FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2079183583> ?p ?o ?g. }

• W2079183583 endingPage "15129" @default.
• W2079183583 startingPage "15124" @default.
• W2079183583 abstract "Cytosine-phosphate-guanine (CpG) motifs in bacterial DNA are known to activate the mammalian immune system, and this activation is thought to depend on the Toll-like receptor 9 (TLR9) signaling pathway. Previous studies strongly suggested that TLR9 is involved as the specific receptor for CpG motifs but did not provide direct evidence of their interaction. In this study, we demonstrate for the first time that murine TLR9 binds an unmethylated CpG-containing plasmid. This interaction is sequence-specific and is influenced by the methylation status of the plasmid. Furthermore, we demonstrate that this interaction leads to the activation of the NF-κB pathway in mTLR9-expressing cells. Our results provide a molecular basis for the interaction between CpG-DNA and TLR9. Cytosine-phosphate-guanine (CpG) motifs in bacterial DNA are known to activate the mammalian immune system, and this activation is thought to depend on the Toll-like receptor 9 (TLR9) signaling pathway. Previous studies strongly suggested that TLR9 is involved as the specific receptor for CpG motifs but did not provide direct evidence of their interaction. In this study, we demonstrate for the first time that murine TLR9 binds an unmethylated CpG-containing plasmid. This interaction is sequence-specific and is influenced by the methylation status of the plasmid. Furthermore, we demonstrate that this interaction leads to the activation of the NF-κB pathway in mTLR9-expressing cells. Our results provide a molecular basis for the interaction between CpG-DNA and TLR9. The recognition of pathogens by the mammalian immune system is a key step in the initiation of the immune response, and the toll-like-receptor (TLR) 1The abbreviations used are: TLR, toll-like-receptor; CpG, cytosine-phosphate-guanine; NF-κB, nuclear factor-κB; LPS, lipopolysaccharide; ODN, oligodeoxyribonucleotide; IRAK, IL-1 receptor-associated kinase; HEK293, human embryonic kidney; CAT, chloramphenicol acetyl transferase; RU, resonance units; TRAF-6, tumor necrosis factor receptor-associated factor-6. 1The abbreviations used are: TLR, toll-like-receptor; CpG, cytosine-phosphate-guanine; NF-κB, nuclear factor-κB; LPS, lipopolysaccharide; ODN, oligodeoxyribonucleotide; IRAK, IL-1 receptor-associated kinase; HEK293, human embryonic kidney; CAT, chloramphenicol acetyl transferase; RU, resonance units; TRAF-6, tumor necrosis factor receptor-associated factor-6. family is an essential component of this process (1Aderem A. Ulevitch R.J. Nature. 2000; 406: 782-787Crossref PubMed Scopus (2603) Google Scholar, 2Ulevitch R.J. Nature. 1999; 401: 755-756Crossref PubMed Scopus (60) Google Scholar). In humans, ten TLRs (TLR1–10) have been identified (1Aderem A. Ulevitch R.J. Nature. 2000; 406: 782-787Crossref PubMed Scopus (2603) Google Scholar, 3Chuang T. Ulevitch R.J. Biochim. Biophys. Acta. 2001; 1518: 157-161Crossref PubMed Scopus (319) Google Scholar). Among these, TLR4 is involved in the recognition of lipopolysaccharide (LPS) from Gram-negative bacteria, TLR2 detects a variety of cell wall components, TLR6 in association with TLR2 senses lipoproteins, and TLR5 recognizes flagellin (4Poltorak A. He X. Smirnova I. Liu M.Y. Van Huffel C. Du X. Birdwell D. Alejos E. Silva M. Galanos C. Freudenberg M. Ricciardi-Castagnoli P. Layton B. Beutler B. Science. 1998; 282: 2085-2088Crossref PubMed Scopus (6382) Google Scholar, 5Takeuchi O. Hoshino K. Kawai T. Sanjo H. Takada H. Ogawa T. Takeda K. Akira S. Immunity. 1999; 11: 443-451Abstract Full Text Full Text PDF PubMed Scopus (2759) Google Scholar, 6Yang R.B. Mark M.R. Gray A. Huang A. Xie M.H. Zhang M. Goddard A. Wood W.I. Gurney A.L. Godowski P.J. Nature. 1998; 395: 284-288Crossref PubMed Scopus (1098) Google Scholar, 7Yoshimura A. Lien E. Ingalls R.R. Tuomanen E. Dziarski R. Golenbock D. J. Immunol. 1999; 163: 1-5PubMed Google Scholar, 8Means T.K. Wang S. Lien E. Yoshimura A. Golenbock D.T. Fenton M.J. J. Immunol. 1999; 163: 3920-3927PubMed Google Scholar, 9Brightbill H.D. Libraty D.H. Krutzik S.R. Yang R.B. Belisle J.T. Bleharski J.R. Maitland M. Norgard M.V. Plevy S.E. Smale S.T. Brennan P.J. Bloom B.R. Godowski P.J. Modlin R.L. Science. 