FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2079018506> ?p ?o ?g. }

• W2079018506 endingPage "4282" @default.
• W2079018506 startingPage "4272" @default.
• W2079018506 abstract "A classic model of tubulogenesis utilizes Madin-Darby canine kidney (MDCK) cells. MDCK cells form monoclonal cysts in three-dimensional collagen and tubulate in response to hepatocyte growth factor, which activates multiple signaling pathways, including the mitogen-activated protein kinase (MAPK) pathway. It was shown previously that MAPK activation is necessary and sufficient to induce the first stage of tubulogenesis, the partial epithelial to mesenchymal transition (p-EMT), whereas matrix metalloproteinases (MMPs) are necessary for the second redifferentiation stage. To identify specific MMP genes, their regulators, tissue inhibitors of matrix metalloproteinases (TIMPs), and the molecular pathways by which they are activated, we used two distinct MAPK inhibitors and a technique we have termed subtraction pathway microarray analysis. Of the 19 MMPs and 3 TIMPs present on the Canine Genome 2.0 Array, MMP13 and TIMP1 were up-regulated 198- and 169-fold, respectively, via the MAPK pathway. This was confirmed by two-dimensional and three-dimensional real time PCR, as well as in MDCK cells inducible for the MAPK gene Raf. Knockdown of MMP13 using short hairpin RNA prevented progression past the initial phase of p-EMT. Knockdown of TIMP1 prevented normal cystogenesis, although the initial phase of p-EMT did occasionally occur. The MMP13 knockdown phenotype is likely because of decreased collagenase activity, whereas the TIMP1 knockdown phenotype appears due to increased apoptosis. These data suggest a model, which may also be important for development of other branched organs, whereby the MAPK pathway controls both MDCK p-EMT and redifferentiation, in part by activating MMP13 and TIMP1. A classic model of tubulogenesis utilizes Madin-Darby canine kidney (MDCK) cells. MDCK cells form monoclonal cysts in three-dimensional collagen and tubulate in response to hepatocyte growth factor, which activates multiple signaling pathways, including the mitogen-activated protein kinase (MAPK) pathway. It was shown previously that MAPK activation is necessary and sufficient to induce the first stage of tubulogenesis, the partial epithelial to mesenchymal transition (p-EMT), whereas matrix metalloproteinases (MMPs) are necessary for the second redifferentiation stage. To identify specific MMP genes, their regulators, tissue inhibitors of matrix metalloproteinases (TIMPs), and the molecular pathways by which they are activated, we used two distinct MAPK inhibitors and a technique we have termed subtraction pathway microarray analysis. Of the 19 MMPs and 3 TIMPs present on the Canine Genome 2.0 Array, MMP13 and TIMP1 were up-regulated 198- and 169-fold, respectively, via the MAPK pathway. This was confirmed by two-dimensional and three-dimensional real time PCR, as well as in MDCK cells inducible for the MAPK gene Raf. Knockdown of MMP13 using short hairpin RNA prevented progression past the initial phase of p-EMT. Knockdown of TIMP1 prevented normal cystogenesis, although the initial phase of p-EMT did occasionally occur. The MMP13 knockdown phenotype is likely because of decreased collagenase activity, whereas the TIMP1 knockdown phenotype appears due to increased apoptosis. These data suggest a model, which may also be important for development of other branched organs, whereby the MAPK pathway controls both MDCK p-EMT and redifferentiation, in part by activating MMP13 and TIMP1. Epithelial organs such as the kidney, lung, and salivary gland develop from a process termed branching morphogenesis or tubulogenesis (1Vainio S. Muller U. Cell. 1997; 90: 975-978Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar, 2Sakurai H. Barros E.J. Tsukamoto T. Barasch J. Nigam S.K. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 6279-6284Crossref PubMed Scopus (148) Google Scholar, 3Sakurai H. Tsukamoto T. Kjelsberg C.A. Cantley L.G. Nigam S.K. Am. J. Physiol. 