FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2079520339> ?p ?o ?g. }

• W2079520339 endingPage "14239" @default.
• W2079520339 startingPage "14230" @default.
• W2079520339 abstract "Tau is a microtubule-associated protein whose transcript undergoes complex regulated splicing in the mammalian nervous system. Exon 2 modulates the tau N-terminal domain, which interacts with the axonal membrane. Exon 10 codes for a microtubule binding domain, increasing the affinity of tau for microtubules. Both exons are excluded from fetal brain, but their default behavior is inclusion, suggesting that silencers are involved in their regulation. Exon 2 is significantly reduced in myotonic dystrophy type 1, whose symptoms include dementia. Mutations that affect exon 10 splicing cause frontotemporal dementia (FTDP). In this study, we investigated three regulators of exon 2 and 10 splicing: serine/arginine-rich (SR) proteins SRp55, SRp30c, and htra2β1. The first two inhibit both exons; htra2β1 inhibits exon 2 but activates exon 10. By deletion analysis, we identified splicing silencers located at the 5′ end of each exon. Furthermore, we demonstrated that SRp30c and SRp55 bind to both silencers and to each other. In exon 2, htra2β1 binds to the inhibitory heterodimer through its RS1 domain but not to exon 2, whereas in exon 10 the heterodimer may sterically interfere with htra2β1 binding to a purine-rich enhancer (defined by FTDP mutation E10-Δ5 = Δ280K) directly downstream of the silencer. Increased exon 10 inclusion in FTDP mutant ENH (N279K) may arise from abolishing SRp30c binding. Also, htra2β3, a naturally occurring variant of htra2β1, no longer inhibits exon 2 splicing but can partially rescue splicing of exon 10 in FTDP mutation E10-Δ5. This work provides interesting insights into the splicing regulation of the tau gene. Tau is a microtubule-associated protein whose transcript undergoes complex regulated splicing in the mammalian nervous system. Exon 2 modulates the tau N-terminal domain, which interacts with the axonal membrane. Exon 10 codes for a microtubule binding domain, increasing the affinity of tau for microtubules. Both exons are excluded from fetal brain, but their default behavior is inclusion, suggesting that silencers are involved in their regulation. Exon 2 is significantly reduced in myotonic dystrophy type 1, whose symptoms include dementia. Mutations that affect exon 10 splicing cause frontotemporal dementia (FTDP). In this study, we investigated three regulators of exon 2 and 10 splicing: serine/arginine-rich (SR) proteins SRp55, SRp30c, and htra2β1. The first two inhibit both exons; htra2β1 inhibits exon 2 but activates exon 10. By deletion analysis, we identified splicing silencers located at the 5′ end of each exon. Furthermore, we demonstrated that SRp30c and SRp55 bind to both silencers and to each other. In exon 2, htra2β1 binds to the inhibitory heterodimer through its RS1 domain but not to exon 2, whereas in exon 10 the heterodimer may sterically interfere with htra2β1 binding to a purine-rich enhancer (defined by FTDP mutation E10-Δ5 = Δ280K) directly downstream of the silencer. Increased exon 10 inclusion in FTDP mutant ENH (N279K) may arise from abolishing SRp30c binding. Also, htra2β3, a naturally occurring variant of htra2β1, no longer inhibits exon 2 splicing but can partially rescue splicing of exon 10 in FTDP mutation E10-Δ5. This work provides interesting insights into the splicing regulation of the tau gene. Alternative splicing is a versatile and widespread mechanism for generating multiple mRNAs from a single transcript (1.Grabowski P.J. Cell. 1998; 92: 709-712Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar, 2.Graveley B.R. Trends Genet. 