1999; 285: 732-736Crossref PubMed Scopus (1400) Google Scholar, 10Underhill D.M. Ozinsky A. Hajjar A.M. Stevens A. Wilson C.B. Bassetti M. Aderem A. Nature. 1999; 401: 811-815Crossref PubMed Scopus (1187) Google Scholar, 11Hayashi F. Smith K.D. Ozinsky A. Hawn T.R. Yi E.C. Goodlett D.R. Eng J.K. Akira S. Underhill D.M. Aderem A. Nature. 2001; 410: 1099-1103Crossref PubMed Scopus (2766) Google Scholar). Members of the TLR family have some common features: they are transmembrane proteins with a large extracellular domain containing several leucine-rich repeats and a cytoplasmic Toll/IL-1-receptor domain. In general, activation through the Toll/IL-1-receptor domain involves the MyD88-dependent interleukin 1 receptor-TLR signaling pathway which leads to the activation of nuclear factor-κB (NF-κB) (12Muzio M. Polntarutti N. Bosisio D. Prahladan M.K. Mantovani A. Eur. Cytokine Network. 2000; 11: 489-490PubMed Google Scholar, 13Daun J.M. Fenton M.J. J. Interferon Cytokine Res. 2000; 20: 843-855Crossref PubMed Scopus (66) Google Scholar, 14Anderson K.V. Curr. Opin. Immunol. 2000; 12: 13-19Crossref PubMed Scopus (519) Google Scholar).Bacterial DNA is a potent stimulus for immune cells. This stimulatory activity is due to a sequence motif containing unmethylated CpG deoxyribonucleotides, the methylation status being a crucial distinction between bacterial and mammalian DNA (15Yamamoto S. Yamamoto T. Tokunaga T. Curr. Top. Microbiol. Immunol. 2000; 247: 23-39PubMed Google Scholar, 16Krieg A.M. Hartmann G. Yi A.K. Curr. Top. Microbiol. Immunol. 2000; 247: 1-21Crossref PubMed Google Scholar, 17Wagner H. Adv. Immunol. 1999; 73: 329-368Crossref PubMed Google Scholar, 18Pisetsky D.S. Springer Semin. Immunopathol. 2000; 22: 21-33Crossref PubMed Scopus (30) Google Scholar). Unmethylated oligodeoxyribonucleotides (ODN) including a CpG motif (CpG-ODN) can mimic the effects of bacterial DNA, inducing B-cell proliferation and activating cells of the myeloid lineage (dendritic cells; Refs. 19Messina J.P. Gilkeson G.S. Pisetsky D.S. J. Immunol. 1991; 147: 1759-1764PubMed Google Scholar, 20Krieg A.M. Yi A.-K. Matson S. Waldschmidt T.J. Bishop G.A. Teadale R. Koretzky G.A. Klinmann D.M. Nature. 1995; 374: 546-549Crossref PubMed Scopus (3071) Google Scholar, 21Yi A.-K. Krieg A.M. J. Immunol. 1998; 160: 1240-1245PubMed Google Scholar, 22Stacey K.J. Sweet M.J. Hume D.A. J. Immunol. 1996; 157: 2116-2122PubMed Google Scholar, 23Sparwasser T. Miethke T. Lipford G. Erdmann A. Heeg K. Wagner H. Eur. J. Immunol. 1997; 27: 1671-1679Crossref PubMed Scopus (367) Google Scholar, 24Jakob T. Walker P.S. Krieg A.M. Udey M.C. Vogel J.C. J. Immunol. 1998; 161: 3042-3049PubMed Google Scholar, 25Häcker H. Mischak H. Miethke T. Liptay S. Schmid R. Sparwasser T. Heeg K. Lipford G.B. Wagner H. EMBO J. 1998; 17: 6230-6240Crossref PubMed Scopus (584) Google Scholar, 26Sparwasser T. Koch E.-S. Vabulas R.M. Heeg K. Lipford G.B. Ellwart J.W. Wagner H. Eur. J. Immunol. 1998; 28: 2045-2054Crossref PubMed Scopus (698) Google Scholar). A molecular understanding of the cellular recognition of CpG-DNA is only now beginning to emerge. Indeed, it was first demonstrated by Hemmi et al. (27Hemmi H. Takeushi O. Kawai T. Kaisho T. Sato S.H.S. Matsumoto M. Hoshino K. Wagner H. Takeda K. Akira S. Nature. 2000; 408: 740-745Crossref PubMed Scopus (5310) Google Scholar) that TLR9 is involved in the signaling induced by synthetic CpG-ODN. Chuang et al. have established that the signaling cascade induced by CpG-ODN involves MyD88, IL-1 receptor-associated kinase (IRAK), and TRAF 6 (28Chuang T.-H. Lee J. Kline L. Mathison J.C. Ulvetich R.J. J. Leukocyte Biol. 2002; 71: 538-544PubMed Google Scholar). Moreover, several investigators have demonstrated that CpG motifs present in plasmid DNA could induce the activation of the immune response (29Sato Y. Roman M. Tighe H. Lee D. Corr M. Nguyen M.-D. Silverman G.J. Lotz M. Carson D.A. Raz E. Science. 1996; 273: 352-354Crossref PubMed Scopus (952) Google Scholar, 30Roman M. Martin-Orozco E. Goodman J.S. Ngyen M.