1997; 273: F463-F472PubMed Google Scholar, 4Gumbiner B.M. Cell. 1992; 69: 385-387Abstract Full Text PDF PubMed Scopus (169) Google Scholar, 5Pollack A.L. Runyan R.B. Mostov K.E. Dev. Biol. 1998; 204: 64-79Crossref PubMed Scopus (195) Google Scholar, 6Lipschutz J.H. Guo W. O'Brien L.E. Nguyen Y.H. Novick P. Mostov K.E. Mol. Biol. Cell. 2000; 11: 4259-4275Crossref PubMed Scopus (121) Google Scholar, 7O'Brien L.E. Tang K. Kats E.S. Schutz-Geschwender A. Lipschutz J.H. Mostov K.E. Dev. Cell. 2004; 7: 21-32Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). Although tubulogenesis is incompletely understood, genes involved in this process are conserved in different organs, and indeed throughout evolution (8Lipschutz J.H. Am. J. Physiol. 2007; 293: F985-F986Crossref Scopus (64) Google Scholar). Of all mammalian organs, kidney development is probably the best understood (9Ekblom P. Seldin D.W. Giesbach G. The Kidney: Physiology and Pathophysiology. Raven Press, Ltd., New York1992: 475-501Google Scholar) and the kidney is particularly well suited for studies of tubulogenesis (10O'Brien L.E. Zegers M.M. Mostov K.E. Nat. Rev. Mol. Cell Biol. 2002; 3: 531-537Crossref PubMed Scopus (493) Google Scholar).Because of the complexity of organogenesis (the human kidney is composed of more than 20 cell types and 1 million nephrons (10O'Brien L.E. Zegers M.M. Mostov K.E. Nat. Rev. Mol. Cell Biol. 2002; 3: 531-537Crossref PubMed Scopus (493) Google Scholar, 11Saxen L. Organogenesis of the Kidney. Cambridge University Press, Cambridge, UK1987: 1-181Crossref Google Scholar)) and the transitory nature of cyst and tubule formation, it is difficult to study these processes in vivo. Therefore, relatively little was known about tubulogenesis prior to the development of the Madin-Darby canine kidney (MDCK) 3The abbreviations used are: MDCKMadin-Darby canine kidneyHGFhepatocyte growth factorMAPKmitogen-activated protein kinaseMMPmatrix metalloproteinaseshRNAshort hairpin RNAp-EMTpartial epithelial-mesenchymal transitionTIMPtissue inhibitor of matrix metalloproteinaseFACSfluorescence-activated cell sorterGFPgreen fluorescent proteinERKextracellular signal-regulated kinaseMEKMAPK/ERK kinase4-HT4-hydroxytamoxifenUOU0126PDPD098059.3The abbreviations used are: MDCKMadin-Darby canine kidneyHGFhepatocyte growth factorMAPKmitogen-activated protein kinaseMMPmatrix metalloproteinaseshRNAshort hairpin RNAp-EMTpartial epithelial-mesenchymal transitionTIMPtissue inhibitor of matrix metalloproteinaseFACSfluorescence-activated cell sorterGFPgreen fluorescent proteinERKextracellular signal-regulated kinaseMEKMAPK/ERK kinase4-HT4-hydroxytamoxifenUOU0126PDPD098059./hepatocyte growth factor (HGF) in vitro assay. The MDCK cell line was derived from the kidney tubules of a normal cocker spaniel in 1958 (12Leighton J. Estes L.W. Mansukhani S. Brada Z. Cancer. 1970; 26: 1022-1028Crossref PubMed Scopus (112) Google Scholar, 13Madin S.H. Andriese P.C. Darby N.B. Am. J. Vet. Res. 1957; 18: 932-941PubMed Google Scholar) and, for the past several decades, has been one of the most widely used reagents for studying important and fundamental issues in epithelial cell biology (14Simons K. Fuller S.D. Annu. Rev. Cell Biol. 1985; 1: 243-288Crossref PubMed Scopus (559) Google Scholar). When MDCK cells are seeded singly within a three-dimensional collagen matrix, over 10 days they form monoclonal structures that are characterized by a polarized epithelium surrounding a fluid-filled space, apical microvilli, a solitary cilium, and apical tight junctions (15McAteer J.A. Dougherty G.S. Gardner Jr., K.D. Evan A.P. Scanning Electron Microsc. 1986; : 1135-1150PubMed Google Scholar, 16McAteer J.A. Evan A.P. Gardner K.D. Anat. Rec. 1987; 217: 229-239Crossref PubMed Scopus (89) Google Scholar), meeting the most rigorous definition of “cysts” (17McAteer J.A. Dougherty G.S. Gardner Jr., K.D. Evan A.P. Scanning Microsc. 1988; 2: 1739-1763PubMed Google Scholar). Exposure of preformed MDCK cysts to HGF causes the cysts to develop branching tubules (18Montesano R. Schaller G. Orci L. Cell. 1991; 66: 697-711Abstract Full Text PDF PubMed Scopus (433) Google Scholar) in a process that resembles renal branching morphogenesis in vivo (11Saxen L. Organogenesis of the Kidney. Cambridge University Press, Cambridge, UK1987: 1-181Crossref Google Scholar).Detailed studies using MDCK cells grown in a collagen matrix until the cyst stage and induced with HGF showed that tubulogenesis consists of the following two morphologically defined stages: an initiation stage, termed partial epithelial-mesenchymal transition (p-EMT) that occurs in the first 24 h following HGF induction, and subsequent redifferentiation that