2001; 17: 100-107Abstract Full Text Full Text PDF PubMed Scopus (939) Google Scholar). Splicing choices are spatially and temporally regulated, and the ensuing mRNAs produce functionally diverse proteins, contributing significantly to proteomic complexity (2.Graveley B.R. Trends Genet. 2001; 17: 100-107Abstract Full Text Full Text PDF PubMed Scopus (939) Google Scholar, 3.Black D.L. Annu. Rev. Biochem. 2003; 72: 291-336Crossref PubMed Scopus (1979) Google Scholar). Splicing is carried out by the spliceosome, a large and dynamic complex of proteins and small RNAs (4.Stamm S. Ben-Ari S. Rafalska I. Tang Y. Zhang Z. Toiber D. Thanaraj T.A. Soreq H. Gene (Amst.). 2005; 344: 1-20Crossref PubMed Scopus (687) Google Scholar, 5.Neubauer G. King A. Rappsilber J. Calvio C. Watson M. Ajuh P. Sleeman J. Lamond A. Mann M. Nat. Genet. 1998; 20: 46-50Crossref PubMed Scopus (422) Google Scholar). A major question in splicing, and an obvious point of regulation, is how the spliceosome recognizes authentic splicing sites. The rules governing splice site selection are not fully understood; combinatorial control and “weighing” of splice element strength are used to enable precise recognition of the short and degenerate splice sites (6.Smith C.W. Valcárcel J. Trends Biochem. Sci. 2000; 25: 381-388Abstract Full Text Full Text PDF PubMed Scopus (754) Google Scholar). Despite the high fidelity of exon recognition in vivo, it is currently impossible to accurately predict alternative exons (7.Thanaraj T.A. Stamm S. Prog. Mol. Subcell. Biol. 2003; 31: 1-31Crossref PubMed Scopus (33) Google Scholar). Exonic and intronic enhancers and silencers are involved in splicing regulation (8.Blencowe B.J. Trends Biochem. Sci. 2000; 25: 106-110Abstract Full Text Full Text PDF PubMed Scopus (534) Google Scholar, 9.Cartegni L. Wang J. Zhu Z. Zhang M.Q. Krainer A.R. Nucleic Acids Res. 2003; 31: 3568-3571Crossref PubMed Scopus (1271) Google Scholar). Their mutation can result in human disease by causing aberrant splicing (10.Faustino N.A. Cooper T.A. Genes Dev. 2003; 17: 419-437Crossref PubMed Scopus (987) Google Scholar, 11.Stoilov P. Meshorer E. Gencheva M. Glick D. Soreq H. Stamm S. DNA Cell Biol. 2002; 21: 803-818Crossref PubMed Scopus (70) Google Scholar). On the trans side of regulation, mammalian splicing regulators mostly belong to two superfamilies, the serine/argininerich (SR) 1The abbreviations used are: SR, serine/arginine-rich; hnRNP, heterogeneous ribonuclear protein; RRM, RNA recognition motif; RS, arginine/serine-rich; FTDP, frontotemporal dementia; GST, glutathione S-transferase; RT, reverse transcription. proteins and the heterogeneous ribonuclear proteins (hnRNPs), neither of which is exclusively involved in alternative splicing (12.Dreyfuss G. Kim V.N. Kataoka N. Nat. Rev. Mol. Cell. Biol. 2002; 3: 195-205Crossref PubMed Scopus (1122) Google Scholar, 13.Graveley B.R. RNA (N. Y.). 2000; 6: 1197-1211Crossref PubMed Scopus (880) Google Scholar). The former are also components of the spliceosome, whereas the latter are also involved in pre-mRNA transport, RNA stability, and translational regulation. Several mammalian splicing factors are enhanced in or restricted to neurons, among them htra2β3, a splicing variant of htra2β1 (14.Nayler O. Cap C. Stamm S. Genomics. 1998; 53: 191-202Crossref PubMed Scopus (76) Google Scholar). Nevertheless, it appears that the exquisite calibration of mammalian alternative splicing is primarily achieved by SR and hnRNP proteins, which show distinct tissue and developmental ratios, despite their ubiquitous distribution (15.Hanamura A. Cáceres J.F. Mayeda A. Franza Jr., B.R. Krainer A.R. RNA (N. Y.). 