FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2079050871> ?p ?o ?g. }

• W2079050871 endingPage "48569" @default.
• W2079050871 startingPage "48563" @default.
• W2079050871 abstract "Cytochrome P450c17 (CYP17) converts the C21 steroids pregnenolone and progesterone to the C19 androgen precursors dehydroepiandrosterone (DHEA) and androstenedione, respectively, via sequential 17α-hydroxylase and 17,20-lyase reactions. Disabling mutations in CYP17 cause combined 17α-hydroxylase/17,20-lyase deficiency, but rare missense mutations cause isolated loss of 17,20-lyase activity by disrupting interactions of redox partner proteins with CYP17. We studied an adolescent male with clinical and biochemical features of isolated 17,20-lyase deficiency, including micropenis, hypospadias, and gynecomastia, who is homozygous for CYP17 mutation E305G, which lies in the active site. When expressed in HEK-293 cells or Saccharomyces cerevisiae, mutation E305G retains 17α-hydroxylase activities, converting pregnenolone and progesterone to 17α-hydroxysteroids. However, mutation E305G lacks 17,20-lyase activity for the conversion of 17α-hydroxypregnenolone to DHEA, which is the dominant pathway to C19 steroids catalyzed by human CYP17 (the Δ5-steroid pathway). In contrast, mutation E305G exhibits 11-fold greater catalytic efficiency (kcat/Km) for the cleavage of 17α-hydroxyprogesterone to androstenedione compared with wild-type CYP17. We conclude that mutation E305G selectively impairs 17,20-lyase activity for DHEA synthesis despite an increased capacity to form androstenedione. Mutation E305G provides genetic evidence that androstenedione formation from 17α-hydroxyprogesterone via the minor Δ4-steroid pathway alone is not sufficient for complete formation of the male phenotype in humans. Cytochrome P450c17 (CYP17) converts the C21 steroids pregnenolone and progesterone to the C19 androgen precursors dehydroepiandrosterone (DHEA) and androstenedione, respectively, via sequential 17α-hydroxylase and 17,20-lyase reactions. Disabling mutations in CYP17 cause combined 17α-hydroxylase/17,20-lyase deficiency, but rare missense mutations cause isolated loss of 17,20-lyase activity by disrupting interactions of redox partner proteins with CYP17. We studied an adolescent male with clinical and biochemical features of isolated 17,20-lyase deficiency, including micropenis, hypospadias, and gynecomastia, who is homozygous for CYP17 mutation E305G, which lies in the active site. When expressed in HEK-293 cells or Saccharomyces cerevisiae, mutation E305G retains 17α-hydroxylase activities, converting pregnenolone and progesterone to 17α-hydroxysteroids. However, mutation E305G lacks 17,20-lyase activity for the conversion of 17α-hydroxypregnenolone to DHEA, which is the dominant pathway to C19 steroids catalyzed by human CYP17 (the Δ5-steroid pathway). In contrast, mutation E305G exhibits 11-fold greater catalytic efficiency (kcat/Km) for the cleavage of 17α-hydroxyprogesterone to androstenedione compared with wild-type CYP17. We conclude that mutation E305G selectively impairs 17,20-lyase activity for DHEA synthesis despite an increased capacity to form androstenedione. Mutation E305G provides genetic evidence that androstenedione formation from 17α-hydroxyprogesterone via the minor Δ4-steroid pathway alone is not sufficient for complete formation of the male phenotype in humans. Cytochrome P450c17 (CYP17, 17α-hydroxylase/17,20-lyase) largely controls sex steroid production by catalyzing the conversion of C21 steroids to C19 androgen precursors (1.Nakajin S. Shively J.E. Yuan P. Hall P.F. Biochemistry. 1981; 20: 4037-4042Crossref PubMed Scopus (259) Google Scholar, 2.Nakajin S. Hall P.F. J. Biol. Chem. 1981; 256: 6134-6139Abstract Full Text PDF PubMed Google Scholar). Human CYP17 17α-hydroxylates pregnenolone and progesterone at comparable rates, but the catalytic efficiency of the 17,20-lyase reaction is much greater with 17α-hydroxypregnenolone (the Δ5-steroid pathway) than with 17α-hydroxyprogesterone (the Δ4-steroid pathway) (3.Auchus R.J. Lee T.C. Miller W.L. J. Biol. Chem. 1998; 273: 3158-3165Abstract Full Text Full Text PDF PubMed Scopus (481) Google Scholar, 4.Lee-Robichaud P. Wright J.N. Akhtar M.E. Akhtar M. Biochem. J. 1995; 308: 901-908Crossref PubMed Scopus (136) Google Scholar). Consequently, dehydroepiandrosterone (DHEA) 1The abbreviations used are: DHEAdehydroepiandrosteroneCPRcytochrome P450 reductaseILDisolated 17,20-lyase deficiency. (Fig. 1) is an obligatory intermediate in the major pathways of sex steroid biosynthesis in humans (5.Fluck C.E. Miller W.L. Auchus R.J. J. Clin. Endocrinol. Metab. 