proceeds over the next 48-72 h (5Pollack A.L. Runyan R.B. Mostov K.E. Dev. Biol. 1998; 204: 64-79Crossref PubMed Scopus (195) Google Scholar, 7O'Brien L.E. Tang K. Kats E.S. Schutz-Geschwender A. Lipschutz J.H. Mostov K.E. Dev. Cell. 2004; 7: 21-32Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar, 10O'Brien L.E. Zegers M.M. Mostov K.E. Nat. Rev. Mol. Cell Biol. 2002; 3: 531-537Crossref PubMed Scopus (493) Google Scholar). In morphologic terms, the p-EMT stage involves the formation of actin extensions and chains of cells, which have lost their polarity, extending off the basolateral surface of the cysts, whereas redifferentiation involves the generation of tubular lumens and the re-emergence of epithelial cell polarity (5Pollack A.L. Runyan R.B. Mostov K.E. Dev. Biol. 1998; 204: 64-79Crossref PubMed Scopus (195) Google Scholar). HGF (also known as scatter factor) is mitogenic, motogenic, and morphogenic, and binding of HGF to its CMET tyrosine kinase receptor, which is located on the basolateral surface of MDCK cells (19Crepaldi T. Pollack A.L. Prat M. Zborek A. Mostov K. Comoglio P.M. J. Cell Biol. 1994; 125: 313-320Crossref PubMed Scopus (108) Google Scholar), activates a multitude of signaling pathways, including phosphoinositide 3-kinase, phospholipase C, protein-tyrosine phosphatase 2, cytosolic phospholipase A2, and MAPK/ERK to name a few (as reviewed in Ref. 20Balkovetz D.F. Lipschutz J.H. Int. Rev. Cytol. 1999; 186: 225-260Crossref PubMed Google Scholar).We and our colleagues previously showed that the MAPK pathway of Raf-MEK-ERK is both necessary and sufficient to initiate p-EMT, whereas matrix metalloproteinases (MMPs) are necessary for the redifferentiation stage of MDCK tubulogenesis (7O'Brien L.E. Tang K. Kats E.S. Schutz-Geschwender A. Lipschutz J.H. Mostov K.E. Dev. Cell. 2004; 7: 21-32Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar, 21Hellman N.E. Greco A.J. Rogers K.K. Kanchagar C. Balkovetz D.F. Lipschutz J.H. Am. J. Physiol. 2005; 289: F777-F785Crossref Scopus (21) Google Scholar). MMPs are zinc-containing endopeptidases that are involved in remodeling the extracellular matrix and are crucial for organ development. Tissue inhibitors of matrix metalloproteinases (TIMPs) are endogenous specific inhibitors of MMPs that bind the active site of the MMP catalytic domain. To date, 28 MMPs and 4 TIMPs have been identified in vertebrates (22Catania J.M. Chen G. Parrish A.R. Am. J. Physiol. 2007; 292: F905-F911Crossref PubMed Scopus (312) Google Scholar).Here we used subtraction pathway microarray analysis to identify specific candidate MMP “tubulogenes,” their TIMP regulators, and the molecular pathways by which they were activated. The resulting candidate tubulogenes genes were then knocked down in MDCK cells using short hairpin RNA (shRNA), and the phenotype and mechanism of action were studied during HGF-induced tubulogenesis.MATERIALS AND METHODSMDCK Culture, HGF/4-HT Treatment, and RNA Isolation–Low passage type II MDCK cells were obtained from K. Mostov (University of California, San Francisco) and used between passages 3 and 10 as described previously (23Balkovetz D.F. Sambandam V. Kidney Int. 1999; 56: 910-921Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar, 24Balkovetz D.F. Pollack A.L. Mostov K.E. J. Biol. Chem. 1997; 272: 3471-3477Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar). These cells were originally cloned by Daniel Louvard at the European Molecular Biology Laboratory (EMBL) and came to Keith Mostov via Karl Matlin. Cells were cultured in modified Eagle's minimum essential medium containing Earle's balanced salt solution and glutamine supplemented with 5% fetal calf serum, 100 units/ml penicillin, and 100 μg/ml streptomycin. MDCK cells were seeded at confluency on 24-mm Transwell filter units coated with collagen (Costar, Cambridge, MA). Pore size on all filters was 0.4 μm. Cell monolayers were used for experiments after 6-7 days of culture with daily changes in medium. Recombinant HGF at 100 ng/ml was added to the basolateral compartment of MDCK cell monolayers following a 1-h pretreatment either with or without U0126 (UO) (Promega) or PD098059 (PD) (Sigma), both inhibitors of MEK, at 10 and 50 μm, respectively.MDCK shRNA-expressing cell lines and controls were plated out in a three-dimensional type I collagen matrix as described previously (21Hellman N.E. Greco A.J. Rogers K.K. Kanchagar C. Balkovetz D.F. Lipschutz J.H. Am. J. Physiol. 