PubMed Scopus (300) Google Scholar. 15-day chicken embryo erythrocyte nuclei were prepared as follows. Blood was collected into 1× PBS, 10 mm sodium butyrate, 5 mm EDTA, 0.1 mm phenylmethylsulfonyl fluoride, and 0.1 mmbenzamidine and filtered through sterile gauze. Erythrocytes were pelleted at 2200 × g for 5 min at 4 °C and washed and pelleted in the same buffer an additional two times. The final pellet was resuspended in ice-cold RSB buffer (10 mmTris-HCl pH 7.4, 1.5 mm MgCl2 10 mmKCl, 0.5% Nonidet P-40) and incubated for 5 min on ice with vigorous agitation to lyse the cells. Nuclei were pelleted at 2000 ×g for 5 min at 4 °C and the supernatant removed by aspiration. Pellets were resuspended in glutamate run-on buffer (125 mm potassium glutamate, 10 mm HEPES, pH 8.0, 5 mm MgCl2, 2 mm dithiothreitol, 1 mm EGTA, 40% glycerol), snap-frozen in liquid nitrogen, and then stored at −80 °C. Nuclei for analysis (100 μg of DNA) were thawed quickly and placed on ice, and then 1.0 μl of 1m creatine phosphate in 10 mm HEPES, pH 8.0, 2.4 μl of 2 mg/ml creatine kinase, 1 μl of 100 mm ATP, 1 μl of AGC (25 mm of each of GTP, ATP, and CTP), 8 μl of [32P]UTP (160 μCi at 800 Ci/mmol) and 50 units of RNAsin (Promega) were added followed by incubation at 37 °C for 15 min. CaCl2 was added to a final concentration of 10 mm together with 50 units of RNase-free Dnase 1 followed by incubation at 37 °C for 20 min. 5 μl of 10× SET buffer (10% SDS, 100 mm Tris-HCl, pH 7.5, 50 mm EDTA) and 150 μl of 1× SET buffer were added along with 10 μl of 10 mg/ml proteinase K and incubated at 37 °C for 45 min. RNA was extracted using phenol-chloroform and precipitated with isopropanol. The RNA pellet was resuspended in 90 μl of 1 mm EDTA, 0.5% SDS, and 15 μl of 2 m NaOH was added followed by incubation on ice for 10 min to partially fragment the RNA. Samples were neutralized by adding 0.48 m HEPES and heated to 100 °C for 5 min before applying to the filter. 5 μg of both sense and antisense single-stranded DNA was slot-blotted onto a Biodyne B membrane for each of the GAPDH, CA, ovalbumin, and βA-globin genes. The hybridization buffer was 50% deionized formamide, 6× SSPE buffer (saline/sodium phosphate/EDTA), 0.1% SDS, and 100 μg/ml tRNA. Prehybridization was for 2 h at 42 °C with hybridization overnight at 42 °C. Washing was for 10 min in 2× SSPE, 0.1% SDS at room temperature and 20 min in 0.2× SSPE, 0.1% SDS at 68 °C. Total RNA was extracted from 15-day chicken erythrocytes using an RNAqueous kit (Ambion) and DNase 1-treated (1 unit/μg, 30 min, 37 °C). First strand cDNA was prepared from 2-μg aliquots using random hexamer primers (Promega) and Superscript II enzyme (Life Technologies, Inc.) under the following conditions: 90 °C for 3 min, add 300 units of Superscript II, 37 °C for 60 min, 95 °C for 3 min. Products were amplified by PCR (94 °C for 2 min; followed by 94 °C for 1 min, 55 °C for 1 min, 72 °C for 2 min, for 28 cycles; finally, 72 °C for 7 min) with gene-specific primers that where designed to reveal the presence of contaminating genomic DNA in the RNA preparations. The two immunogens used to raise the antibodies utilized in the ChIP assays were chemically acetylated histone H4, in which essentially all of the lysine residues of H4 become modified (2Hebbes T.R. Thorne A.W. Crane-Robinson C. EMBO J. 1988; 7: 1395-1402Crossref PubMed Scopus (705) Google Scholar, 10Hebbes T.R. Clayton A.L. Thorne A.W. Crane-Robinson C. EMBO J. 1994; 13: 1823-1830Crossref PubMed Scopus (481) Google Scholar, 44Hebbes T.R. Turner C.H. Thorne A.W. Crane-Robinson C. Mol. Immunol. 1989; 26: 865-873Crossref PubMed Scopus (30) Google Scholar, 45Crane-Robinson C. Hebbes T.R. Clayton A.L. Thorne A.W. Methods Comp. Methods Enzymol. 