FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2079343428> ?p ?o ?g. }

• W2079343428 endingPage "43" @default.
• W2079343428 startingPage "43" @default.
• W2079343428 abstract "An approach to the solid-phase synthesis of oligo- and poly-ribonucleotides is described. The synthetic strategy involves the use of building blocks in which two acid-labile groups, 1-(2-fluorophenyl)-4-methoxypiperidin-4-yl (Fpmp) and 9-phenylxanthen-9-yl (Px), respectively, are used to protect the 2′- and 5′-hydroxy functions of ribonucleoside building blocks. The adenine, cytosine and guanine base residues are protected with pivaloyl, benzoyl and phenylacetyl groups, respectively. 2-Cyanoethyl N,N-diisopropylphosphoramidites are used in the coupling steps, and 5-(3nitrophenyl)-1H-tetrazole is used as the activating agent. Following the chain-assembly process, 2′-protected oligo-and poly-ribonucleotides are released from the functionalized controlled-pore glass solid support; the latter stabilized ribonucleic acid (RNA) sequences are purified before they are fully unblocked by treatment with 0.01 mol dm–3 hydrochloric acid (pH 2) at room temperature for 20 h. The efficacy of this methodology is illustrated by the synthesis of the 3′-terminal decamer (r[UCGUCCACCA]), nonadecamer (r[AUUCCGGACUCGUCCACCA]), and heptatriacontamer (37-mer, r[GGAGAGGUCUCCGGUUCGAUUCCGGACUCGUCCACCA]) sequences of yeast alanine tRNA (tRNAAla)." @default.
• W2079343428 created "2016-06-24" @default.
• W2079343428 creator A5012784397 @default.
• W2079343428 creator A5018343324 @default.
• W2079343428 creator A5044888544 @default.
• W2079343428 creator A5090567250 @default.
• W2079343428 date "1993-01-01" @default.
• W2079343428 modified "2023-10-09" @default.
• W2079343428 title "Use of the 1-(2-fluorophenyl)-4-methoxypiperidin-4-yl (Fpmp) protecting group in the solid-phase synthesis of oligo- and poly-ribonucleotides" @default.
• W2079343428 cites W1529847153 @default.
• W2079343428 cites W1966419565 @default.
• W2079343428 cites W1972063928 @default.
• W2079343428 cites W1981431082 @default.
• W2079343428 cites W1985096669 @default.
• W2079343428 cites W1986195081 @default.
• W2079343428 cites W1987512279 @default.
• W2079343428 cites W1991421341 @default.
• W2079343428 cites W1993654043 @default.
• W2079343428 cites W2002009265 @default.
• W2079343428 cites W2019014169 @default.
• W2079343428 cites W2026042275 @default.
• W2079343428 cites W2034479471 @default.
• W2079343428 cites W2054077866 @default.
• W2079343428 cites W2064344335 @default.
• W2079343428 cites W2064635496 @default.
• W2079343428 cites W2069636180 @default.
• W2079343428 cites W2074141363 @default.
• W2079343428 cites W2085877925 @default.
• W2079343428 cites W2089617243 @default.
• W2079343428 cites W2095555621 @default.
• W2079343428 cites W2095959703 @default.
• W2079343428 cites W2107286826 @default.
• W2079343428 cites W2140170799 @default.
• W2079343428 cites W2150981906 @default.
• W2079343428 cites W2154989771 @default.
• W2079343428 cites W2316529488 @default.
• W2079343428 cites W2326266373 @default.
• W2079343428 cites W2328366366 @default.
• W2079343428 cites W2329543029 @default.
• W2079343428 cites W2330534542 @default.
• W2079343428 doi "https://doi.org/10.1039/p19930000043" @default.
• W2079343428 hasPublicationYear "1993" @default.
• W2079343428 type Work @default.
• W2079343428 sameAs 2079343428 @default.
• W2079343428 citedByCount "37" @default.
• W2079343428 countsByYear W20793434282013 @default.
• W2079343428 countsByYear W20793434282014 @default.
• W2079343428 countsByYear W20793434282022 @default.
• W2079343428 crossrefType "journal-article" @default.
• W2079343428 hasAuthorship W2079343428A5012784397 @default.
• W2079343428 hasAuthorship W2079343428A5018343324 @default.
• W2079343428 hasAuthorship W2079343428A5044888544 @default.
• W2079343428 hasAuthorship W2079343428A5090567250 @default.
• W2079343428 hasConcept C104317684 @default.
• W2079343428 hasConcept C111921641 @default.
• W2079343428 hasConcept C153957851 @default.
• W2079343428 hasConcept C178790620 @default.
• W2079343428 hasConcept C185592680 @default.
• W2079343428 hasConcept C21951064 @default.
• W2079343428 hasConcept C24107716 @default.
• W2079343428 hasConcept C2776023528 @default.
• W2079343428 hasConcept C2776469878 @default.
• W2079343428 hasConcept C2776844798 @default.
• W2079343428 hasConcept C2778301229 @default.
• W2079343428 hasConcept C2779281246 @default.
• W2079343428 hasConcept C2779746882 @default.
• W2079343428 hasConcept C2780263894 @default.
• W2079343428 hasConcept C512185932 @default.
• W2079343428 hasConcept C552990157 @default.
• W2079343428 hasConcept C55493867 @default.
• W2079343428 hasConcept C67705224 @default.
• W2079343428 hasConcept C71240020 @default.
• W2079343428 hasConceptScore W2079343428C104317684 @default.
• W2079343428 hasConceptScore W2079343428C111921641 @default.
• W2079343428 hasConceptScore W2079343428C153957851 @default.
• W2079343428 hasConceptScore W2079343428C178790620 @default.
• W2079343428 hasConceptScore W2079343428C185592680 @default.
• W2079343428 hasConceptScore W2079343428C21951064 @default.
• W2079343428 hasConceptScore W2079343428C24107716 @default.
• W2079343428 hasConceptScore W2079343428C2776023528 @default.
• W2079343428 hasConceptScore W2079343428C2776469878 @default.
• W2079343428 hasConceptScore W2079343428C2776844798 @default.
• W2079343428 hasConceptScore W2079343428C2778301229 @default.
• W2079343428 hasConceptScore W2079343428C2779281246 @default.
• W2079343428 hasConceptScore W2079343428C2779746882 @default.
• W2079343428 hasConceptScore W2079343428C2780263894 @default.
• W2079343428 hasConceptScore W2079343428C512185932 @default.
• W2079343428 hasConceptScore W2079343428C552990157 @default.
• W2079343428 hasConceptScore W2079343428C55493867 @default.
• W2079343428 hasConceptScore W2079343428C67705224 @default.
• W2079343428 hasConceptScore W2079343428C71240020 @default.
• W2079343428 hasIssue "1" @default.
• W2079343428 hasLocation W20793434281 @default.
• W2079343428 hasOpenAccess W2079343428 @default.
• W2079343428 hasPrimaryLocation W20793434281 @default.
• W2079343428 hasRelatedWork W1965164734 @default.
• W2079343428 hasRelatedWork W2000061949 @default.
• W2079343428 hasRelatedWork W2076953429 @default.

• next