2005; 289: F777-F785Crossref Scopus (21) Google Scholar) and allowed to mature into hollow cystic structures over the course of 2 weeks. Cysts were then stimulated either in the presence or absence of hepatocyte growth factor at a concentration of either 100 ng/ml for 24 h or a concentration of 30 ng/ml for 4 days, and the HGF-containing media were changed daily. MDCK cell cysts subjected to HGF at 100 ng/ml for 24 h have been shown to induce p-EMT, the initial stage of tubulogenesis, in virtually 100% of MDCK cell cysts (6Lipschutz J.H. Guo W. O'Brien L.E. Nguyen Y.H. Novick P. Mostov K.E. Mol. Biol. Cell. 2000; 11: 4259-4275Crossref PubMed Scopus (121) Google Scholar, 21Hellman N.E. Greco A.J. Rogers K.K. Kanchagar C. Balkovetz D.F. Lipschutz J.H. Am. J. Physiol. 2005; 289: F777-F785Crossref Scopus (21) Google Scholar); however, the same concentration applied to MDCK cells for 4 days was observed to result in cell scatter. Therefore, a lower concentration of HGF (30 ng/ml) was chosen, which, when added for 4 days, was observed to result in mature tubule formation in some cysts. Recombinant human HGF was very generously provided by the late R. Schwall (Genentech, South San Francisco).Type II MDCK cells containing inducible Raf fused to the estrogen receptor (25Hansen S.H. Zegers M.M. Woodrow M. Rodriguez-Viciana P. Chardin P. Mostov K.E. McMahon M. Mol. Cell. Biol. 2000; 20: 9364-9375Crossref PubMed Scopus (92) Google Scholar) were grown on two-dimensional Transwell filters as described above. In these cells, the kinase activity of Raf was induced using an estrogen analog, 4-hydroxytamoxifen (4-HT) (Sigma), at a concentration of 1 μm as described previously (25Hansen S.H. Zegers M.M. Woodrow M. Rodriguez-Viciana P. Chardin P. Mostov K.E. McMahon M. Mol. Cell. Biol. 2000; 20: 9364-9375Crossref PubMed Scopus (92) Google Scholar, 26Liu Z. Greco A.J. Hellman N.E. Spector J. Robinson J. Tang O.T. Lipschutz J.H. Biochem. Biophys. Res. Commun. 2007; 353: 793-798Crossref PubMed Scopus (13) Google Scholar).Total RNA was obtained from MDCK cell monolayers using the RNeasy Mini Protocol (Qiagen) for the isolation of total RNA from animal cells. For the microarray studies, RNA samples were visualized by agarose RNA electrophoresis. RNA concentration and purity were measured by determining the 260 nm/280 nm ratio. All ratios were greater than 1.8.Microarray Analysis–For our experiments, all protocols were conducted as described in the Affymetrix GeneChip Expression Analysis Technical Manual. All conditions were performed in quadruplicate except where otherwise stated. Fifteen μg of total RNA, collected from MDCK cells grown for 6 days on Transwell filters and exposed to 0 or 24 h of HGF, with and without UO126 or PD09859, were converted to first-strand cDNA. Second-strand cDNA synthesis was followed by in vitro transcription for linear amplification of each transcript and incorporation of biotinylated CTP and UTP. The cRNA products were fragmented to 200 nucleotides or less, heated at 99 °C for 5 min, and hybridized for 16 h at 45 °C to the GeneChip® Canine Genome 2.0 Array (Affymetrix Inc), containing 42,860 Canis familiaris probe sets for >20,000 predicted genes.The GeneChip® Canine Genome 2.0 Array chips were then washed at low and high stringency and stained with streptavidin-phycoerythrin. Fluorescence was amplified by adding biotinylated anti-streptavidin and an additional aliquot of streptavidin-phycoerythrin stain. A confocal scanner was used to collect fluorescence signal at 3 nm resolution after excitation at 570 nm. The average signal from two sequential scans was calculated for each microarray feature. A complete microarray expression data set has been submitted to the National Center for Biotechnology Information's (NCBI) Gene Expression Omnibus (GEO) data base (GEO Submission GSE9435, NCBI tracking system 15360129).Affymetrix GeneChip Operating System (GCOS, version 1.4) was used to quantitate the expression levels for the genes represented on the GeneChip® Canine Genome 2.0 Array; default values provided by Affymetrix were applied to all analysis parameters. Border pixels were removed, and the average intensity of pixels within the 75th percentile was computed for each probe. The average of the lowest 2% of probe intensities occurring in each