FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2079294361> ?p ?o ?g. }

• W2079294361 endingPage "5412" @default.
• W2079294361 startingPage "5404" @default.
• W2079294361 abstract "We previously found that a mutation at the ODA7 locus in Chlamydomonas prevents axonemal outer row dynein assembly by blocking association of heavy chains and intermediate chains in the cytoplasm. We have now cloned the ODA7 locus by walking in the Chlamydomonas genome from nearby molecular markers, confirmed the identity of the gene by rescuing the mutant phenotype with genomic clones, and identified the ODA7 gene product as a 58-kDa leucine-rich repeat protein unrelated to outer row dynein LC1. Oda7p is missing from oda7 mutant flagella but is present in flagella of other outer row or inner row dynein assembly mutants. However, Oda7 levels are greatly reduced in flagella that lack both outer row dynein and inner row I1 dynein. Biochemical fractionation and rebinding studies support a model in which Oda7 participates in a previously uncharacterized structural link between inner and outer row dyneins. We previously found that a mutation at the ODA7 locus in Chlamydomonas prevents axonemal outer row dynein assembly by blocking association of heavy chains and intermediate chains in the cytoplasm. We have now cloned the ODA7 locus by walking in the Chlamydomonas genome from nearby molecular markers, confirmed the identity of the gene by rescuing the mutant phenotype with genomic clones, and identified the ODA7 gene product as a 58-kDa leucine-rich repeat protein unrelated to outer row dynein LC1. Oda7p is missing from oda7 mutant flagella but is present in flagella of other outer row or inner row dynein assembly mutants. However, Oda7 levels are greatly reduced in flagella that lack both outer row dynein and inner row I1 dynein. Biochemical fractionation and rebinding studies support a model in which Oda7 participates in a previously uncharacterized structural link between inner and outer row dyneins. Bend propagation in eukaryotic cilia and flagella requires coordination among multiple dynein motors. These organelles typically have ten or more unique dynein isoforms whose properties combine to support a range of motile activities. The loss of different dynein isoforms has been correlated with reductions in beat frequency (1Mitchell D.R. Rosenbaum J.L. J. Cell Biol. 1985; 100: 1228-1234Crossref PubMed Scopus (161) Google Scholar), altered waveform regulation (2Brokaw C.J. Kamiya R. Cell Motil. Cytoskeleton. 1987; 8: 68-75Crossref PubMed Scopus (309) Google Scholar), loss of resistance to viscous load (3Yagi T. Minoura I. Fujiwara A. Saito R. Yasunaga T. Hirono M. Kamiya R. J. Biol. Chem. 2005; 280: 41412-41420Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar), or reduced responsiveness to tactic signals (4King S.J. Dutcher S.K. J. Cell Biol. 1997; 136: 177-191Crossref PubMed Scopus (137) Google Scholar). Although most of our current understanding of the functional contribution of dynein diversity results from mutant analysis in the green alga Chlamydomonas, similar results are seen in the ciliate Tetrahymena (5Liu S. Hard R. Rankin S. Hennessey T. Pennock D.G. Cell Motil. Cytoskeleton. 2004; 59: 201-214Crossref PubMed Scopus (16) Google Scholar), the excavate Trypanosoma (6Kohl L. Bastin P. Int. Rev. Cytol. 2005; 244: 227-285Crossref PubMed Scopus (58) Google Scholar), and in chemically treated sea urchin spermatozoa (7Gibbons B.H. Gibbons I.R. J. Cell Sci. 1973; 13: 337-357Crossref PubMed Google Scholar). Sequence comparisons also support the evolution of axonemal dyneins into multiple isoforms prior to divergence of all present day organisms from the last common eukaryotic ancestor (8Asai D.J. Wilkes D.E. J. Eukaryot. Microbiol. 2004; 51: 23-29Crossref PubMed Scopus (56) Google Scholar, 9Asai D.J. Koonce M.F. Trends Cell Biol. 2001; 11: 196-202Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar), suggesting that dynein functional diversity plays a fundamental role in flagellar motility. Flagellar dyneins fall into two broad groups: outer row dyneins, which are essential for maintaining normal beat frequency and for some calcium-dependent waveform changes, and inner row dyneins, which are needed for normal waveform and for some tactic responses (10Kamiya R. Int. Rev. Cytol. 