2003; 88: 3762-3766Crossref PubMed Scopus (126) Google Scholar). The 17,20-lyase activity is particularly dependent on proper abundance of the electron transfer proteins cytochrome P450 reductase (CPR) (6.Yanagibashi K. Hall P.F. J. Biol. Chem. 1986; 261: 8429-8433Abstract Full Text PDF PubMed Google Scholar, 7.Lin D. Black S.M. Nagahama Y. Miller W.L. Endocrinology. 1993; 132: 2498-2506Crossref PubMed Google Scholar) and cytochrome b5 (8.Onoda M. Hall P.F. Biochem. Biophys. Res. Commun. 1982; 108: 454-460Crossref PubMed Scopus (118) Google Scholar). Optimal molar ratios of CYP17 to cytochrome b5 stimulate 17,20-lyase activity 10-fold, with little influence on 17α-hydroxylase activity (3.Auchus R.J. Lee T.C. Miller W.L. J. Biol. Chem. 1998; 273: 3158-3165Abstract Full Text Full Text PDF PubMed Scopus (481) Google Scholar, 4.Lee-Robichaud P. Wright J.N. Akhtar M.E. Akhtar M. Biochem. J. 1995; 308: 901-908Crossref PubMed Scopus (136) Google Scholar, 9.Katagiri M. Kagawa N. Waterman M.R. Arch. Biochem. Biophys. 1995; 317: 343-347Crossref PubMed Scopus (212) Google Scholar); however, the Δ5-steroid preference for the 17,20-lyase reaction persists under all conditions examined. In contrast, the rat (10.Fevold H.R. Lorence M.C. McCarthy J.L. Trant J.M. Kagimoto M. Waterman M.R. Mason J.I. Mol. Endocrinol. 1989; 3: 968-975Crossref PubMed Scopus (148) Google Scholar), mouse (11.Youngblood G.L. Payne A.H. Mol. Endocrinol. 1992; 6: 927-934PubMed Google Scholar), and Xenopus (12.Yang W.H. Lutz L.B. Hammes S.R. J. Biol. Chem. 2003; 278: 9552-9559Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar) CYP17 enzymes demonstrate high 17,20-lyase activity for both pathways, and the guinea pig isoform (13.Tremblay Y. Fleury A. Beaudoin C. Valée M. Bélanger A. DNA Cell Biol. 1994; 13: 1199-1212Crossref PubMed Scopus (53) Google Scholar) strongly favors the Δ4-steroid pathway. dehydroepiandrosterone cytochrome P450 reductase isolated 17,20-lyase deficiency. Inactivating mutations in the CYP17 gene cause combined 17α-hydroxylase/17,20-lyase deficiency (14.Biglieri E.G. Herron M.A. Brust N. J. Clin. Investig. 1966; 15: 1945-1954Google Scholar, 15.Auchus R.J. Endocrinol. Metab. Clin. N. Am. 2001; 30: 101-119Abstract Full Text Full Text PDF PubMed Scopus (214) Google Scholar). Without adrenal 17α-hydroxylase activity, glucocorticoid precursors with mineralocorticoid activity accumulate, causing hypertension and hypokalemia, whereas absent gonadal 17,20-lyase activity results in sexual infantilism regardless of genetic sex. Partial deficiencies in CYP17 can cause milder or intermediate phenotypes (16.Yanase T. Simpson E.R. Waterman M.R. Endocr. Rev. 1991; 12: 91-108Crossref PubMed Scopus (332) Google Scholar, 17.Miura K. Yasuda K. Yanase T. Yamakita N. Sasano H. Nawata H. Inoue M. Fukaya T. Shizuta Y. J. Clin. Endocrinol. Metab. 1996; 81: 3797-3801Crossref PubMed Scopus (76) Google Scholar), including genital ambiguity in genetic males. In rare instances, only 17,20-lyase activity is significantly impaired, causing isolated 17,20-lyase deficiency (ILD) (18.Geller D.H. Auchus R.J. Mendonça B.B. Miller W.L. Nat. Genet. 1997; 17: 201-205Crossref PubMed Scopus (261) Google Scholar), which also causes male pseudohermaphroditism. Genetic and biochemical studies confirm that R347H (18.Geller D.H. Auchus R.J. Mendonça B.B. Miller W.L. Nat. Genet. 1997; 17: 201-205Crossref PubMed Scopus (261) Google Scholar) or R347C (19.Van Den Akker E.L. Koper J.W. Boehmer A.L. Themmen A.P. Verhoef-Post M. Timmerman M.A. Otten B.J. Drop S.L. De Jong F.H. J. Clin. Endocrinol. Metab. 2002; 87: 5714-5721Crossref PubMed Scopus (105) Google Scholar) and R358Q (18.Geller D.H. Auchus R.J. Mendonça B.B. Miller W.L. Nat. Genet. 1997; 17: 201-205Crossref PubMed Scopus (261) Google Scholar) are responsible for the clinical phenotype. In these subjects, 17-hydroxysteroid production is relatively normal, but the ratio of 17-hydroxysteroid precursors to C19 steroid products is elevated, indicating a deficiency in 17,20-lyase activity. Enzyme assays in transfected COS-1 cells and in yeast microsomes (20.Geller D.H. Auchus R.J. Miller W.L. Mol. Endocrinol. 