-D. Sato Y. Ronaghy A. Kornbluth R.S. Richman D.D. Carson D.A. Raz E. Nat. Med. 1997; 3: 849-854Crossref PubMed Scopus (809) Google Scholar).In this paper, we demonstrate for the first time that a plasmid containing unmethylated CpG motifs physically binds to TLR9. This interaction is sequence-specific and depends on the methylation status of the CpG motifs. Furthermore, this interaction is sufficient to activate the NF-κB transcription factor.EXPERIMENTAL PROCEDURESCloning mTLR9 —The full-length mTLR9 was PCR-amplified from a mouse lung single-stranded cDNA library. Specific primers for amplification of mTLR9 were designed based on the GenBank™ accession number AF314224 (28Chuang T.-H. Lee J. Kline L. Mathison J.C. Ulvetich R.J. J. Leukocyte Biol. 2002; 71: 538-544PubMed Google Scholar). The forward primer was 5′-TCCTCCATCTCCCAACATggTTCTC, and the reverse primer sequence was 5′-TTCTgCTgTAGGTCCCCggCAgAAg. PCR was performed with 20 mm of platinum Taq polymerase (Invitrogen). The amplified full-length cDNA was subcloned into pCR4 containing the V5 and polyhistidine tags (Invitrogen) and sequenced.For expression in SF9 insect cells, mTLR9 was sub-cloned in the pIZT expression vector containing the V5 and poly-histidine tags (Invitrogen). This vector expressed the green fluorescent protein constitutively as a positive control of transfection.Cell Culture, NF-κB Reporter Assay, and Immunolocalization—Human embryonic kidney 293 (HEK293) cells were cultured in Dulbecco's modified Eagle's medium with Glutamax (Invitrogen, France) supplemented with 10% fetal bovine serum. The HEK293 cells were plated at 4 × 105 cells in six-well plates and transfected by Exgen (Euromedex, France) with 475 ng of mTLR9 expression vector plus 1 μg of NF-κB luciferase reporter plasmid (Stratagene, France). Twenty-four hours later, the cells were treated with indicated agonists for 6 h. The cells were lysed, and luciferase activity was determined using reagents from Promega Corp. Results were normalized according to the protein content measured by the BCA reagent (Pierce-Perbio, France). Results are expressed as fold induction compared with unstimulated controls, and the data presented are the mean ± S.E. (n = 3). To demonstrate that the mTLR9 was expressed on the cell surface, 4 × 105 HEK293 cells or SF9 cells were plated on six-well plates and transfected with 1 μg of mTLR9 DNA per well. Forty-eight hours later, cells were washed twice in phosphate-buffered saline and fixed in 4% paraformaldehyde. HEK293 cells were stained with anti-V5 antibody-fluorescein isothiocyanate antibody (Invitrogen) 1 h at room temperature, washed three times with phosphate-buffered saline, and incubated for a few minutes with phosphate-buffered saline plus 4′,6-diamidino-2-phenylindole for DNA staining. SF9 (Spodoptera frugiperda) cells were stained with anti-V5 as primary antibody and then with anti-mouse IgG phycoerythrin-conjugated antibody (Sigma).The insect cell line SF9 was used to produce large amounts of mTLR9 and was cultured in Grace insect cell medium (Invitrogen, France) supplemented with 10% fetal bovine serum and 5% glutamine. SF9 cells were transfected with Cellfectin (Invitrogen) at 50% of confluence with 25 μg of DNA per 75 cm2 flask. Forty-hours later, cells were centrifuged, and pellets were frozen for use in surface plasmon resonance experiments.Surface Plasmon Resonance—The Biacore 3000 instrument (Uppsala, Sweden) was used with an NTA sensor chip (nitriloacetic acid bound to a solid support). SPR buffers and solutions were as follows: eluent buffer (10 mm HEPES, 0.15 m NaCl, 50 μm EDTA, 0.005% surfactant P20, pH 7.4); nickel solution (500 μm NiCl2 in eluent buffer); and regeneration buffer (10 mm HEPES, 0.15 m NaCl, 350 mm EDTA, 0.005% surfactant P20, pH 8.3). Two flow cells were run in parallel: on the first one, irrelevant His-tagged chloramphenicol acetyl transferase (CAT) protein was immobilized to provide background corrections for nonspecific binding of plasmid on the chip surface; on the second one, His-tagged solubilized mTLR9 was immobilized for binding purposes. Runs were performed at 20 μl/min. After a 1-min injection of regeneration buffer followed by a 1-min injection of eluent buffer, the control His-tagged protein, and subsequently the His-tagged mTLR9, were immobilized on the two channels, respectively, by 2-min injections. The analytes (buffer or plasmid solutions) were then injected over the two channels for 5 min followed by a dissociation phase of 5 min. The sensorgrams were recorded and