2002; 219: 115-155Crossref PubMed Scopus (191) Google Scholar). These two groups of motors also differ in their distribution along the doublet surface (11Porter M.E. Sale W.S. J. Cell Biol. 2000; 151: F37-F42Crossref PubMed Scopus (313) Google Scholar). The outer row consists of a single complex that repeats every three tubulin dimers (24 nm) along each doublet, whereas several different inner row dyneins each appear only once in every twelve tubulin dimers (96 nm). This 96-nm unit appears to correspond to one regulatory interval, as it contains one dynein regulatory complex and one set of radial spokes. Although dyneins in these two groups must be coordinately regulated, links between inner and outer row dyneins have not been identified. Mutations that disrupt assembly of outer row dyneins in Chlamydomonas map to over 16 loci, most of which encode subunits in one of three complexes. The largest complex is the dynein motor itself, composed of three catalytic heavy chains, two intermediate chains, and at least nine light chains (12DiBella L.M. Sakato M. Patel-King R.S. Pazour G.J. King S.M. Mol. Biol. Cell. 2004; 15: 4633-4646Crossref PubMed Scopus (57) Google Scholar). Mutations in most motor subunits interfere with association of the remaining subunits into a complex in the cytoplasm and block subsequent attachment of this motor complex to flagellar doublet microtubules (13Fowkes M.E. Mitchell D.R. Mol. Biol. Cell. 1998; 9: 2337-2347Crossref PubMed Scopus (143) Google Scholar). The docking complex consists of three proteins that assemble on the doublet surface separately from the motor complex (14Takada S. Wilkerson C.G. Wakabayashi K. Kamiya R. Witman G.B. Mol. Biol. Cell. 2002; 13: 1015-1029Crossref PubMed Scopus (102) Google Scholar). This complex is essential for attachment of the motor complex to doublet microtubules but not for its assembly in the cytoplasm. The Oda5 protein may form part of a third complex that associates with outer row dyneins (15Wirschell M. Pazour G. Yoda A. Hirono M. Kamiya R. Witman G.B. Mol. Biol. Cell. 2004; 15: 2729-2741Crossref PubMed Scopus (68) Google Scholar) and may help anchor outer row dyneins to doublet microtubules. However, not all dynein assembly loci encode proteins that function directly in the anchoring of motors to axonemal microtubules. We recently determined that the ODA16 gene product localizes to the soluble flagellar matrix and may act specifically as an assembly factor for intraflagellar transport-dependent transport of outer row dynein motor complexes to the flagellar compartment (16Ahmed N.T. Mitchell D.R. Mol. Biol. Cell. 2005; 16: 5004-5012Crossref PubMed Google Scholar). Two additional dynein assembly loci, ODA7 and ODA8, remain uncharacterized at the molecular level, and their exact roles in dynein assembly have not been determined. Here, we characterize the ODA7 gene and the axonemal location of its product. The oda7 mutation blocks outer row dynein assembly and fails to complement mutations in outer row dynein motor subunits in temporary diploid (dikaryon) analysis (17Kamiya R. J. Cell Biol. 1988; 107: 2253-2258Crossref PubMed Scopus (189) Google Scholar). Surprisingly, oda7 cells lack any observable pool of outer row dynein heavy chain α (the oda11 gene product), although they retain normal levels of other motor subunits (13Fowkes M.E. Mitchell D.R. Mol. Biol. Cell. 1998; 9: 2337-2347Crossref PubMed Scopus (143) Google Scholar), suggesting that oda7 interacts in some unique way with this heavy chain. The α heavy chain is a phosphoprotein (18King S.M. Witman G.B. J. Biol. Chem. 1994; 269: 5452-5457Abstract Full Text PDF PubMed Google Scholar) whose absence correlates with loss of beat frequency differences between the two flagella of Chlamydomonas (19Sakakibara H. Mitchell D.R. Kamiya R. J. Cell Biol. 1991; 113: 615-622Crossref PubMed Scopus (106) Google Scholar), indicating a likely role for this heavy chain in motility regulation. Because of these unique properties, we sought to identify the ODA7 gene product and determine its role in outer row dynein assembly and function. Sequence analysis of the ODA7 gene shows that the gene product is a leucine-rich repeat (LRR) 3The abbreviations used are: LRR, leucine-rich repeat; RFLP, restriction fragment length polymorphism; BAC, bacterial artificial chromosome. 