1999; 13: 167-175Crossref PubMed Scopus (141) Google Scholar) demonstrate that these mutations retain most 17α-hydroxylase activity, but DHEA and androstenedione formation via 17,20-lyase reactions is barely detectable, even in the presence of cytochrome b5. Consistent with the known dependence of the 17,20-lyase reaction on CPR and cytochrome b5, mutations R347H, R347C, and R358Q neutralize positive charges in the redox partner-binding site of CYP17 (18.Geller D.H. Auchus R.J. Mendonça B.B. Miller W.L. Nat. Genet. 1997; 17: 201-205Crossref PubMed Scopus (261) Google Scholar, 21.Auchus R.J. Miller W.L. Mol. Endocrinol. 1999; 13: 1169-1182Crossref PubMed Google Scholar), and these mutations disrupt interactions of CYP17 with CPR and cytochrome b5 (20.Geller D.H. Auchus R.J. Miller W.L. Mol. Endocrinol. 1999; 13: 167-175Crossref PubMed Scopus (141) Google Scholar). Other mutations suspected of causing ILD that do not map to the redox partner-binding site have been found to be deficient in all activities rather than selectively deficient in 17,20-lyase activity (22.Yanase T. Waterman M.R. Zachmann M. Winter J.S.D. Simpson E.R. Kagimoto M. Biochim. Biophys. Acta. 1992; 1139: 275-279Crossref PubMed Scopus (53) Google Scholar, 23.Gupta M.K. Geller D.H. Auchus R.J. J. Clin. Endocrinol. Metab. 2001; 86: 4416-4423Crossref PubMed Scopus (45) Google Scholar). Herein, we describe a subject with ILD whose CYP17 mutation maps to the active site and causes ILD by a novel mechanism. Genomic PCR and Sequencing—After obtaining informed consent, blood was obtained for isolation of lymphocyte DNA using the High Pure DNA isolation kit (Roche Applied Science, Basel, Switzerland). The 6.4-kb CYP17 gene (24.Chung B.C. Picado-Leonard J. Haniu M. Bienkowski M. Hall P.F. Shively J.E. Miller W.L. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 407-411Crossref PubMed Scopus (415) Google Scholar) was amplified by PCR using primer pairs c17geneS1a + I4AS1 and I3S1 + c17geneAS1 (see Table I) to amplify the 5′- and 3′-halves, respectively (25.Costa-Santos M. Auchus R.J. Kater C.E. J. Clin. Endocrinol. Metab. 2003; (in press)Google Scholar). Each PCR contained 1 μg of DNA, 50 pmol of each primer, 200 μm dNTPs, 1.5 μl of dimethyl sulfoxide, and 2 units of ExTaq polymerase (PanVera, Madison, WI) in a total volume of 50 μl of the manufacturer's buffer. The following PCR conditions were employed: 94 °C for 3 min, followed by 41 cycles at 65 °C for 1 min, 70 °C for 3 min, and 95 °C for 30 s and a final annealing/extension cycle at 65 °C for 1 min and 70 °C for 5 min. The resulting PCR products were precipitated with ethanol and 0.3 m sodium acetate, purified on a 1% agarose gel, and isolated using the QIAEX-II gel extraction kit (QIAGEN Inc., Valencia, CA). The exons and flanking intronic segments of the amplicons were directly sequenced as described (25.Costa-Santos M. Auchus R.J. Kater C.E. J. Clin. Endocrinol. Metab. 2003; (in press)Google Scholar). For the other kindred members analyzed, PCR amplification of only exons 4 and 5 of the CYP17 gene was performed as described above using primers I3S1 and I5AS, except that extension parameters were 2 min at 70 °C. Exon 5 of the CYP17 amplicons was sequenced using primer I4S.Table IOligonucleotide primersPrimerSequenceaRestriction sites and mutagenic codons are underlined.c17geneS1aCTCCACCGCTGTCTATCTTGCCTGCCI4AS1CCTACTATGTGCCAGGTTCTCTGCTTGI3S1GCTGGAGAAGCAAAATGGAAGAAGGGTGGc17geneAS1CTCTAAATCTGTGTTGTGGGGCCACI5ASAGAGATTGGGCTGGCTGGGGTCTAGI4SGAGTGTCACAGATGGGGCTCCTTCCT7GTAATACGACTCACTATAc17E305GS1CTGGCGTGGGGACCACCACCTCTGTTGc17E305GAS1GTGGTGGTCCCCACGCCAGCCCCAAAGpLWAS1TCAGCAAAAAACCCCTCAAGACCCGYred5′/5′CGCGGCCGCATCTACAGTCCACCTGYred5′/3′CGGATCCGTGTTGTCTATTCCAAACGGYred3′/5′CCAAGCTTCCAAGAAGATGTCTGGTAATCAGYred3′/3′CCAGATCTTAAAGGCCGGCAAAGCAATGGGYRED 5′U4TTGCTACTGTGCTTTCGAGCGCCGACpPGKAS2GGATGGGGAGGGATCAATTGTGACGa Restriction sites and mutagenic codons are underlined. Open table in a new tab Site-directed Mutagenesis—Mutation E305G was introduced into the CYP17 cDNA by sequential PCR using overlapping mutagenic oligonucleotides (23.Gupta M.K. Geller D.H. Auchus R.J. J. Clin. Endocrinol. Metab. 