of 16 microarray sectors was set as background and subtracted from all features in that sector. Probe pairs were scored positive or negative for detection of a specific gene sequence by comparing signals from the perfect match and mismatch probe features. The number of probe pairs meeting the default discrimination threshold (τ = 0.015) was used to assign a call of absent (A), present (P), or marginal (M) for each assayed gene, and a p value was calculated to reflect confidence in the detection determination. One of the samples, HGF + UO, was observed to have been degraded during processing and was therefore excluded from subsequent analyses.Affymetrix cell files, containing probe intensities, were imported into GeneSpring (version 7.3, Agilent Technologies) where GC-robust multiarray average was applied to calculate probe set signal levels. The GCOS-generated present/absent/marginal determinations for each probe set on each GeneChip® Canine Genome 2.0 Array chip were imported as well. To assess global inter-sample relationships, we exported the data for all genes that were present in at least 3 of the 15 samples and performed hierarchical clustering using GeneSpring.We were interested in identifying differentially regulated genes in three basic comparisons, HGF alone versus control (standard medium), HGF + UO versus HGF alone, and HGF + PD versus HGF alone. For each comparison, all genes on the array were first filtered to retain those that were present in all replicates of at least one of the conditions. The filtered lists were then exported to Microsoft Excel, where Significance Analysis of Microarrays (version 2.21, Stanford University) was applied in a two-class unpaired mode, with 500 permutations to identify differentially regulated genes with a ≥2-fold change and a false discovery rate of <0.01%. These three gene lists were each then subdivided to include a group of genes that were up-regulated and a group of genes that were down-regulated, yielding six lists as follows: HGF > control, HGF < control, HGF + PD > HGF, HGF + PD < HGF, HGF + UO > HGF, and HGF + UO < HGF.Real Time PCR–Fifteen μg of total RNA, collected from MDCK cells grown for 6 days on Transwell filters and exposed to 0 or 24 h of HGF ± UO126 or PD09859, were converted to first-strand cDNA. cDNA and the TaqMan primer/probe system, individualized for each mRNA, were used in conjunction with the 7700 PRISM sequence detection instrument (both Applied Biosystems) as described in the Applied Biosystems technical manual. When the reaction product amplification exceeded the threshold value, the corresponding cycle number was termed CT. Fold change between conditions was calculated through an exponential function of the observed difference in CT as described previously (27Livak K.J. Schmittgen T.D. Methods (San Diego). 2001; 25: 402-408Crossref PubMed Scopus (119422) Google Scholar). The values were normalized to a control mRNA, the 18S ribosome, and all real time PCR studies were performed at least three times in triplicate.Western Blotting–Western blot analysis was performed as described previously (28Lipschutz J.H. Lingappa V.R. Mostov K.E. J. Biol. Chem. 2003; 278: 20954-20960Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar). For caspase 3 analysis, filters were probed with rabbit anti-cleaved caspase 3 at a concentration of 1:1000 (Asp-175; Cell Signal Technology, Danvers, MA). This antibody recognizes active caspase 3 and is a marker for apoptosis (29Yu W. Fang X. Ewald A. Wong K. Hunt C.A. Werb Z. Matthay M.A. Mostov K. Mol. Biol. Cell. 2007; 18: 1693-1700Crossref PubMed Scopus (75) Google Scholar). Filters were then probed with horseradish peroxidase-labeled donkey anti-rabbit antibody at 1:5000 dilution. Filters were developed using SuperSignal West Femto maximum sensitivity substrate kit (Pierce) and visualized on Kodak X-Omat film (Eastman Kodak Co.).Creation of shRNA Vectors–The lentiviral vector psicoR (30Ventura A. Meissner A. Dillon C.P. McManus M. Sharp P.A. Van Parijs L. Jaenisch R. Jacks T. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 10380-10385Crossref PubMed Scopus (510) Google Scholar) was used to generate all shRNA-containing vectors in this paper. The software program Psicoligomaker was used to select 19-mer shRNA sequences against both canine MMP13 and TIMP1 genes. The sequence selected for MMP13 shRNA knockdown was 5′-GACTCATTCTGAAGTTGAA-3′ (located in exon 3), and the primers used to generate this sequence were MMP13shFwd (5′-TGACTCATTCTGAAGTTGAATTCAAGAGATTCAACTTCAGAATGAGTCTTTTTTC-3′) and MMP13shRev (5′-TCGAGAAAAAAGACTCATTCTGAAGTTGAATCTCTTGAATTCAACTTCAGAATGAGTCA-3′). The sequence selected for TIMP1 shRNA was 5′-GTTCATCCATCCCCTGCAA-3′ (located in exon 6), and the primers used to generate this sequence were TIMP1shFwd (5′-TGTTCATCCATCCCCTGCAATTCAAGAGATTGCAGGGGATGGATGAACTTTTTTC-3′) and TIMP1shRev (5′-TCGAGAAAAAAGTTCATCCATCCCCTGCAATCTCTTGAATTGCAGGGGATGGATGAACA-3′). The sequence of the scrambled shRNA used as a control was 5′-GTCAAGTCTCACTTGCGTC-3′ and the primers used to generate this sequence were scrFwd1 (5′-TGTCAAGTCTCACTTGCGTCTTCAAGAGAGACGCAAGTGAGACTTGACTTTTTTC-3′) and scrRev1 (5′-TCGAGAAAAAAGTCAAGTCTCACTTGCGTCTCTCTTGAAGACGCAAGTGAGACTTGACA-3′). Annealed, phosphorylated oligonucleotides were then ligated into HpaI/XhoI-cut psicoR vector, and clones with the appropriate size insert were selected for sequence analysis. One clone of each plasmid with the correct sequence was chosen and DNA prepared using a maxi-prep DNA kit (Qiagen).To confirm the specificity of the shRNA knockdown, a second shRNA was created using the pPRIME system, which was generously supplied by the Elledge laboratory (31Stegmeier F. Hu G. Rickles R.J. Hannon G.J. Elledge S.J. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 13212-13217Crossref PubMed Scopus (444) Google Scholar). The shRNA sequence was designed by pasting the TIMP1 canine mRNA sequence (GenBank™ accession number AY534616) into the program found at the RNAi Central website. The 22-mer shRNA sequence beginning at position 89, TGGAGAGCGTCTGCGGATACTT, was cloned into the p199 vector and then into a lentiviral delivery system for infection into MDCK T23 cells, followed by FACS sorting as described above.Creation of MDCK shRNA Cell Lines–To prepare lentivirus-containing media, early passage HEK293T cells (ATCC) were transfected according to the calcium phosphate precipitation method with 12 μg of the shRNA-containing vector (either psi-coR-MMP13sh, psicoR-TIMP1sh, psicoR-scr, or psicoR vector alone) along with 6 μg each of the packaging vectors pVSVG, pMDL, and pREV. After 48 h, 45 ml of lentivirus-containing media were harvested and concentrated in an ultracentrifuge at 16,000 × g at 4 °C for 2.5 h. The viral pellet was resuspended in phosphate-buffered saline and used to infect MDCK strain II or MDCK T23 cells plated at a concentration of 5 × 105 at a multiplicity of infection of 10-20. Efficiency of infection was determined by assessing GFP fluorescence using FACS analysis (FACSCalibur, BD Biosciences).Cre Rescue–MDCK cells expressing MMP13 and TIMP1 knockdown shRNA were grown to 60% confluency and exposed to standard minimum essential medium containing 10 μl of adenovirus expressing Cre recombinase (Vector Laboratories). The concentration of adenovirus corresponded to a multiplicity of infection of 200. The Cre-containing medium was left on the cells for 6 h at 37 °C and then replaced with fresh medium. Excision of the loxp-flanked shRNA-containing vector was confirmed by loss of GFP expression.Immunofluorescence–Collagen disks from HGF-treated and -untreated cells were harvested and fixed in 4% paraformaldehyde for 20 min followed by quenching in 50 mm NH4Cl for 10 min as described previously (21Hellman N.E. Greco A.J. Rogers K.K. Kanchagar C. Balkovetz D.F. Lipschutz J.H. Am. J. Physiol. 2005; 289: F777-F785Crossref Scopus (21) Google Scholar). Cysts were permeabilized in 1% Triton X-100 for 15 min, treated with Hoechst nuclear stain (Sigma) for 10 min when indicated, and then treated with either phalloidin-rhodamine (Sigma) or primary antibody against caspase 3 at a concentration of 1:250 (Asp-175; Cell Signal Technology, Danvers, MA). Secondary antibody (e.g. donkey anti-rabbit Cy3 at a concentration of 1:600) was used when indicated. Collagen disks were mounted with Fluoprep (Biomérieux, France) and visualized using a fluorescent microscope (Leica DMR) or a confocal microscope (Leica TCS SL).RESULTSIdentification of Genes Regulated by HGF as Determined by Microarray Analysis–HGF-induced tubulogenesis in MDCK cells is a complex process requiring the coordination of diverse cellular processes such as proliferation, cytoskeletal rearrangement, motility, differentiation, and extracellular matrix