analyzed by BiaEvaluation 3 software (Biacore). For each set of experiments, sensorgrams obtained with the control channel (coated with CAT His-tagged protein) were subtracted from those obtained with the channel with the Toll-like receptor 9. If nonspecific binding to the tag histidine occurred, it was subtracted for the kinetic analysis. The resulting curve represents specific binding of the analytes on the TLR9. Signal from buffer was then subtracted from the signals obtained with the different plasmids.Reagents—pAIT2, the methylated CpG-containing plasmid, was kindly donated by New England Biolabs (Beverley, MA). The unmethylated plasmid was derived from pAIT2 by introducing a frameshift in the methylase gene. 2Cornelie, S., Poulain-Godefroy, D., Lund, C., Vendeville, C., Ban, E., Capron, M., and Riveau, G. (2004) Scan. J. Immunol. 59, 143–151. Both plasmids were produced with Endofree Gigaprep (Qiagen, France). The sequences of the bioactive CpG-ODN (TCCATGACGTTCCTGATGCT) and the control inverted GpC-ODN (TCCATGAGCTTCCTGATGCT) (Invitrogen) were selected from the previously published work of Sparwasser et al. (26Sparwasser T. Koch E.-S. Vabulas R.M. Heeg K. Lipford G.B. Ellwart J.W. Wagner H. Eur. J. Immunol. 1998; 28: 2045-2054Crossref PubMed Scopus (698) Google Scholar). Detection of endotoxins was achieved by using the limulus amebocyte lysate assay (Bio-Whittaker). The level of endotoxin detected was always <0.1 endotoxin unit/ml in all DNA preparation.RESULTSTLR9 Mediates CpG-ODN-induced NF-κB Activation— cDNA-encoding TLR9 (mTLR9) was isolated from a single-stranded cDNA library from mouse lung. This mTLR9 is identical to the GenBank™ accession number AF314224 and encodes a protein of 1032 amino acid residues, which share 77% identity to human TLR9 (as described by Chuang et al., Ref. 28Chuang T.-H. Lee J. Kline L. Mathison J.C. Ulvetich R.J. J. Leukocyte Biol. 2002; 71: 538-544PubMed Google Scholar). As expected, the sequence obtained contains all the structural features characteristic of other TLR family members and shares poor identity to TLR2 and TLR4 (28Chuang T.-H. Lee J. Kline L. Mathison J.C. Ulvetich R.J. J. Leukocyte Biol. 2002; 71: 538-544PubMed Google Scholar). We first verified that recombinant TLR9 localized to the plasma membrane of transfected cells. SF9 and HEK293 cells were transiently transfected with 1 μg of pIZT or pCR4 expression vector containing mTLR9 respectively. Cells were fixed and stained as described under “Experimental Procedures.” Expression of mTLR9 was detected in SF9 cells (Fig. 1a). pIZT plasmid encoding the green fluorescent protein was used as a positive control for the transfection (Fig 1b). Merging these two images indicates that mTLR9 was expressed on the plasma membrane of these cells. Membrane expression of mTLR9 was also verified in HEK293 cells (Fig. 1, lower panel). The consequence of membrane expression of mTLR9 on cell activation by CpG-ODN or a CpG-containing plasmid was investigated in HEK293 cells. We transiently cotransfected 4 × 105 cells with the mammalian expression vector for mTLR9 together with a luciferase-reporter gene driven by an NF-κB promoter. As a first step, cells were activated 24 h later with 3 μm of bioactive CpG-ODN or 3 μm of control inverted GpC-ODN for 6 h. In HEK293, bioactive CpG-ODN markedly induced NF-κB activity (Fig. 2a), which was 13-fold higher than that observed with unstimulated cells. Activation of the cells by control inverted GpC-ODN induced only marginal relative NF-κB activity, comparable with that detected when mTLR9 was not expressed by the cells. Furthermore, this activity was not observed when the cells were incubated in the presence of other bacterial stimuli such as LPS. These results indicate that the NF-κB activation of the HEK293 transfected cells by the bioactive CpG-ODN is strongly dependent upon mTLR9 expression and is sequence-specific. These results are consistent with those obtained with human TLR9 by other authors (28Chuang T.-H. Lee J. Kline L. Mathison J.C. Ulvetich R.J. J. Leukocyte Biol. 2002; 71: 538-544PubMed Google Scholar, 31Bauer S. Kirschning C.J. Häcker H. Redecke V. Hausmann S. Akira S. Wagner H. Lipford G.B. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 9237-9242Crossref PubMed Scopus (1251) Google Scholar, 32Takeshita F. Leifer C.A. Gursel I. Ishii K.J. Takeshita S. Gursel M. Klinman D.M. J. Immunol. 