2001; 86: 4416-4423Crossref PubMed Scopus (45) Google Scholar). Two separate PCRs utilized primer pair T7 + c17E305GAS1 or c17E305GS1 + pLWAS1 in addition to plasmid pLW01-c17 as a template, 1.25 units of ExTaq polymerase, and 200 μm dNTPs in a total volume of 50 μl of the manufacturer's buffer. The PCR cycling conditions were as follows: 94 °C for 3 min, followed by 26 cycles at 50 °C for 30 s, 72 °C for 1.5 min, and 94 °C for 1 min and a final annealing/extension cycle at 50 °C for 30 s and 72 °C for 4 min. Aliquots of these reactions were diluted 1:10, and 1 μl of each dilution was combined and used as a template in a third reaction to construct a full-length mutated cDNA using primers T7 and pLWAS1 and the same conditions used for the first two PCRs. The resulting amplicon was gel-purified, digested with BamHI and EcoRI, gel-purified again, and ligated into the BamHI/EcoRI sites of the mammalian expression vector pcDNA3 (Invitrogen). The inserts from several positive colonies were sequenced in their entirety to ensure that only the desired nucleotide substitution was incorporated, 2A silent change of one base (GTT for GTG) was inadvertently introduced by oligonucleotide c17E305GS1 at Leu310. affording plasmid pcDNA3-c17E305G. A subsequent BamHI/EcoRI digestion released the E305G cDNA insert, which was gel-purified and subcloned into the BamHI/EcoRI sites of the yeast expression vector V60 (26.Pompon D. Louerat B. Bronine A. Urban P. Methods Enzymol. 1996; 272: 51-64Crossref PubMed Google Scholar), yielding V60-c17E305G. Wild-type vectors pcDNA3-c17 (23.Gupta M.K. Geller D.H. Auchus R.J. J. Clin. Endocrinol. Metab. 2001; 86: 4416-4423Crossref PubMed Scopus (45) Google Scholar) and V60-c17 (27.Auchus R.J. Kumar A.S. Boswell C.A. Gupta M.K. Bruce K. Rath N.P. Covey D.F. Arch. Biochem. Biophys. 2003; 409: 134-144Crossref PubMed Scopus (38) Google Scholar) were described previously. Transformation and Steroid Metabolism in HEK-293 Cells—HEK-293 cells were grown in T-75 flasks with Dulbecco's modified Eagle's medium containing 0.584 g/liter glutamine, 10% fetal bovine serum, 100 IU/ml penicillin, and 0.1 mg/ml streptomycin (Cellgro, Mediatech, Inc., Herndon, VA) and transfected with the FuGENE 6 reagent (Roche Applied Science) as previously described for COS-7 cells (23.Gupta M.K. Geller D.H. Auchus R.J. J. Clin. Endocrinol. Metab. 2001; 86: 4416-4423Crossref PubMed Scopus (45) Google Scholar). Cells were seeded to 60–80% confluency in 6-well plates and transfected with 1 μg/well plasmid pcDNA3 or 2 μg of plasmid for incubations with 17α-hydroxyprogesterone. The next day, all but 0.5 ml of medium was removed from each well and replaced with 3 ml of fresh medium containing the indicated steroid (60,000 cpm/ml) plus unlabeled steroid to give a final concentration of 0.1 μm. Aliquots (1 ml) were removed at 2, 4, or 8 h; extracted; separated by thin-layer chromatography; and visualized as described (7.Lin D. Black S.M. Nagahama Y. Miller W.L. Endocrinology. 1993; 132: 2498-2506Crossref PubMed Google Scholar). Generation of Yeast Strain YiV(B)—Genomic DNA was isolated from Saccharomyces cerevisiae strain W303B by disruption with glass beads (28.Guthrie C. Fink G.R. Methods Enzymol. 1991; 194: 319-329Crossref PubMed Scopus (124) Google Scholar). DNA fragments homologous to segments in the 5′- and 3′-ends of the yeast NCP1 gene (homolog of the human CPR gene) were generated by PCR using oligonucleotides Yred5′/5′ + Yred5′/3′ (Not-Bam-5′) and Yred3′/5′ + Yred3′/3′ (Hind-Bgl-3′). PCRs contained 1 μg of DNA, 100 pmol of each primer, 200 μm dNTPs, 2 mm MgCl2, 1.5 μl of dimethyl sulfoxide, and 2.5 units of Taq polymerase (Promega, Madison, WI) in a 50-μl total reaction volume. Thermocycling conditions were at follows: 94 °C for 3 min, followed by 40 cycles at 55 °C for 30 s, 72 °C for 1 min, and 94 °C for 1 min and a final annealing/extension cycle at 55 °C for 30 s and 72 °C for 3 min. These amplicons of 560 and 390 bp, respectively, were gel-purified, cloned into vector pGEM-T (Promega) using the A-overhang method, and sequenced. The Hind-Bgl-3′ fragment was excised by digestion with HindIII and BglII and ligated into the HindIII and BglII sites of vector pLW01, yielding vector pLW01–3′. The Not-Bam-5′ fragment was excised with NotI and BamHI and ligated into the corresponding sites in vector pcDNA3 to acquire the convenient