3The abbreviations used are: LRR, leucine-rich repeat; RFLP, restriction fragment length polymorphism; BAC, bacterial artificial chromosome. protein in the SDS22 protein phosphatase 1 regulatory subunit family, with orthologs among organisms that have motile cilia. Biochemical analysis indicates that the Oda7 protein interacts with both outer row dynein and I1 inner row dynein and forms a bridge between these two motors on the doublet surface. Its location suggests a role in coordination of dynein isoforms during flagellar motility. Strains and Culture—Chlamydomonas reinhardtii wild type strains 137c, RFLP strain S1D2, and mutant strains arg7, pf9-2, ida2, ida4, ida7, oda1, pf28 (an allele of oda2), oda3, oda4, oda5, oda6, oda7, oda8, oda9, oda11, and oda12 are available from the Chlamydomonas Genetics Center (Duke University, Durham, NC). Double mutant strain oda7,arg7 was constructed and used for chromosome walking experiments and transformation rescue. Strain WS4 (pf28,pf30,ssh1) was constructed by Gianni Piperno (20LeDizet M. Piperno G. Mol. Biol. Cell. 1995; 6: 697-711Crossref PubMed Scopus (125) Google Scholar) and was obtained from Winfield Sale, Emory University, Atlanta, GA. Strain OS12C (pf28,ssh1) was selected from a non-parental ditype tetrad out of a cross of WS4 with pf28 and has normal length paralyzed flagella. The other genotype represented in this tetrad had short paralyzed flagella, typical of strains that contain both an inner row I1 mutation (pf30) and an outer row dynein assembly mutation (pf28). Strain ssh1 (suppressor of short) was selected from a tetratype tetrad out of a cross between OS12C and 137c and shows motility with an altered swimming pattern and a reduced beat frequency. All strains were maintained on minimal M medium (21Sager R. Granick S. Ann. N. Y. Acad. Sci. 1953; 466: 18-30Google Scholar) supplemented as needed with 0.05% l-arginine. For high density liquid cultures and for transformation experiments, cells were grown on acetate-enriched MII medium (21Sager R. Granick S. Ann. N. Y. Acad. Sci. 1953; 466: 18-30Google Scholar). Cloning and Sequencing ODA7—To initiate a walk to the ODA7 locus, strain oda7,arg7 was crossed with wild type RFLP strain S1D2, and 31 random oda7 progeny were selected on minimal medium. All 31 selected strains contain a crossover between the ARG7 and ODA7 loci, which are separated by ∼8 centimorgans on linkage group I. DNA prepared from these strains was used for genomic Southern blots to map the relative positions of RFLP markers and oda7. RFLP marker clones CNC41 and CNA73 (obtained from Carolyn Silflow, University of Minnesota, Minneapolis), Gbp1 (obtained from Judith Berman, University of Minnesota, Minneapolis), and PBT302 (obtained from John Jarvik, Carnegie Mellon University, Pittsburgh, PA) were labeled with digoxigenin (Roche Applied Science) for use as hybridization probes on Southern blots and to screen a Chlamydomonas genomic BAC library (available from the Clemson University Genomics Institute, Clemson, SC). BAC end fragments were prepared by gel-isolating unique HindIII fragments or by vectorette PCR (22Riley J. Butler R. Ogilvie D. Finniear R. Jenner D. Powell S. Anand R. Smith J.C. Markham A.F. Nucleic Acids Res. 1990; 18: 2887-2890Crossref PubMed Scopus (654) Google Scholar) and were random prime labeled for use as hybridization probes. Genomic sequences surrounding the PBT302 marker, as reported in the Chlamydomonas genome Data Base Version 2.0 (http://genome.jgi-psf.org/chlre2/chlre2.home.html), were examined to identify candidate ODA7 genes, and BAC clones corresponding to the regions of interest were co-transformed with pARG7.8 (arginosuccinate lyase gene plasmid) (23Debuchy R. Purton S. Rochaix J-D. EMBO J. 1989; 8: 2803-2809Crossref PubMed Scopus (320) Google Scholar) into an oda7,arg7 strain by glass bead transformation (24Kindle K.L. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 1228-1232Crossref PubMed Scopus (804) Google Scholar). The resulting colonies were transferred to MI medium in flat bottomed microtiter wells and examined, on an Olympus SZ60 stereoscope with substage darkfield illumination, for restoration of wild type swimming speed. Beat frequency was measured on free swimming cells grown in MI for 18 h with aeration under a 10-h dark, 14-h light cycle, using a Zeiss Axioskop with a ×20 objective under stroboscopic dark field illumination as previously described (25Mitchell D.R. Kang Y. J. Cell Biol. 1991; 113: 835-842Crossref PubMed Scopus (123) Google Scholar). The light