2001; 167: 3555-3558Crossref PubMed Scopus (513) Google Scholar).Fig. 2Relative NF-κB activity in HEK293 cells after CpG DNA stimulation. 4 × 105 cells were transiently transfected with 475 ng of mTLR9 and/or 1 μg of luciferase reporter plasmid. 24 h later, cells were activated with 3 μm of bioactive CpG or inverted GpC-ODN and 1 μg of LPS (a), or 10 μg of unmethylated or methylated CpG-containing plasmid (b). After 6 h, cells were lysed, and luciferase activity was measured in triplicate. Data represent triplicate means ± SD and are shown as fold activation compared with stimulation with media alone for each transfection.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Plasmid DNA Activates NF-κB in a CpG-dependent Manner—Induction of NF-κB activity via mTLR9 by a CpG-containing plasmid was investigated next. To address this question, we used two plasmids similar in their sequences which do not code for any eukaryotic protein. These two plasmids were either fully methylated or unmethylated on the CG sequences and were derived from the pACY184 replicon. Both methylated and unmethylated CpG-containing plasmids contained about 60 CpG motifs. The pAIT2 plasmid expresses the methylase SssI gene, allowing the de novo methylation specifically on the CG sequences in bacteria; we called this the methylated CpG-containing plasmid. By introducing a frameshift in the methylase gene, we generated the unmethylated CpG-containing plasmid which contains the same number of CpG motifs, but which is not methylated. The methylation status of plasmids was verified by using a functional test with restriction enzymes. Plasmids were treated with HpaII, which cut the unmethylated restriction site (C ↓ CGG), or by MspI, which recognizes the same restriction site independently of its methylation state. 2Cornelie, S., Poulain-Godefroy, D., Lund, C., Vendeville, C., Ban, E., Capron, M., and Riveau, G. (2004) Scan. J. Immunol. 59, 143–151. This treatment proved that no one CpG was found unmethylated in the plasmid coding the SssI methylase gene. We made use of these two plasmids to test whether they could induce NF-κB activity in vitro. HEK293 cells were transiently transfected with both mTLR9 and NF-κB-expressing plasmids as described above. Cells were then activated with 10 μg of plasmid DNA, corresponding to 80 nm of equivalent integrated CpG motifs. As shown in Fig. 2b, the unmethylated CpG-containing plasmid induced a 5-fold increase in NF-κB activity, whereas the same amount of methylated CpG plasmid provoked only a weak induction of 1.5-fold. Furthermore, only a 1-fold background activity was observed when the mTLR9 was not expressed by the cells. This result reinforced the hypothesis that unmethylated CpG-containing plasmid requires TLR9 for the activation of the NF-κB transcription factor. These results suggest that activation of the NF-κB transduction pathway is strongly dependent upon the methylation status of the CpG-containing plasmid.NF-κB Activation by Plasmid DNA Requires Endosomal Internalization—To confirm these findings, a dose-response experiment with both plasmids was performed. The activation of the NF-κB transcription factor by unmethylated CpG-containing plasmid increased with the concentration of the plasmid (up to 20-fold for the 100 μg dose; 833 nm of equivalent integrated CpG motifs) (Fig. 3a). It seems, therefore, that the effect of unmethylated CpG-containing plasmid is dose-dependent. Furthermore, increasing the concentration of methylated plasmid had no influence on the relative NF-κB activity. This indicates that the weak activation observed with the methylated plasmid is nonspecific. These results strongly suggest that the stimulation by unmethylated CpG-containing plasmid is mediated by a receptor, probably the mTLR9. Bauer et al. (31Bauer S. Kirschning C.J. Häcker H. Redecke V. Hausmann S. Akira S. Wagner H. Lipford G.B. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 9237-9242Crossref PubMed Scopus (1251) Google Scholar) have already suggested that endosomal maturation is required for the NF-κB activity induced by CpG-ODN. Therefore, we tested whether unmethylated CpG-containing plasmid required endosomal maturation to mediate its effects. Pre-treatment of HEK293-transfected cells with chloroquine prevented the induction of NF-κB activity by either unmethylated CpG-containing plasmid or bioactive CpG-ODN (Fig. 3b). This result is consistent with the previously described inhibitory effect of chloroquine on CpG-ODN-induced activation in macrophages, dendritic cells, and B cells (33Macfarlane D.E. Manzel L. J. Immunol. 1998; 160: 1122-1131PubMed Google Scholar).Fig. 3Dose-response experiments and effect of chloroquine for the unmethylated CpG-containing plasmid. 4 × 105 cells were transiently transfected with 475 ng of mTLR9 and/or 1 μg of luciferase reporter plasmid. a, 24 h later, cells were activated with indicated doses of unmethylated CpG-containing plasmid (gray), methylated CpG-containing plasmid (black), or bioactive CpG-ODN (white). b, HEK293 cells were pre-treated with 1 μg/ml of chloroquine and then stimulated with 3 μm of bioactive CpG-ODN or 75 μg of unmethylated CpG-containing plasmid. Data represent triplicate means ± SD and are shown as fold activation compared with stimulation with media alone for each transfection.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Plasmid DNA Binds mTLR9 —BIAcore technology was used to study the physical interaction of CpG-containing plasmid with mTLR9 produced in SF9 cells. Expression of mTLR9 was tested by Western blotting for each batch of transfected cells (data not shown). After cell transfection and lysis, the supernatant containing His-tagged TLR9 was used to cover an Ni-NTA sensor chip. Several concentrations of the CpG-containing plasmid were tested in this experiment. To ensure that the observed interactions occurred with the TLR9, a correction for nonspecific binding was applied by subtraction of the control channel data where the chip was coated with an irrelevant His-tagged protein, the chloramphenicol acetyl transferase protein for each binding experiment, as described under “Experimental Procedures.” As shown in Fig. 4a, when 250 nm (calculated as CpG motifs) of unmethylated CpG-containing plasmid was injected onto the sensorchip, a significant increase in the absorption of signal (37.1 resonance units (RU); corresponds to 1 pg/mm2) was observed. This difference was enhanced with increased doses of unmethylated plasmid, demonstrating that the unmethylated CpG-containing plasmid binds to mTLR9. The kinetics of association are slow and saturable. On the other hand, injection of methylated CpG-containing plasmid showed flattened association curves and a much lesser increase in RU at the dissociation phase, suggesting nonspecific interactions. Therefore, we subtracted this nonspecific interaction from the sensorgrams of unmethylated CpG-containing plasmid to determine the kinetic constants of specific binding (Fig. 4b). Although the sensorgrams had no smooth shape, probably because of the high mass and the low amount of the adsorbed plasmids, they could be correctly analyzed using a single Langmuir binding model with drifting baseline. This model takes into account the differential dissociation of the His-tagged TLR-9 molecules compared with the His-tagged control protein from the nickel chip. The affinity constant found was 186 nm ± 35 nm, taking into account the molarity of the CpG motifs in the plasmid. The relatively slow association rate constant (1 × 104m-1 s-1) suggests some conformational changes to obtain a stable complex with a half-life of ∼6 min, as calculated from the dissociation rate constant. The maximal response calculated from the dose-response curve was 80 RU, suggesting that only a low amount of TLR9 was able to bind to the plasmid after the solubilization and immobilization procedures. Our data unequivocally demonstrate that plasmid specifically binds to the mTLR9 when the plasmid contains unmethylated CpG motifs.Fig. 4Overlay plots showing the binding of CpG-containing plasmid to His-tagged mTLR9 immobilized on the Ni+-NTA surface. The flow rate was 20 μl/min. a, increasing concentrations of CpG-containing plasmid (250, 500, 1000 nm) were used. Sensograms from unmethylated (black) and methylated (gray) CpG-containing plasmid. b, integrated sensogram of the dose-response experiment with subtraction of nonspecific binding of methylated CpG-containing plasmid signal. c, overlay plot of competition experiments between