adjacent restriction sites HindIII (3′) and XhoI (5′) from the vector (pcDNA3–5′). An extended Not-Bam-5′ fragment was excised from vector pcDNA3–5′ with XhoI and HindIII and ligated into LW01–3′ digested with XhoI and HindIII, yielding vector pLW01–5′3′. A cassette containing the yeast phosphoglycerate kinase promoter, the human CPR cDNA with modified early codons to improve expression, and the yeast phosphoglycerate kinase terminator was excised from vector V10-OR (3.Auchus R.J. Lee T.C. Miller W.L. J. Biol. Chem. 1998; 273: 3158-3165Abstract Full Text Full Text PDF PubMed Scopus (481) Google Scholar) with BamHI and HindIII and ligated into vector pLW01–5′3′ digested with BamHI and HindIII, yielding vector pLW01–5′-CPR-3′. Finally, the yeast ura3 gene, flanked by hisG repeats (which enhance homologous recombination), was excised from vector pYNK51 (29.Alani E. Cao L. Kleckner N. Genetics. 1987; 116: 541-545Crossref PubMed Scopus (752) Google Scholar) as a BamHI/BglII fragment and ligated into the BamHI site, located between the yeast Not-Bam-5′ fragment and the CPR cassette, of vector pLW01–5′-CPR-3′, yielding the final targeting vector pLW01-YiV. Vector pLW01-YiV (2 μg) was linearized with XhoI and used to transform 108 cells of strain W303B, and clones were selected and restreaked on uracil-deficient minimal medium (1.7 g/liter Difco yeast nitrogen base (BD Biosciences), 5 g/liter ammonium sulfate, 20 g/liter glucose, 2% agar supplemented with 40 mg/liter l-tryptophan, 40 mg/liter adenine hemisulfate, 60 mg/liter l-leucine, and 20 mg/liter l-histidine). Several colonies were restreaked on YPD medium (10 g/liter yeast extract, 10 g/liter peptone, 20 g/liter dextrose, and 2% agar) then finally streaked onto minimal medium plates containing the above nutrients plus 50 mg/liter uracil and 750 mg/liter 5-fluoroorotic acid, yielding a small number of clones with the ura3 gene deleted. Genomic DNA was isolated from several clones to confirm that homologous recombination had occurred, as shown by a 1.9-kb PCR fragment from the phosphoglycerate kinase promoter to sequences farther 5′ of the targeting construct on yeast chromosome 8 (primers YRED 5′U4 and pPGKAS2) (Table I). One positive clone, named YiV(B), was propagated on YPD medium and used for transformation and expression. Strain engineering is schematized in Fig. 2. Yeast Transformation, Microsome Preparation, and Enzyme Assays—S. cerevisiae strains YiV(B) and W303B were transformed with 1 μg of plasmid V60 (26.Pompon D. Louerat B. Bronine A. Urban P. Methods Enzymol. 1996; 272: 51-64Crossref PubMed Google Scholar) containing the cDNA for either wild-type CYP17 or mutation E305G as described (23.Gupta M.K. Geller D.H. Auchus R.J. J. Clin. Endocrinol. Metab. 2001; 86: 4416-4423Crossref PubMed Scopus (45) Google Scholar). Transformants were selected on minimal medium plates as described above. For microsome preparation, 2-ml precultures of liquid minimal medium with supplements were inoculated with YiV(B) yeast transformed with either V60-c17 or V60-c17E305G and shaken at 30 °C overnight. The following morning, the 2-ml preculture was added to 10 ml of the same medium and grown for 10 h, at which time a flask containing 500 ml of 10 g/liter yeast extract, 10 g/liter peptone, 5 g/liter glucose, and 3% ethanol was inoculated with the 10-h culture. This culture was grown for 24 h at 30 °C, induced by addition of 60 ml of 200 g/liter galactose, and allowed to grow overnight. Cells were harvested by centrifugation at 3000 × g for 5 min; resuspended in 10 ml of 50 mm Tris-HCl (pH 8), 1 mm EDTA, and 0.1 m KCl; and centrifuged again. The cell pellet was resuspended in TES buffer (50 mm Tris-HCl (pH 8), 1 mm EDTA, and 0.6 m sorbitol) to a total volume of 20 ml and added to 20 g of glass beads (425–600 μm) in the small chamber of a BeadBeater (Biospec Products, Inc., Bartlesville, OK) with 100 μl of protease inhibitor mixture for fungal/yeast cultures (Sigma). The chamber was thoroughly chilled, and cells were disrupted by pulsing three times for 1 min with several minutes of icing between pulses. The homogenate was transferred to a 50-ml centrifuge bottle. The beads were then washed with 10 ml of TES buffer, which was then added to the initial homogenate. The combined suspension was centrifuged twice at 10,000 × g, and the