source was passed through a 635-nm band pass filter to reduce phototactic responses. After determining that BAC clone 17H5 could rescue the oda7 mutation, smaller genomic clones were isolated by hybridization screening of a phage genomic library in EMBL4 with a PCR-generated fragment of 17H5. Primer sequences oda7r5 (CCATTTACTTGCAGTCGGTC) and oda7f5 (GCTATGCCTAGCCATTTGAG) used to amplify the probe were selected from the predicted ODA7 coding region, based on Chlamydomonas expressed sequence tag sequences that matched predicted exons of gene model C_410113. Two overlapping phage clones, ODA7λ1 and ODA7λ4, were purified and tested for their ability to rescue the mutation by glass bead transformation as described above. A 5-kb NotI-BamI fragment that spanned the predicted gene was subcloned from ODA7λ4 into pBluescript II (Stratagene) to create pODA7-NB5. cDNA clones were isolated by hybridization screening of a Lambda ZapII cDNA library prepared from vegetative cells (Stress II library, available from the Chlamydomonas Genetics Center, Duke University) with the same probe used to isolate genomic clones (above). The inserts of two selected phage were cloned as pBluescript II plasmids by phagmid excision, sequenced by primer walking on both strands, and determined to be identical to each other. Sequences were assembled and translated using Vector NTI Advance, version 9.0 (Invitrogen) and have been deposited in GenBank™ under accession number DQ886489. Data base comparisons used BLAST (26Altschul S.F. Madden T.L. Schaffer A.A. Zhang J. Zhang Z. Miller W. Lipman D.J. Nucleic Acids Res. 1997; 25: 3389-3402Crossref PubMed Scopus (59448) Google Scholar) at NCBI with default parameters. Expressed sequence tag sequences that align with ODA7 were identified through analysis of tracks on the Chlamydomonas Genome v2.0 Internet site and confirmed by BLAST searches of Chlamydomonas expressed sequence tags. Sequence data available on the genome browser were produced by the U.S. Department of Energy Joint Genome Institute, www.jgi.doe.gov/, and are provided for use in this publication only. Antibody Production and Purification—The coding region of cDNA clone pODA7-3 was amplified with primers oda7-3AGf (CCGCGAATTCTGACTAAGGAAGCTCTTCTAGAGG), which introduces an EcoRI site at codon 4, and oda7-3AGr (CCATGGCCTAATTCCAGGTCGTT), which extends beyond the stop codon of the 432-codon Oda7 coding sequence. The amplified product was digested with EcoRI and SalI to generate a 1270-bp fragment (ODA7 codons 4–427), which was cloned into pGEX-4T-2 (Amersham Biosciences), and a glutathione S-transferase fusion protein was expressed in Escherichia coli BL21 (DE3) pLysS cells (Stratagene), gel-purified, and used to raise polyclonal antibodies in rabbits (Covance, Princeton, NJ). For antibody purification, the fusion protein was digested with thrombin, separated by SDS-PAGE on a 7% acrylamide gel, and blotted, and a strip of the blot containing only Oda7p was used as an affinity matrix. Flagellar Isolation and Fractionation—Cells grown in liquid medium were deflagellated by treatment with dibucaine as previously described (27Mitchell B.F. Pedersen L.B. Feely M. Rosenbaum J.L. Mitchell D.R. Mol. Biol. Cell. 2005; 16: 4509-4518Crossref PubMed Scopus (87) Google Scholar). All subsequent steps were at 4 °C or on ice. Flagella were purified by differential centrifugation and rinsed once in HMDEK (30 mm Hepes, 5 mm MgSO4, 1 mm dithiothreitol, 0.5 mm EGTA, 25 mm potassium acetate, 1 mm phenylmethylsulfonyl fluoride, pH 7.4) before preparation for SDS-PAGE (or further fractionation). To remove membranes, flagella were resuspended in HMDEK and then mixed with an equal volume of HMDEK containing a detergent, either Nonidet-P40 (Fluka) or octylglucopyranoside (Sigma) as indicated under “Results.” After trituration with a micropipet, samples were pelleted in a microfuge (16,000 × g) for 10 min and pellets were resuspended to the same volume as supernatant solutions prior to mixing with an equal volume of 2× SDS sample buffer. Demembranation was monitored by the appearance of a high molecular weight membrane glycoprotein (28Bloodgood R.A. Salomonsky N.L. J. Cell Biol. 1994; 127: 803-811Crossref PubMed Scopus (25) Google Scholar) in the supernatant, as observed by protein stain after SDS-PAGE. Dynein was extracted into high salt by resuspension of demembranated axonemes in HMDEK supplemented