1997; 12: 48-56Crossref Scopus (28) Google Scholar) and the peptide 1–27 of histone H3 acetylated at residues 9, 14, 18, and 23 chemically synthesized as multiple antigenic peptides (Alta Bioscience). Western blots were conducted to characterize the specificity of the sera, using histones extracted from butyrate-treated HeLa cells; in each case a Coomassie-stained marker lane of the these histones is shown for comparison. Fig. 1 shows the results for each serum using both SDS gels and acetic acid/urea (AU) or acetic acid/urea/Triton (AUT) gels. The SDS gels in Fig. 1, A andC, show that both sera are highly specific for the histone used as immunogen, although careful inspection shows that the specificities are not absolute. For example, the anti-acetylated H4 serum shows a weak recognition of H3 at the higher loading that amounts to about 10% of the activity against H4, whereas the anti-acetylated H3 peptide serum shows a very weak recognition of H4 and H2B histones. This weak cross-reactivity is almost certainly due to the presence of anti-acetyl lysine activity in the sera, as previously documented for sera derived from chemically acetylated H4 (44Hebbes T.R. Turner C.H. Thorne A.W. Crane-Robinson C. Mol. Immunol. 1989; 26: 865-873Crossref PubMed Scopus (30) Google Scholar). When the acetylated subspecies are spread out using AUT or AU gels the specificity is more precisely revealed. For histone H4, about half of the activity is directed at the tetra (fully)-acetylated species, with the remainder against Ac3 and Ac2, whereas for histone H3 the activity is about equally directed against the Ac4 and Ac3 species (although a low activity against Ac2 can also be detected). These antisera can most simply be described as being against hyperacetylated H4 and H3. Antibodies from both sera were then affinity-purified using columns carrying the immobilized immunogens, i.e. chemically acetylated histone H4 and the acetylated H3 peptide. All of the ChIP experiments described below were carried out using these affinity-purified antibodies. Nucleosomal fragments from 15-day chicken embryo erythrocyte nuclei were prepared by micrococcal nuclease digestion and fractionated on a sucrose gradient. The di- and tri-nucleosomal components were pooled and used as “input” chromatin for ChIP assays. In a typical assay, 400 μg of input chromatin (as DNA) was mixed with 100 μg of affinity-purified antibodies (see “Experimental Procedures”). Immunocomplexes were immobilized on protein A-Sepharose and washed to remove the “unbound” chromatin, and the “bound” chromatin was released by a SDS-containing buffer. Typically about 5–10 μg of DNA was recovered from the bound fraction, i.e. about 1.25–2.5% of the input. The content of acetylated histones in the two precipitated chromatin fractions was assessed by comparing the “input” (I) and “bound” (B) samples on stained AUT gels (Fig. 2). When the anti-acetylated H4 antibodies were used, as expected, the bound chromatin was indeed much enriched in multiply acetylated H4 species as compared with the input chromatin. Close inspection also showed some increase in multiply acetylated H3 species. In the experiment using the anti-acetylated H3 antibodies, an enrichment in multiply acetylated H3 species could be seen, as expected, but in addition there was a considerable rise in the acetylation level of the histone H4 present. The tight histone specificity of the anti-acetylated H3 peptide antibodies (Fig. 1) means that the co-isolation of other multiply acetylated histone species must" @default.
• W2078941335 created "2016-06-24" @default.
• W2078941335 creator A5009185796 @default.
• W2078941335 creator A5019581385 @default.
• W2078941335 creator A5072082972 @default.
• W2078941335 creator A5077754192 @default.
• W2078941335 creator A5081383291 @default.
• W2078941335 date "2001-01-01" @default.
• W2078941335 modified "2023-10-11" @default.
• W2078941335 title "Targeted and Extended Acetylation of Histones H4 and H3 at Active and Inactive Genes in Chicken Embryo Erythrocytes" @default.
• W2078941335 cites W1511815964 @default.
• W2078941335 cites W1540264737 @default.
• W2078941335 cites W1606741593 @default.
• W2078941335 cites W1867241955 @default.
• W2078941335 cites W1874007049 @default.