final supernatant was centrifuged at 100,000 × g for 45 min. Microsomes were prepared by resuspending the pellet in 1 ml of 50 mm Tris-HCl (pH 8), 1 mm EDTA, and 20% glycerol and shearing through a 27-gauge needle. Quantitation of microsomal cytochrome P450 and protein content, incubations with radiolabeled steroids, steroid extraction, and chromatography were performed as described (3.Auchus R.J. Lee T.C. Miller W.L. J. Biol. Chem. 1998; 273: 3158-3165Abstract Full Text Full Text PDF PubMed Scopus (481) Google Scholar). For incubations with purified recombinant human cytochrome b5 (PanVera), microsomes were preincubated for 2 min at 37 °C with 30 molar eq of cytochrome b5 and 0.6 μm steroid prior to addition of NADPH to start the reaction. The kinetic constants Km(app) and Vmax were calculated from iterative hyperbolic fits of the data to the Michaelis-Menten equation (v = Vmax·[S]/(Km + [S])) using Origin Version 6.0 (OriginLab Corp., Northampton, MA). Because kinetic data from experiments in the presence of competitive inhibitors encompass only the linear portions of the v versus [S] plots, hyperbolic curves cannot be fit to the data; consequently, KI(app) values were obtained from constants derived from least-squares fits to Lineweaver-Burk plots as described (27.Auchus R.J. Kumar A.S. Boswell C.A. Gupta M.K. Bruce K. Rath N.P. Covey D.F. Arch. Biochem. Biophys. 2003; 409: 134-144Crossref PubMed Scopus (38) Google Scholar). Turnover experiments with hydrogen peroxide and cumene hydroperoxide (Sigma) were performed with 1 pmol of cytochrome P450, 2 pmol of [3H]progesterone, and 10 μm oxidant in 200 μl as described (21.Auchus R.J. Miller W.L. Mol. Endocrinol. 1999; 13: 1169-1182Crossref PubMed Google Scholar). Spectral binding constants (KS) were obtained from titration curves in intact W303B cells expressing wild-type CYP17 or the E305G mutation (27.Auchus R.J. Kumar A.S. Boswell C.A. Gupta M.K. Bruce K. Rath N.P. Covey D.F. Arch. Biochem. Biophys. 2003; 409: 134-144Crossref PubMed Scopus (38) Google Scholar). Miscellaneous—Reagents and chemicals were purchased from either Fisher or Sigma except as noted, and restriction enzymes and DNA ligase were purchased from New England Biolabs Inc. (Beverly, MA). 3H-Labeled pregnenolone, 17α-hydroxypregnenolone, and progesterone (45–65 Ci/mmol) were purchased from PerkinElmer Life Sciences, and 3H-labeled 17α-hydroxyprogesterone (50 Ci/mmol) was purchased from American Radiolabeled Chemicals (St. Louis, MO). Oligonucleotides were purchased from Integrated DNA Technologies, Inc. (Coralville, IA). DNA sequencing employed the dye termination method with PE Applied Biosystems instruments at the University of Texas Southwestern McDermott Center Sequencing Center. Autoradiography was performed by exposing X-Omat Blue film (Eastman Kodak Co.) to TLC plates saturated with EN3HANCE spray (PerkinElmer Life Sciences). Clinical Presentation of the Index Case and Genetic Analysis—The subject presented at age 15 for evaluation of gynecomastia. The pregnancy was uncomplicated, and the parents were first cousins. Hypospadias and micropenis were noted at birth, and the hypospadias was surgically repaired at age 4. Physical examination showed Tanner stage 4 breasts and pubic hair, normal (15–20 ml) testes, and a small (3 cm) phallus. Electrolytes and plasma renin activity were normal. Basal and stimulated hormone values are listed in Table II. The combination of elevated gonadotropins, low testosterone, and extremely low DHEA sulfate suggested a defect in CYP17, which is required for the conversion of C21 steroids to C19 steroids in both the adrenal glands and gonads (24.Chung B.C. Picado-Leonard J. Haniu M. Bienkowski M. Hall P.F. Shively J.E. Miller W.L. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 407-411Crossref PubMed Scopus (415) Google Scholar). Unlike classical 17-hydroxylase deficiency, however, circulating concentrations of most 17-hydroxysteroids were elevated, suggesting selective impairment of 17,20-lyase activity (ILD). Amplification and direct sequencing of all the exons of the CYP17 gene from this subject showed a homozygous GAG-to-GGG missense mutation at codon 305 in exon 5 (data not shown). This mutation substitutes a glycine for the highly conserved glutamate at this position, which resides within the active-site pocket.Table IIHormone values for index caseHormoneBasal value (normal)aAll values are expressed in nmol/liter, except luteinizing and follicle-stimulating hormones, which are expressed in iu/liter.Post-ACTH1-24 (normal)bACTH, adrenocorticotropic hormone.Luteinizing hormone19.5 (2-10)Follicle-stimulating hormone12.9 (1-6)Cortisol128 (150-500)305 (>500)11-Deoxycortisol8.4 (0.4-5)9.1 (>5)17α-Hydroxyprogesterone6.2 (1-6)6.4 (>6)DHEA sulfate220 (2700-10,000)Testosterone1.4-2.6 (7-21)Estradiol0.15 (0.04-0.13)Aldosterone0.2 (0.1-1)a All values are expressed in nmol/liter, except luteinizing and follicle-stimulating hormones, which are expressed in iu/liter.b ACTH, adrenocorticotropic hormone. Open table in a new tab Enzyme Activity in Transfected HEK-293 Cells—To confirm that the CYP17 mutation alone explains the clinical and laboratory data, E305G was introduced into the CYP17 cDNA, and the mutation was expressed in HEK-293 cells. Cells expressing mutation E305G metabolized progesterone approximately the same as those expressing wild-type CYP17, except that the mutation appeared to produce more androstenedione compared with the wild-type enzyme (Fig. 3A, left). Androstenedione synthesis by E305G also moderately exceeded that by wild-type CYP17 when 17α-[3H]hydroxyprogesterone was added to the medium (Fig. 3A, right). Thus, when expressed in HEK-293 cells with endogenous redox partners, steroid metabolism by mutation E305G in the Δ4-steroid pathway was equivalent (if not superior) to metabolism by wild-type CYP17. In contrast, pregnenolone metabolism experiments qualitatively revealed the enzymatic defect in mutation E305G. Cells expressing wild-type CYP17 converted pregnenolone to 17α-hydroxypregnenolone, and a substantial amount of the 17α-hydroxypregnenolone intermediate was further metabolized to DHEA, which is the 17,20-lyase product in the preferred Δ5-steroid pathway for human CYP17 (Fig. 3B, left). Cells expressing mutation E305G converted pregnenolone to 17α-hydroxypregnenolone about as well as cells expressing wild-type CYP17, but no DHEA was formed during prolonged incubations (Fig. 3B, left). When [3H]17α-hydroxypregnenolone was added to the medium, cells expressing wild-type CYP17 converted half of this substrate to DHEA after 8 h, but cells expressing mutation E305G produced no detectable DHEA (Fig. 3B, right). These data suggest that mutation E305G has selectively lost the capacity to cleave 17α-hydroxypregnenolone to DHEA, whereas all other assayed activities are normal, if not enhanced. However, these experiments do not reveal the mechanisms responsible for this unique change in activity profile. Steroid Metabolism in Yeast Microsomes Containing CYP17 and Mutation E305G—To measure kinetic constants for the individual reactions, we expressed wild-type CYP17 and mutation E305G in S. cerevisiae. Microsomes from transformed yeast are a versatile and consistent source of native CYP17 for enzyme assays (3.Auchus R.J. Lee T.C. Miller W.L. J. Biol. Chem. 1998; 273: 3158-3165Abstract Full Text Full Text PDF PubMed Scopus (481) Google Scholar). The 17,20-lyase activity of CYP17 is very dependent on the abundance of redox partners, and previous studies of human CYP17 in yeast incorporated cotransformation with a second plasmid for the expression of human CPR (3.Auchus R.J. Lee T.C. Miller W.L. J. Biol. Chem. 1998; 273: 3158-3165Abstract Full Text Full Text PDF PubMed Scopus (481) Google Scholar, 30.Arlt W. Martens J.W. Song M. Wang J.T. Auchus R.J. Miller W.L. Endocrinology. 2002; 143: 4665-4672Crossref PubMed Scopus (88) Google Scholar). However, this approach precludes the use of inducible expression vectors for CYP17 and leaves some uncertainty that CPR plasmid amplification and thus CPR expression may vary among yeast clones and cultures, potentially complicating comparisons of 17,20-lyase activity. To increase the expression of CYP17 and to afford more consistent coexpression of human CPR, we engineered yeast str" @default.
• W2079050871 created "2016-06-24" @default.
• W2079050871 creator A5029707943 @default.
• W2079050871 creator A5045828711 @default.
• W2079050871 creator A5047143883 @default.
• W2079050871 creator A5055037280 @default.
• W2079050871 creator A5057071433 @default.
• W2079050871 date "2003-12-01" @default.
• W2079050871 modified "2023-10-17" @default.