with the indicated concentrations of salts. All extractions proceeded for 30 min on ice, followed by a 20-min spin in a microfuge. Salt extracts were dialyzed versus HMDEK and clarified (16,000 × g, 20 min) prior to further use. Alternatively, to extract dyneins by low ionic strength dialysis (29Gibbons I.R. Arch. Biol. 1965; 76: 317-352PubMed Google Scholar), flagella were resuspended in 1 mm Tris, 0.1 mm EDTA, 5 mm KCl, 0.1 mm dithiothreitol, 0.01 mm phenylmethylsulfonyl fluoride, pH 8.0, dialyzed against this solution for 24 h, and centrifuged (16,000 × g, 20 min) to generate pellet and supernatant fractions. To further separate dyneins, extracts were sedimented on 12.5-ml gradients of 5–20% sucrose in HMDEK at 155,000 × g (35,000 rpm in a Beckman SW40 rotor) for 15 h (standard conditions) or on 4.5-ml gradients at 181,000 × g (42,000 rpm in a Beckman SW 60 rotor) for 4.5 h (alternate conditions to preserve intact outer row dynein) (30Takada S. Sakakibara H. Kamiya R. J. Biochem. (Tokyo). 1992; 111: 758-762Crossref PubMed Scopus (35) Google Scholar). Fractions collected from the bottom of the tube were precipitated with 2 volumes acetone and dissolved in SDS sample buffer. Dynein heavy chains (average Mr = 500,000) and Benchmark Protein Ladder (Invitrogen) were used as protein size standards. For immunoblotting, proteins were transferred to Immobilon-P membranes (Millipore Corp). Affinity-purified polyclonal rabbit antibodies to I1 subunits IC140, IC138, and IC97 were provided by Winfield Sale. A monoclonal antibody against outer row dynein IC2 has been previously described (31Mitchell D.R. Rosenbaum J.L. Cell Motil. Cytoskeleton. 1986; 6: 510-520Crossref PubMed Scopus (59) Google Scholar). Antibodies were detected with peroxidase-labeled secondary antibodies (Bio-Rad) using Super Signal West Dura Extend Duration substrate (Pierce). Images were scanned into Adobe Photoshop 6.0 and cropped. Electron Microscopy—Specimens for thin section electron microscopy were prepared as previously described (32Mitchell D.R. Sale W.S. J. Cell Biol. 1999; 144: 293-304Crossref PubMed Scopus (102) Google Scholar). Images were taken using a JEOL 100CXII microscope operated at 80 kV. Negatives were scanned and imported in Adobe Photoshop 6.0; the images were then inverted and adjusted for contrast and median density. Axoneme cross-sections were reoriented so the dyneins projected clockwise. Chromosome Walk to ODA7—Many dynein genes in Chlamydomonas have been identified through analysis of insertional mutants by using the inserted sequence as a tag to clone the disrupted gene. However, despite analysis of 28 insertional mutants that prevented outer row dynein assembly, we were unable to identify insertional mutants at the ODA7 locus. As an alternative we used the one available mutation at oda7, which was generated by ultraviolet irradiation (17Kamiya R. J. Cell Biol. 1988; 107: 2253-2258Crossref PubMed Scopus (189) Google Scholar), for a genomic walk. Molecular markers that map in the vicinity of ODA7 on linkage group I, including Gbp1, PBT302, CNC41, and CNA73 (33Silflow C.D. Kathir P. Lefebvre P.A. Methods Cell Biol. 1995; 47: 525-530Crossref PubMed Scopus (13) Google Scholar), were used to probe DNA from 31 random recombinants in the ARG7-ODA7 interval. These recombinants were selected from a cross between RFLP strain S1D2 and double mutant strain arg7,oda7. For the Gbp1 and CNA73 markers, all recombinants gave an identical pattern consistent with a marker location telomeric to the test interval. In contrast, the PBT302 and CNC41 markers lay within the interval, as seen by the presence of recombinations between both markers and the oda7 locus in 2 of the 31 strains. Based on this recombination frequency, these markers are within 1 centimorgan of ODA7 (Fig. 1A), which translates on average in the Chlamydomonas genome to ∼100 kb. The PBT302 marker was used to select clones from an indexed BAC library to start the walk. A 200-kb region covered by 17 BAC clones extended this walk beyond one of the two crossovers in the PBT302-ODA7 interval to orient the walk and also identified the relative locations of PBT302 and CNC41 (Fig. 1B), but probes from the end of this walk closest to ODA7 failed to select additional clones in either of two BAC libraries. Compiled genomic sequence data (Chlamydomonas Genome Data Base v2.0) placed PBT302 on sequence scaffold 