secretion (32Zegers M.M. O'Brien L.E. Yu W. Datta A. Mostov K.E. Trends Cell Biol. 2003; 13: 169-176Abstract Full Text Full Text PDF PubMed Scopus (211) Google Scholar). Given that we and our colleagues previously showed, using broad inhibitors of the entire MMP family, that MMPs are necessary for the redifferentiation stage of tubulogenesis (7O'Brien L.E. Tang K. Kats E.S. Schutz-Geschwender A. Lipschutz J.H. Mostov K.E. Dev. Cell. 2004; 7: 21-32Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar), we set out here to identify specific candidate MMP and TIMP genes regulated by HGF and their pathway of activation. Because of the large number of MMPs and TIMPs described to date (22Catania J.M. Chen G. Parrish A.R. Am. J. Physiol. 2007; 292: F905-F911Crossref PubMed Scopus (312) Google Scholar), we decided to use nonbiased DNA microarray analysis as our initial screen. The recently released Canine Genome 2.0 Array (Affymetrix) contains 19 MMPs and 3 TIMPs (Fig. 1A), and importantly, all the MMPs and TIMPs that have been reported to be expressed in the kidney are found on the Canine Genome 2.0 Array (Fig. 1B). Our screen was accomplished by first determining the total set of genes regulated by HGF and then, because the MAPK/ERK pathway has been shown to play a central role in HGF-induced tubulogenesis, subtracting out the subset of genes that were still regulated by HGF in the presence of either of two distinct inhibitors of the MAPK/ERK pathway, UO and PD, both of which act by preventing phosphorylation of MEK.For these experiments, MDCK type II cells were grown on a Transwell filter coated with collagen for 6 days and treated according to one of four conditions as follows: exposure to recombinant HGF, to HGF + UO, to HGF + PD, or to standard medium (control). For each condition, performed in quadruplicate, the MDCK cells were exposed to the indicated treatment for a 24-h period, which corresponds to the completion of the p-EMT stage and the beginning of the redifferentiation stage of tubulogenesis. Therefore, all RNA necessary to initiate the redifferentiation stage of tubulogenesis should be present. RNA was harvested from the MDCK cells treated under each condition and then converted to cDNA, which was used to query the C. familiaris genes on the GeneChip® Canine Genome 2.0 Array. The details of how we performed the analysis can be found under “Materials and Methods.” We initially evaluated the list of genes that were differentially regulated by hierarchically clustering all genes that were present in at least 3 of the 15 individual samples (one sample in the HGF + UO set was lost during processing).The resulting dendrogram shown at the top of Fig. 2A indicates that the replicates are very similar for each condition (exposure to recombinant HGF, to HGF + UO, to HGF + PD, or to standard medium) and, furthermore, that gene expression in the HGF + UO condition is similar to gene expression in the HGF + PD condition. The color in Fig. 2A depicts ratios of the expression of a gene in a single sample to the median of expression of that same gene across all the samples.FIGURE 2Subtraction pathway microarray analysis of gene regulation induced by HGF via the MAPK/ERK signaling pathway. A, dendrogram illustrating the clustering of all four replicates for each condition as follows: HGF alone, HGF + PD, HGF + UO, and control (standard culture medium). The fact that all four replicates in each condition cluster thus validates the similarity of the replicates. The columns represent the genes, ordered in rows across the columns, that were differentially regulated. The different colors refer to levels of regulation with blue" @default.
• W2079018506 created "2016-06-24" @default.
• W2079018506 creator A5008639087 @default.
• W2079018506 creator A5011609263 @default.
• W2079018506 creator A5060473087 @default.
• W2079018506 creator A5067853725 @default.
• W2079018506 creator A5072881309 @default.
• W2079018506 creator A5080539449 @default.
• W2079018506 creator A5086426092 @default.
• W2079018506 creator A5090227920 @default.
• W2079018506 date "2008-02-01" @default.
• W2079018506 modified "2023-10-14" @default.
• W2079018506 title "Matrix Metalloproteinase 13 (MMP13) and Tissue Inhibitor of Matrix Metalloproteinase 1 (TIMP1), Regulated by the MAPK Pathway, Are Both Necessary for Madin-Darby Canine Kidney Tubulogenesis" @default.