1998; 4: 430-444PubMed Google Scholar, 16.Kamma H. Portman D.S. Dreyfuss G. Exp. Cell Res. 1995; 221: 187-196Crossref PubMed Scopus (162) Google Scholar). Tau is a microtubule-associated protein enriched in axons of mature and growing neurons (17.Kempf M. Clement A. Faissner A. Lee G. Brandt R. J. Neurosci. 1996; 16: 5583-5592Crossref PubMed Google Scholar), although it is also found in other cell compartments and types (18.Andreadis A. Biochim. Biophys. Acta. 2005; 1739: 91-103Crossref PubMed Scopus (217) Google Scholar). Hyperphosphorylated, microtubule-dissociated tau protein is the major component of neurofibrillary tangles, a hallmark of several neurodegenerative diseases (18.Andreadis A. Biochim. Biophys. Acta. 2005; 1739: 91-103Crossref PubMed Scopus (217) Google Scholar, 19.Ingram E.M. Spillantini M.G. Trends Mol. Med. 2002; 8: 555-562Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar). The tau gene produces three transcripts that undergo complex alternative splicing: 6 of the 16 tau exons are regulated cassettes (18.Andreadis A. Biochim. Biophys. Acta. 2005; 1739: 91-103Crossref PubMed Scopus (217) Google Scholar). The N terminus of the tau protein interacts with the plasma membrane (20.Brandt R. Léger J. Lee G. J. Cell Biol. 1995; 131: 1327-1340Crossref PubMed Scopus (534) Google Scholar). The structure and function of the tau N terminus are modulated by cassette exons 2 and 3. The C terminus of the tau protein contains four imperfect repeats (encoded by exons 9–12) that act as microtubule binding domains (21.Lee G. Neve R.L. Kosik K.S. Neuron. 1989; 2: 1615-1624Abstract Full Text PDF PubMed Scopus (365) Google Scholar). Exons 2 and 10 are adult-specific in rodents and humans but with a crucial difference relevant to neurodegeneration: in adult rodents, exon 2 remains regulated, but exon 10 becomes constitutive (22.Goedert M. Spillantini M.G. Jakes R. Rutherford D. Crowther R.A. Neuron. 1989; 3: 519-526Abstract Full Text PDF PubMed Scopus (1858) Google Scholar, 23.Goedert M. Spillantini M.G. Potier M.C. Ulrich J. Crowther R.A. EMBO J. 1989; 8: 393-399Crossref PubMed Scopus (844) Google Scholar, 24.Kosik K.S. Orecchio L.D. Bakalis S. Neve R.L. Neuron. 1989; 2: 1389-1397Abstract Full Text PDF PubMed Scopus (518) Google Scholar). In contrast, in adult humans exon 10, like exon 2, remains regulated in the central nervous system (23.Goedert M. Spillantini M.G. Potier M.C. Ulrich J. Crowther R.A. EMBO J. 1989; 8: 393-399Crossref PubMed Scopus (844) Google Scholar, 25.Gao Q.S. Memmott J. Lafyatis R. Stamm S. Screaton G. Andreadis A. J. Neurochem. 2000; 74: 490-500Crossref PubMed Scopus (78) Google Scholar). The difference most likely arises from the details of the cis sequences flanking exon 10 in various organisms (26.Grover A. Houlden H. Baker M. Adamson J. Lewis J. Prihar G. Pickering-Brown S. Duff K. Hutton M. J. Biol. Chem. 1999; 274: 15134-15143Abstract Full Text Full Text PDF PubMed Scopus (243) Google Scholar, 27.Wang J. Gao Q.S. Wang Y. Lafyatis R. Stamm S. Andreadis A. J. Neurochem. 2004; 88: 1078-1090Crossref PubMed Scopus (78) Google Scholar), which in turn affect the regulation exerted by trans factors. Altered splicing factor ratios suppress exon 2 splicing in myotonic dystrophy type 1, a multisystemic disorder whose symptoms include dementia (28.Sergeant N. Sablonniere B. Schraen-Maschke S. Ghestem A. Maurage C.A. Wattez A. Vermersch P. Delacourte A. Hum. Mol. Genet. 2001; 10: 2143-2155Crossref PubMed Scopus (230) Google Scholar). Altered splicing regulation of tau exon 10 can cause inherited frontotemporal dementia (FTDP) with Parkinsonism (17.Kempf M. Clement A. Faissner A. Lee G. Brandt R. J. Neurosci. 