41 and provided an additional likely contiguous sequence that extended 200 kb beyond the gap at the end of our walk. Because some sequences at the end of scaffold 41 also appear on scaffold 139, portions of this region of the genome data base may retain assembly errors. However, most of the BAC end sequences for clones in our walk appeared at appropriate locations in the scaffold 41 sequence. To identify ODA7 gene candidates, genome data base annotations for appropriate regions of scaffold 41 were analyzed to identify genes whose homologs are expressed exclusively in organisms that have motile cilia or flagella. A single gene met this criterion, C_410113, based on the similarity of its predicted gene product to those of expressed sequence tags derived from mammalian testis cDNA libraries. Sequences from scaffold 41 were used to BLAST the data base of BAC end sequences and identified BAC 17H5 (PTQ6356) as the smallest BAC clone that spanned predicted gene C_410113. Co-transformation of BAC 17H5 and an ARG gene plasmid into an arg7,oda7 strain resulted in rescue of the slow swimming phenotype in 12 of 189 ARG+ colonies, showing that 17H5 can complement the oda7 mutation. Restoration of outer row dyneins was confirmed in one of these co-transformants by both transmission electron microscopy of isolated flagellar axonemes and Western blot of axonemal proteins with an antibody against outer row dynein intermediate chain IC2. To further determine whether C_410113 corresponds to ODA7, we amplified a small region of the presumed coding sequence from BAC 17H5 and used it as a hybridization probe to select smaller genomic and cDNA clones from phage λ libraries. Two overlapping genomic clones selected with this probe were able to rescue the mutant phenotype when transformed into an oda7 strain. The region of overlap between these clones, which spans the presumptive ODA7 gene, was subcloned into a plasmid (Fig. 1C) that also rescued the mutant phenotype. The selected cDNA clone (pODA7-3) was sequenced and contained the complete coding region predicted in the annotation for gene C_410113. Exon I Is Deleted in the oda7 Mutation—Exons of the presumptive ODA7 gene, identified by comparing our cDNA sequence with the reported genomic sequence (supplemental Fig. S1A), were amplified from wild type and oda7 mutant genomic DNA, and amplification products were characterized to confirm the presence of a mutation in the oda7 gene copy. Exons 2–5 amplified from the oda7 strain contained no differences from wild type genomic sequences. However, we were unable to amplify exon 1 from mutant DNA with any of three separate primer pairs, all of which successfully amplified bands of the expected size from wild type DNA (supplemental Fig. S1B). 4D. R. Mitchell and J. Freshour, unpublished observations. A genomic Southern blot probed with the complete cDNA also indicated that the genomic region spanning exon 1 contained an estimated 1.2-kb deletion in the oda7 strain (supplemental Fig. S1C). Oda7 Is an LRR Protein in the SDS22 Family—Our 1812-bp ODA7 cDNA sequence contains a 140-bp 5′-untranslated region, a 376-bp 3′-untranslated region, and an open reading frame that encodes a predicted protein of 432 amino acids (47 kDa). The CD search algorithm (34Marchler-Bauer A. Bryant S.H. Nucleic Acids Res. 2004; 32: W327-W331Crossref PubMed Scopus (1481) Google Scholar) identified an LRR domain in the N-terminal half of Oda7 (Fig. 2A). Comparison to known LRR proteins shows that Oda7 is an ortholog of the uncharacterized LRRC50 sequences of mammals (e.g. mouse AAH50751) and puts Oda7p in the SDS22 family (35Kajava A.V. Kobe B. Protein Sci. 2002; 11: 1082-1090Crossref PubMed Scopus (103) Google Scholar). The 6 LRR repeats in Oda7 are followed by sequences that typically cap the C terminus of the LRR structure (Fig. 2B). Although axonemal dynein light chains such as Chlamydomonas outer row dynein LC1 are also SDS22 family LRR proteins, Oda7 groups with other related sequences in a subfamily that has diverged from LC1 within the LRR repeat domain and shows no sequence similarity to LC1 within the C-terminal non-LRR domain. Genomes from a wide diversity of eukaryotic phyla each retained only a single gene encoding a protein that grouped with Oda7 by ClustalW analysis (Fig. 2C). Biochemical Characterization of Oda7—Antibodies raised against a bacterially expressed GST-Oda7 fusion