• W2079050871 title "CYP17 Mutation E305G Causes Isolated 17,20-Lyase Deficiency by Selectively Altering Substrate Binding" @default.
• W2079050871 cites W1016749220 @default.
• W2079050871 cites W1498652161 @default.
• W2079050871 cites W1515404266 @default.
• W2079050871 cites W1529636312 @default.
• W2079050871 cites W1540622966 @default.
• W2079050871 cites W1548619243 @default.
• W2079050871 cites W1563481840 @default.
• W2079050871 cites W1580057573 @default.
• W2079050871 cites W1891933871 @default.
• W2079050871 cites W1927579840 @default.
• W2079050871 cites W1963545612 @default.
• W2079050871 cites W1974004653 @default.
• W2079050871 cites W1979975835 @default.
• W2079050871 cites W1985280444 @default.
• W2079050871 cites W1986232120 @default.
• W2079050871 cites W1989300914 @default.
• W2079050871 cites W1995421298 @default.
• W2079050871 cites W1995802297 @default.
• W2079050871 cites W2002511916 @default.
• W2079050871 cites W2007321993 @default.
• W2079050871 cites W2008053811 @default.
• W2079050871 cites W2010143253 @default.
• W2079050871 cites W2032124099 @default.
• W2079050871 cites W2034176443 @default.
• W2079050871 cites W2049916785 @default.
• W2079050871 cites W2053012453 @default.
• W2079050871 cites W2056097417 @default.
• W2079050871 cites W2059850722 @default.
• W2079050871 cites W2080038277 @default.
• W2079050871 cites W2103133230 @default.
• W2079050871 cites W2107264018 @default.
• W2079050871 cites W2115296460 @default.
• W2079050871 cites W2126123126 @default.
• W2079050871 cites W2126733133 @default.
• W2079050871 cites W2129876849 @default.
• W2079050871 cites W2142886860 @default.
• W2079050871 cites W2157020561 @default.
• W2079050871 cites W2164097694 @default.
• W2079050871 cites W4254536048 @default.
• W2079050871 doi "https://doi.org/10.1074/jbc.m307586200" @default.
• W2079050871 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/14504283" @default.
• W2079050871 hasPublicationYear "2003" @default.
• W2079050871 type Work @default.
• W2079050871 sameAs 2079050871 @default.
• W2079050871 citedByCount "115" @default.
• W2079050871 countsByYear W20790508712012 @default.
• W2079050871 countsByYear W20790508712013 @default.
• W2079050871 countsByYear W20790508712014 @default.
• W2079050871 countsByYear W20790508712015 @default.
• W2079050871 countsByYear W20790508712016 @default.
• W2079050871 countsByYear W20790508712017 @default.
• W2079050871 countsByYear W20790508712018 @default.
• W2079050871 countsByYear W20790508712019 @default.
• W2079050871 countsByYear W20790508712020 @default.
• W2079050871 countsByYear W20790508712021 @default.
• W2079050871 countsByYear W20790508712022 @default.
• W2079050871 countsByYear W20790508712023 @default.
• W2079050871 crossrefType "journal-article" @default.
• W2079050871 hasAuthorship W2079050871A5029707943 @default.
• W2079050871 hasAuthorship W2079050871A5045828711 @default.
• W2079050871 hasAuthorship W2079050871A5047143883 @default.
• W2079050871 hasAuthorship W2079050871A5055037280 @default.
• W2079050871 hasAuthorship W2079050871A5057071433 @default.
• W2079050871 hasBestOaLocation W20790508711 @default.
• W2079050871 hasConcept C104317684 @default.
• W2079050871 hasConcept C185592680 @default.
• W2079050871 hasConcept C18903297 @default.
• W2079050871 hasConcept C2777289219 @default.
• W2079050871 hasConcept C501734568 @default.
• W2079050871 hasConcept C55493867 @default.
• W2079050871 hasConcept C71240020 @default.
• W2079050871 hasConcept C86803240 @default.
• W2079050871 hasConceptScore W2079050871C104317684 @default.
• W2079050871 hasConceptScore W2079050871C185592680 @default.
• W2079050871 hasConceptScore W2079050871C18903297 @default.
• W2079050871 hasConceptScore W2079050871C2777289219 @default.
• W2079050871 hasConceptScore W2079050871C501734568 @default.
• W2079050871 hasConceptScore W2079050871C55493867 @default.
• W2079050871 hasConceptScore W2079050871C71240020 @default.
• W2079050871 hasConceptScore W2079050871C86803240 @default.
• W2079050871 hasIssue "49" @default.
• W2079050871 hasLocation W20790508711 @default.
• W2079050871 hasOpenAccess W2079050871 @default.
• W2079050871 hasPrimaryLocation W20790508711 @default.
• W2079050871 hasRelatedWork W1990066813 @default.
• W2079050871 hasRelatedWork W2010090914 @default.
• W2079050871 hasRelatedWork W2039296773 @default.
• W2079050871 hasRelatedWork W2057781129 @default.

• next