• W2078941335 cites W1885556624 @default.
• W2078941335 cites W1898626329 @default.
• W2078941335 cites W1921479150 @default.
• W2078941335 cites W1964892229 @default.
• W2078941335 cites W1965329875 @default.
• W2078941335 cites W1967769642 @default.
• W2078941335 cites W1974112332 @default.
• W2078941335 cites W1974632113 @default.
• W2078941335 cites W1984769155 @default.
• W2078941335 cites W1985063313 @default.
• W2078941335 cites W1991987237 @default.
• W2078941335 cites W1999952815 @default.
• W2078941335 cites W2000939708 @default.
• W2078941335 cites W2002698073 @default.
• W2078941335 cites W2004988279 @default.
• W2078941335 cites W2016567695 @default.
• W2078941335 cites W2017846948 @default.
• W2078941335 cites W2021798498 @default.
• W2078941335 cites W2025120585 @default.
• W2078941335 cites W2025909991 @default.
• W2078941335 cites W2026441085 @default.
• W2078941335 cites W2029320889 @default.
• W2078941335 cites W2029903254 @default.
• W2078941335 cites W2033749460 @default.
• W2078941335 cites W2036639816 @default.
• W2078941335 cites W2039313637 @default.
• W2078941335 cites W2040506727 @default.
• W2078941335 cites W2050458992 @default.
• W2078941335 cites W2060696024 @default.
• W2078941335 cites W2063560319 @default.
• W2078941335 cites W2064510821 @default.
• W2078941335 cites W2074096799 @default.
• W2078941335 cites W2074362522 @default.
• W2078941335 cites W2077315884 @default.
• W2078941335 cites W2079635700 @default.
• W2078941335 cites W2086778920 @default.
• W2078941335 cites W2088890872 @default.
• W2078941335 cites W2095217266 @default.
• W2078941335 cites W2104788426 @default.
• W2078941335 cites W2106900373 @default.
• W2078941335 cites W2114752899 @default.
• W2078941335 cites W2127640652 @default.
• W2078941335 cites W2132440338 @default.
• W2078941335 cites W2140475749 @default.
• W2078941335 cites W2146780090 @default.
• W2078941335 cites W2154848570 @default.
• W2078941335 doi "https://doi.org/10.1074/jbc.m009472200" @default.
• W2078941335 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11274167" @default.
• W2078941335 hasPublicationYear "2001" @default.
• W2078941335 type Work @default.
• W2078941335 sameAs 2078941335 @default.
• W2078941335 citedByCount "110" @default.
• W2078941335 countsByYear W20789413352012 @default.
• W2078941335 countsByYear W20789413352013 @default.
• W2078941335 countsByYear W20789413352014 @default.
• W2078941335 countsByYear W20789413352015 @default.
• W2078941335 countsByYear W20789413352016 @default.
• W2078941335 countsByYear W20789413352017 @default.
• W2078941335 countsByYear W20789413352018 @default.
• W2078941335 countsByYear W20789413352019 @default.
• W2078941335 countsByYear W20789413352020 @default.
• W2078941335 countsByYear W20789413352021 @default.
• W2078941335 countsByYear W20789413352022 @default.
• W2078941335 countsByYear W20789413352023 @default.
• W2078941335 crossrefType "journal-article" @default.
• W2078941335 hasAuthorship W2078941335A5009185796 @default.
• W2078941335 hasAuthorship W2078941335A5019581385 @default.
• W2078941335 hasAuthorship W2078941335A5072082972 @default.
• W2078941335 hasAuthorship W2078941335A5077754192 @default.
• W2078941335 hasAuthorship W2078941335A5081383291 @default.
• W2078941335 hasBestOaLocation W20789413351 @default.
• W2078941335 hasConcept C104317684 @default.
• W2078941335 hasConcept C119157956 @default.
• W2078941335 hasConcept C153911025 @default.
• W2078941335 hasConcept C185592680 @default.
• W2078941335 hasConcept C196843134 @default.
• W2078941335 hasConcept C54355233 @default.
• W2078941335 hasConcept C55493867 @default.
• W2078941335 hasConcept C64927066 @default.
• W2078941335 hasConcept C86803240 @default.
• W2078941335 hasConcept C95444343 @default.
• W2078941335 hasConceptScore W2078941335C104317684 @default.
• W2078941335 hasConceptScore W2078941335C119157956 @default.

• next