protein identify a single 58-kDa band on blots of wild type Chlamydomonas flagellar proteins that partitions after detergent treatment into both insoluble (axonemal) and soluble (membrane/matrix) fractions (Fig. 3A). Comparison of wild type flagella with those of oda mutants shows that Oda7 is retained by all other tested strains except oda7 (Fig. 3B). The strains used in this comparison include several that are only defective in assembly of the dynein catalytic complex (e.g. oda2, 4, 6, 9), strains that disrupt the outer row dynein docking complex (oda1, 3), and strains that disrupt dynein assembly without affecting either of these complexes (oda5, 8) (13Fowkes M.E. Mitchell D.R. Mol. Biol. Cell. 1998; 9: 2337-2347Crossref PubMed Scopus (143) Google Scholar). Although the amount of Oda7p retained by oda mutant flagella (other than oda7) was variable, this variability was not related to the strain under analysis but appeared to be due to uncontrollable differences between preparations. In addition, we tested for the retention of Oda7 in flagella from strains lacking radial spokes (pf14, not shown) and inner row dyneins (ida4, ida6, ida7) and only observed a slight reduction in flagellar Oda7 in the ida7 strain, which is defective for assembly of I1 inner row dynein (36Perrone C.A. Yang P.F. O'Toole E. Sale W.S. Porter M.E. Mol. Biol. Cell. 1998; 9: 3351-3365Crossref PubMed Scopus (81) Google Scholar) (Fig. 3, C and D). This result was unexpected, as oda7 has no effect on I1 assembly (17Kamiya R. J. Cell Biol. 1988; 107: 2253-2258Crossref PubMed Scopus (189) Google Scholar). However, at least three other dynein subunits are thought to function as subunits in both outer row and I1 dyneins, light chains LC7a and LC7b (12DiBella L.M. Sakato M. Patel-King R.S. Pazour G.J. King S.M. Mol. Biol. Cell. 2004; 15: 4633-4646Crossref PubMed Scopus (57) Google Scholar, 37Bowman A.B. Patel-King R.S. Benashski S.E. McCaffery J.M. Goldstein L.S.B. King S.M. J. Cell Biol. 1999; 146: 165-179Crossref PubMed Scopus (148) Google Scholar) and LC8 (12DiBella L.M. Sakato M. Patel-King R.S. Pazour G.J. King S.M. Mol. Biol. Cell. 2004; 15: 4633-4646Crossref PubMed Scopus (57) Google Scholar), raising the possibility that Oda7 is present in both complexes. To test the combined effects of loss of outer row and I1 dyneins, we compared flagellar Oda7 levels in wild type and ida7 to those in WS4 flagellar samples (Fig. 3D). WS4, a triple mutant (pf28,pf30,ssh1), is defective in assembly of both outer row and I1 dyneins and contains a suppressor mutation (suppressor of short1) to support the assembly of full-length flagella when both outer row and I1 dyneins are missing. To control for the effects of ssh1, flagella from a strain containing only the ssh1 mutation were also examined. The combination of both dynein mutations (Fig. 3D, lane WS4) has a consistently greater effect on Oda7 levels than either single dynein assembly defect alone but does not completely prevent flagellar targeting of Oda7. The ssh1 mutation has no apparent effect on the assembly of Oda7. Oda7 Is an Axonemal Protein Associated with Both I1 and Outer Row Dyneins—Most of Oda7 was extracted during demembranation of flagella with Nonidet P-40 detergent (Fig. 3A). When a range of Nonidet P-40 concentrations were compared, more than half of Oda7 was extracted into a soluble fraction at the lowest Nonidet P-40 concentration tested (supplemental Fig. S2A), indicating either that Oda7 resides in part in the matrix or as a membrane-associated protein or that its axonemal association is detergent-sensitive. We tested alternative non-ionic detergents and identified" @default.
• W2079294361 created "2016-06-24" @default.
• W2079294361 creator A5002492825 @default.
• W2079294361 creator A5038972992 @default.
• W2079294361 creator A5084381004 @default.
• W2079294361 date "2007-02-01" @default.
• W2079294361 modified "2023-09-30" @default.
• W2079294361 title "Chlamydomonas Flagellar Outer Row Dynein Assembly Protein Oda7 Interacts with Both Outer Row and I1 Inner Row Dyneins" @default.
• W2079294361 cites W1583761679 @default.
• W2079294361 cites W1597489805 @default.
• W2079294361 cites W1606277263 @default.
• W2079294361 cites W1783497132 @default.
• W2079294361 cites W1867593330 @default.
• W2079294361 cites W1935281316 @default.
• W2079294361 cites W1968723998 @default.
• W2079294361 cites W1976049716 @default.