1996; 16: 5583-5592Crossref PubMed Google Scholar), almost certainly by disturbing the normal tau isoform ratio (18.Andreadis A. Biochim. Biophys. Acta. 2005; 1739: 91-103Crossref PubMed Scopus (217) Google Scholar, 19.Ingram E.M. Spillantini M.G. Trends Mol. Med. 2002; 8: 555-562Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar). Thus, the splicing regulation of these two exons is directly relevant to neurodegeneration. Both exons show a splicing default pattern of inclusion (25.Gao Q.S. Memmott J. Lafyatis R. Stamm S. Screaton G. Andreadis A. J. Neurochem. 2000; 74: 490-500Crossref PubMed Scopus (78) Google Scholar, 29.Andreadis A. Broderick J.A. Kosik K.S. Nucleic Acids Res. 1995; 23: 3585-3593Crossref PubMed Scopus (68) Google Scholar), are affected by intronic and exonic sequences (25.Gao Q.S. Memmott J. Lafyatis R. Stamm S. Screaton G. Andreadis A. J. Neurochem. 2000; 74: 490-500Crossref PubMed Scopus (78) Google Scholar, 26.Grover A. Houlden H. Baker M. Adamson J. Lewis J. Prihar G. Pickering-Brown S. Duff K. Hutton M. J. Biol. Chem. 1999; 274: 15134-15143Abstract Full Text Full Text PDF PubMed Scopus (243) Google Scholar, 27.Wang J. Gao Q.S. Wang Y. Lafyatis R. Stamm S. Andreadis A. J. Neurochem. 2004; 88: 1078-1090Crossref PubMed Scopus (78) Google Scholar, 29.Andreadis A. Broderick J.A. Kosik K.S. Nucleic Acids Res. 1995; 23: 3585-3593Crossref PubMed Scopus (68) Google Scholar, 30.Li K. Arikan M.C. Andreadis A. Mol. Brain Res. 2003; 116: 94-105Crossref PubMed Scopus (29) Google Scholar, 31.D'Souza I. Poorkaj P. Hong M. Nochlin D. Lee V.M. Bird T.D. Schellenberg G.D. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 5598-5603Crossref PubMed Scopus (421) Google Scholar, 32.D'Souza I. Schellenberg G.D. J. Biol. Chem. 2000; 275: 17700-17709Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 33.D'Souza I. Schellenberg G.D. J. Biol. Chem. 2002; 277: 26587-26599Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar, 34.Hutton M. Lendon C.L. Rizzu P. Baker M. Froelich S. Houlden H. Pickering-Brown S. Chakraverty S. Isaacs A. Grover A. Hackett J. Adamson J. Lincoln S. Dickson D. Davies P. Petersen R.C. Stevens M. de Graaff E. Wauters E. van Baren J. Hillebrand M. Joosse M. Kwon J.M. Nowotny P. Che L.K. Norton J. Morris J.C. Reed L.A. Trojanowski J. Basun H. Lannfelt L. Neystat M. Fahn S. Dark F. Tannenberg T. Dodd P. Hayward N. Kwok J.B.J. Schofield P.R. Andreadis A. Snowden J. Craufurd D. Neary D. Owen F. Oostra B.A. Hardy J. Goate A. van Swieten J. Mann D. Lynch T. Heutink P. Nature. 1998; 393: 702-705Crossref PubMed Scopus (2915) Google Scholar, 35.Stanford P.M. Shepherd C.E. Halliday G.M. Brooks W.S. Schofield P.W. Brodaty H. Martins R.N. Kwok J.B. Schofield P.R. Brain. 2003; 126: 814-826Crossref PubMed Scopus (107) Google Scholar), and are regulated by several splicing factors, most acting as inhibitors (25.Gao Q.S. Memmott J. Lafyatis R. Stamm S. Screaton G. Andreadis A. J. Neurochem. 2000; 74: 490-500Crossref PubMed Scopus (78) Google Scholar, 27.Wang J. Gao Q.S. Wang Y. Lafyatis R. Stamm S. Andreadis A. J. Neurochem. 2004; 88: 1078-1090Crossref PubMed Scopus (78) Google Scholar, 36.Hartmann A.M. Rujescu D. Giannakouros T. Nikolakaki E. Goedert M. Mandelkow E.M. Gao Q.S. Andreadis A. Stamm S. Mol. Cell. Neurosci. 2001; 18: 80-90Crossref PubMed Scopus (87) Google Scholar, 37.Jiang Z. Tang H. Havlioglu N. Zhang X. Stamm S. Yan R. Wu J.Y. J. Biol. Chem. 2003; 278: 18997-19007Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar, 38.Kondo S. Yamamoto N. Murakami T. Okumura M. Mayeda A. Imaizumi K. Genes Cells. 