• W2079018506 cites W1581464438 @default.
• W2079018506 cites W1969134145 @default.
• W2079018506 cites W1979841422 @default.
• W2079018506 cites W1986340915 @default.
• W2079018506 cites W1989963027 @default.
• W2079018506 cites W1993261987 @default.
• W2079018506 cites W1994683536 @default.
• W2079018506 cites W1995012824 @default.
• W2079018506 cites W1997812521 @default.
• W2079018506 cites W2001475400 @default.
• W2079018506 cites W2003500892 @default.
• W2079018506 cites W2008434851 @default.
• W2079018506 cites W2022422012 @default.
• W2079018506 cites W2028289405 @default.
• W2079018506 cites W2030705338 @default.
• W2079018506 cites W2032461554 @default.
• W2079018506 cites W2044801532 @default.
• W2079018506 cites W2047404721 @default.
• W2079018506 cites W2051066117 @default.
• W2079018506 cites W2062835218 @default.
• W2079018506 cites W2067621691 @default.
• W2079018506 cites W2071359561 @default.
• W2079018506 cites W2086647308 @default.
• W2079018506 cites W2093353711 @default.
• W2079018506 cites W2100808624 @default.
• W2079018506 cites W2104551096 @default.
• W2079018506 cites W2107277218 @default.
• W2079018506 cites W2110223227 @default.
• W2079018506 cites W2114117271 @default.
• W2079018506 cites W2114182635 @default.
• W2079018506 cites W2114529565 @default.
• W2079018506 cites W2118124944 @default.
• W2079018506 cites W2124894661 @default.
• W2079018506 cites W2125156008 @default.
• W2079018506 cites W2135151730 @default.
• W2079018506 cites W2135188993 @default.
• W2079018506 cites W2136222819 @default.
• W2079018506 cites W2136513361 @default.
• W2079018506 cites W2142956110 @default.
• W2079018506 cites W2143371665 @default.
• W2079018506 cites W2143460256 @default.
• W2079018506 cites W2148649613 @default.
• W2079018506 cites W2158699923 @default.
• W2079018506 cites W2159695799 @default.
• W2079018506 cites W2162938177 @default.
• W2079018506 cites W2233247593 @default.
• W2079018506 cites W4251805238 @default.
• W2079018506 doi "https://doi.org/10.1074/jbc.m708027200" @default.
• W2079018506 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/18039671" @default.
• W2079018506 hasPublicationYear "2008" @default.
• W2079018506 type Work @default.
• W2079018506 sameAs 2079018506 @default.
• W2079018506 citedByCount "45" @default.
• W2079018506 countsByYear W20790185062012 @default.
• W2079018506 countsByYear W20790185062013 @default.
• W2079018506 countsByYear W20790185062014 @default.
• W2079018506 countsByYear W20790185062015 @default.
• W2079018506 countsByYear W20790185062016 @default.
• W2079018506 countsByYear W20790185062018 @default.
• W2079018506 countsByYear W20790185062019 @default.
• W2079018506 countsByYear W20790185062020 @default.
• W2079018506 countsByYear W20790185062021 @default.
• W2079018506 countsByYear W20790185062023 @default.
• W2079018506 crossrefType "journal-article" @default.
• W2079018506 hasAuthorship W2079018506A5008639087 @default.
• W2079018506 hasAuthorship W2079018506A5011609263 @default.
• W2079018506 hasAuthorship W2079018506A5060473087 @default.
• W2079018506 hasAuthorship W2079018506A5067853725 @default.
• W2079018506 hasAuthorship W2079018506A5072881309 @default.
• W2079018506 hasAuthorship W2079018506A5080539449 @default.
• W2079018506 hasAuthorship W2079018506A5086426092 @default.
• W2079018506 hasAuthorship W2079018506A5090227920 @default.
• W2079018506 hasBestOaLocation W20790185061 @default.
• W2079018506 hasConcept C104317684 @default.
• W2079018506 hasConcept C106487976 @default.
• W2079018506 hasConcept C109523444 @default.
• W2079018506 hasConcept C134018914 @default.
• W2079018506 hasConcept C150194340 @default.
• W2079018506 hasConcept C185592680 @default.
• W2079018506 hasConcept C2775965246 @default.
• W2079018506 hasConcept C2780091579 @default.
• W2079018506 hasConcept C2780692422 @default.
• W2079018506 hasConcept C43617362 @default.
• W2079018506 hasConcept C55493867 @default.
• W2079018506 hasConcept C55728118 @default.

• next