• W2079294361 cites W1981045929 @default.
• W2079294361 cites W1999369230 @default.
• W2079294361 cites W2004589024 @default.
• W2079294361 cites W2016617586 @default.
• W2079294361 cites W2028605946 @default.
• W2079294361 cites W2035318827 @default.
• W2079294361 cites W2036301709 @default.
• W2079294361 cites W2046715986 @default.
• W2079294361 cites W2053768951 @default.
• W2079294361 cites W2057131828 @default.
• W2079294361 cites W2058163799 @default.
• W2079294361 cites W2058232249 @default.
• W2079294361 cites W2063043817 @default.
• W2079294361 cites W2067010823 @default.
• W2079294361 cites W2071943449 @default.
• W2079294361 cites W2072997894 @default.
• W2079294361 cites W2077499459 @default.
• W2079294361 cites W2082016203 @default.
• W2079294361 cites W2089665250 @default.
• W2079294361 cites W2091748425 @default.
• W2079294361 cites W2098782815 @default.
• W2079294361 cites W2101476021 @default.
• W2079294361 cites W2107854855 @default.
• W2079294361 cites W2109516793 @default.
• W2079294361 cites W2109822773 @default.
• W2079294361 cites W2122358634 @default.
• W2079294361 cites W2129942659 @default.
• W2079294361 cites W2134201984 @default.
• W2079294361 cites W2136485352 @default.
• W2079294361 cites W2147191468 @default.
• W2079294361 cites W2153277457 @default.
• W2079294361 cites W2158714788 @default.
• W2079294361 cites W2164051661 @default.
• W2079294361 doi "https://doi.org/10.1074/jbc.m607509200" @default.
• W2079294361 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3321484" @default.
• W2079294361 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17194703" @default.
• W2079294361 hasPublicationYear "2007" @default.
• W2079294361 type Work @default.
• W2079294361 sameAs 2079294361 @default.
• W2079294361 citedByCount "56" @default.
• W2079294361 countsByYear W20792943612012 @default.
• W2079294361 countsByYear W20792943612013 @default.
• W2079294361 countsByYear W20792943612014 @default.
• W2079294361 countsByYear W20792943612015 @default.
• W2079294361 countsByYear W20792943612016 @default.
• W2079294361 countsByYear W20792943612017 @default.
• W2079294361 countsByYear W20792943612018 @default.
• W2079294361 countsByYear W20792943612019 @default.
• W2079294361 countsByYear W20792943612020 @default.
• W2079294361 countsByYear W20792943612021 @default.
• W2079294361 countsByYear W20792943612022 @default.
• W2079294361 countsByYear W20792943612023 @default.
• W2079294361 crossrefType "journal-article" @default.
• W2079294361 hasAuthorship W2079294361A5002492825 @default.
• W2079294361 hasAuthorship W2079294361A5038972992 @default.
• W2079294361 hasAuthorship W2079294361A5084381004 @default.
• W2079294361 hasBestOaLocation W20792943611 @default.
• W2079294361 hasConcept C104317684 @default.
• W2079294361 hasConcept C106987784 @default.
• W2079294361 hasConcept C143065580 @default.
• W2079294361 hasConcept C185592680 @default.
• W2079294361 hasConcept C20418707 @default.
• W2079294361 hasConcept C2776580309 @default.
• W2079294361 hasConcept C54355233 @default.
• W2079294361 hasConcept C86803240 @default.
• W2079294361 hasConcept C95444343 @default.
• W2079294361 hasConceptScore W2079294361C104317684 @default.
• W2079294361 hasConceptScore W2079294361C106987784 @default.
• W2079294361 hasConceptScore W2079294361C143065580 @default.
• W2079294361 hasConceptScore W2079294361C185592680 @default.
• W2079294361 hasConceptScore W2079294361C20418707 @default.
• W2079294361 hasConceptScore W2079294361C2776580309 @default.
• W2079294361 hasConceptScore W2079294361C54355233 @default.
• W2079294361 hasConceptScore W2079294361C86803240 @default.
• W2079294361 hasConceptScore W2079294361C95444343 @default.
• W2079294361 hasIssue "8" @default.
• W2079294361 hasLocation W20792943611 @default.
• W2079294361 hasLocation W20792943612 @default.
• W2079294361 hasLocation W20792943613 @default.
• W2079294361 hasOpenAccess W2079294361 @default.
• W2079294361 hasPrimaryLocation W20792943611 @default.
• W2079294361 hasRelatedWork W1513575249 @default.

• next