unmethylated CpG-containing plasmid and ODNs. 200 nm of unmethylated plasmid was injected alone (-), with 2 μm bioactive CpG-ODN (gray line), or with 2 μm control inverted GpC-ODN (—).View Large Image Figure ViewerDownload Hi-res image Download (PPT)Plasmid Binding to mTLR9 Is CpG-specific—To prove the CpG involvement in the interaction of plasmid with mTLR9, competition experiments were performed with ODNs. 200 nm of plasmid plus 2 μm of bioactive CpG-ODN or control inverted GpC-ODN were injected on the mTLR9 or CAT-coated sensor chips. While the bioactive CpG was injected with the plasmid, the signal obtained deeply differs from that obtained with the plasmid alone. Only a weak signal was observed, suggesting that the ODN interacts with the TLR9 (Fig. 4c, 15 RU). Indeed, because the RU response is proportional to the mass adsorbed, binding of a small molecular weight molecule (CpG-ODN) gives a signal which is much lower than that obtained with the high molecular weight ligand, i.e. plasmid DNA, resulting in a decrease in the RU response. This element strongly suggests that bioactive CpG-ODN inhibited the binding of the plasmid on the TLR9. Furthermore when the inverted GpC-ODN was injected with the plasmid, the dissociation curve obtained superposed on that obtained with the plasmid alone. These results show that inverted GpC-ODN did not inhibit the binding of the plasmid on the TLR9. All of these data support the hypothesis that mTLR9 is the receptor for plasmid DNA and that its recognition requires the presence of unmethylated CpG motifs in the sequence.DISCUSSIONRecent research on pathogen-associated molecular patterns linked to immunity has highlighted the importance of the innate response (34Janeway Jr., C.A. Medzhitov R. Annu. Rev. Immunol. 2002; 20: 197-216Crossref PubMed Scopus (6060) Google Scholar). The patterns in question involve peptidoglycan, LPS, bacterial flagellin, lipoteichoic acid, double-stranded RNA, and bacterial DNA. These components are specific for bacteria and viruses and can signal the presence of potential infectious agents. The case of DNA is particular because its chemical composition and structure in plants, bacteria, viruses, and vertebrates is conserved. The discrimination between self and foreign DNA would depend upon certain sequence motifs and modifications such as methylation (35Krieg A.M. Annu. Rev. Immunol. 2002; 20: 709-760Crossref PubMed Scopus (2202) Google Scholar). Indeed, mammalian DNA is highly suppressed in CpG motifs, and most of them are methylated. In contrast, these CpG motifs are more frequent in bacteria and are not methylated in the cytosine residue (36Cardon L.R. Buge C. Clayton D.A. Karlin S. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3799-3803Crossref PubMed Scopus (198) Google Scholar). These features would allow the immune system to recognize specifically bacterial DNA and lead to the initiation of signal transduction within the cells (37Häcker H. Vabulas R.M. Takeuchi O. Hoshimo K. Akira S. Wagner H. J. Exp. Med. 2000; 192: 595-600Crossref PubMed Scopus (416) Google Scholar). This would mark the starting point for the immune system to secrete cytokines and co-stimulatory molecules needed for the adaptive response (35Krieg A.M. Annu. Rev. Immunol. 2002; 20: 709-760Crossref PubMed Scopus (2202) Google Scholar).Functional analyses in gene-deficient mice have identified TLR9 as a major component necessary for the responses mediated by synthetic CpG motifs, i.e. CpG-ODNs (27Hemmi H. Takeushi O. Kawai T. Kaisho T. Sato S.H.S. Matsumoto M. Hoshino K. Wagner H. Takeda K. Akira S. Nature. 2000; 408: 740-745Crossref PubMed Scopus (5310) Google Scholar). The results suggest that T" @default.
• W2079183583 created "2016-06-24" @default.
• W2079183583 creator A5013640385 @default.
• W2079183583 creator A5018151806 @default.
• W2079183583 creator A5044431066 @default.
• W2079183583 creator A5062701884 @default.
• W2079183583 creator A5063788658 @default.
• W2079183583 creator A5065880945 @default.
• W2079183583 creator A5080769402 @default.
• W2079183583 date "2004-04-01" @default.
• W2079183583 modified "2023-10-14" @default.
• W2079183583 title "Direct Evidence that Toll-like Receptor 9 (TLR9) Functionally Binds Plasmid DNA by Specific Cytosine-phosphate-guanine Motif Recognition" @default.
• W2079183583 cites W1514540900 @default.
• W2079183583 cites W1519633296 @default.
• W2079183583 cites W1524792851 @default.
• W2079183583 cites W1524870960 @default.
• W2079183583 cites W1538844879 @default.
• W2079183583 cites W1568165627 @default.
• W2079183583 cites W1612465238 @default.
• W2079183583 cites W1930598094 @default.
• W2079183583 cites W1967475367 @default.
• W2079183583 cites W1972140057 @default.
• W2079183583 cites W1979517563 @default.
• W2079183583 cites W1979956993 @default.
• W2079183583 cites W1982922581 @default.
• W2079183583 cites W1988314455 @default.
• W2079183583 cites W1999624664 @default.
• W2079183583 cites W2004726009 @default.
• W2079183583 cites W2004773897 @default.
• W2079183583 cites W2017638885 @default.
• W2079183583 cites W2025345914 @default.
• W2079183583 cites W2027983878 @default.
• W2079183583 cites W2032056947 @default.
• W2079183583 cites W2042863201 @default.
• W2079183583 cites W2047366876 @default.
• W2079183583 cites W2057809738 @default.
• W2079183583 cites W2062091239 @default.
• W2079183583 cites W2066833587 @default.
• W2079183583 cites W2069981713 @default.
• W2079183583 cites W2085166735 @default.
• W2079183583 cites W2092128665 @default.
• W2079183583 cites W2093508027 @default.
• W2079183583 cites W2102578857 @default.
• W2079183583 cites W2115147255 @default.
• W2079183583 cites W2116933950 @default.
• W2079183583 cites W2118011548 @default.
• W2079183583 cites W2129319296 @default.
• W2079183583 cites W2133449490 @default.
• W2079183583 cites W2138067578 @default.
• W2079183583 cites W2145078103 @default.
• W2079183583 cites W2153900602 @default.
• W2079183583 cites W2162076795 @default.
• W2079183583 cites W2331054937 @default.
• W2079183583 doi "https://doi.org/10.1074/jbc.m313406200" @default.
• W2079183583 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/14736866" @default.
• W2079183583 hasPublicationYear "2004" @default.
• W2079183583 type Work @default.
• W2079183583 sameAs 2079183583 @default.
• W2079183583 citedByCount "108" @default.
• W2079183583 countsByYear W20791835832012 @default.
• W2079183583 countsByYear W20791835832013 @default.
• W2079183583 countsByYear W20791835832014 @default.
• W2079183583 countsByYear W20791835832015 @default.
• W2079183583 countsByYear W20791835832016 @default.
• W2079183583 countsByYear W20791835832017 @default.
• W2079183583 countsByYear W20791835832018 @default.
• W2079183583 countsByYear W20791835832019 @default.
• W2079183583 countsByYear W20791835832020 @default.
• W2079183583 countsByYear W20791835832021 @default.
• W2079183583 countsByYear W20791835832022 @default.
• W2079183583 countsByYear W20791835832023 @default.
• W2079183583 crossrefType "journal-article" @default.
• W2079183583 hasAuthorship W2079183583A5013640385 @default.
• W2079183583 hasAuthorship W2079183583A5018151806 @default.
• W2079183583 hasAuthorship W2079183583A5044431066 @default.
• W2079183583 hasAuthorship W2079183583A5062701884 @default.
• W2079183583 hasAuthorship W2079183583A5063788658 @default.
• W2079183583 hasAuthorship W2079183583A5065880945 @default.
• W2079183583 hasAuthorship W2079183583A5080769402 @default.
• W2079183583 hasBestOaLocation W20791835831 @default.
• W2079183583 hasConcept C104317684 @default.
• W2079183583 hasConcept C121332964 @default.
• W2079183583 hasConcept C150194340 @default.
• W2079183583 hasConcept C153911025 @default.
• W2079183583 hasConcept C185592680 @default.
• W2079183583 hasConcept C190727270 @default.
• W2079183583 hasConcept C22744801 @default.
• W2079183583 hasConcept C24890656 @default.
• W2079183583 hasConcept C2776023528 @default.
• W2079183583 hasConcept C2778301229 @default.
• W2079183583 hasConcept C2779138994 @default.
• W2079183583 hasConcept C2908999202 @default.
• W2079183583 hasConcept C32276052 @default.
• W2079183583 hasConcept C512185932 @default.
• W2079183583 hasConcept C552990157 @default.
• W2079183583 hasConcept C55493867 @default.
• W2079183583 hasConcept C86803240 @default.
• W2079183583 hasConceptScore W2079183583C104317684 @default.

• next