2004; 9: 121-130Crossref PubMed Scopus (57) Google Scholar). In this report we show that these two tau exons are partially regulated by exonic silencers located at their respective 5′ ends, which bind splicing factors SRp30c and SRp55. A third factor, htra2β1, acts in opposite fashion on the two exons: it inhibits exon 2 by binding to the SRp30c·SRp55 heterodimer through its RS1 domain but activates exon 10 by binding to an exonic enhancer located directly downstream of the silencer that recognizes the SRp30c·SRp55 heterodimer. In the case of exon 10, htra2β1 and the SRp30c·SRp55 complex may sterically interfere with each other. Plasmid Construction and Mutagenesis—The starting constructs were SP/2L (Fig. 1A) and SP/10L (Fig. 1C), in which tau genomic fragments are inserted in vector pSPL3 (Invitrogen). SP/2L contains tau exon 2 and 1 kilobase pair of the upstream and downstream native introns flanking exon 2 (30.Li K. Arikan M.C. Andreadis A. Mol. Brain Res. 2003; 116: 94-105Crossref PubMed Scopus (29) Google Scholar). Construct SP/10L contains tau exon 10, 471 bp of its upstream intron, and 408 bp of its downstream intron (27.Wang J. Gao Q.S. Wang Y. Lafyatis R. Stamm S. Andreadis A. J. Neurochem. 2004; 88: 1078-1090Crossref PubMed Scopus (78) Google Scholar). Using directed mutagenesis, as previously described (27.Wang J. Gao Q.S. Wang Y. Lafyatis R. Stamm S. Andreadis A. J. Neurochem. 2004; 88: 1078-1090Crossref PubMed Scopus (78) Google Scholar, 30.Li K. Arikan M.C. Andreadis A. Mol. Brain Res. 2003; 116: 94-105Crossref PubMed Scopus (29) Google Scholar), we created nine deletions that scan exon 2 in SP/2L (E2-Δ1 to E2-Δ9; Fig. 1A) and three deletions and a double point mutation in exon 10 (E10-Δ2/3/4, E10-Δ8/9, and E10-Δ15, following the nomenclature of D'Souza and Schellenberg (32.D'Souza I. Schellenberg G.D. J. Biol. Chem. 2000; 275: 17700-17709Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar), and point mutation M280 in the M3 background (Fig. 1C) (24.Kosik K.S. Orecchio L.D. Bakalis S. Neve R.L. Neuron. 1989; 2: 1389-1397Abstract Full Text PDF PubMed Scopus (518) Google Scholar)). The mutations are diagrammed in Fig. 1, A and C, and the mutagenic primers are listed in Table I. The deletions were verified by PCR (using primers 2PCS and HTI2 for exon 2 and primers HT10PS and HT10N90 for exon 10; Table I) and by sequencing.Table IPrimers used in PCR For creation of deletions and point mutations, we used pairs of these primers and their reverse complements (not shown). The carets in the sequence of the first three primers show the location of the deletion. The mutations in primer M280S are shown in bold. In Fig. 1A, the deleted regions are underlined, and the point mutations are indicated by arrows. S, sense; A, antisense.NameStrandLocationSequenceDeletion and point mutation constructs 2-Δ1SSWithin exon 2CACTGTATGTGTTCCAGA^CTGCAGACCCCCACTGAGG 2-Δ2SSWithin exon 2CTGTATGTGTTCCAGAATCTCCC^CCCCACTGAGGACGGATCTGAGG 2-Δ3SSWithin exon 2CCAGAATCTCCCCTGCAGACCCC^GGATCTGAGGAACCGGGCTC 2-Δ4SSWithin exon 2CTGCAGACCCCCACTGAGGAC^AACCGGGCTCTGAAACCTCTG 2-Δ5SSWithin exon 2CCACTGAGGACGGATCTGAGG^GCTCTGAAACCTCTGATGCTAAG 2-Δ6SSWithin exon 2CTGAGGACGGATCTGAGGAACCGG^ACCTCTGATGCTAAGAGCAC 2-Δ7SSWithin exon 2CGGATCTGAGGAACCGGGCTCTGAAAC^CTAAGAGCACTCCAACAGCGG 2-Δ8SSWithin exon 2GGGCTCTGAAACCTCTGATGCT^TCCAACAGCGGAAGGTGGGC 2-Δ9SSWithin exon 2CCTCTGATGCTAAGAGCACTC^GAAGGTGGGCCCCCCTTCAGACG 10-Δ3/4SSWithin exon 10CTGGCTACCAAAGGTGCAGA^AAGAAGCTGGATCTTAGCAACGTCC 10-Δ8/9SSWithin exon 10GTGCAGATAATTAATAAGAAGCTG^AGCAACGTCCAGTCCAAGTGTGGC 10-Δ15SSWithin exon 10GTCCAAGTGTGGCTCAAAGGAT^CACGTCCCGGGAGGCGGCAGTG M280SSWithin exon 10GTGCAGATAATTAATAATAATCTGGATCTTAGCAAIn vitro constructs, PCR and sequencing 2PCSSExon 2 5′ intronTGTTCCAGCTGTTTCCACAGGGAG 2PCNA3′ end of tau exon 2CTTCCGCTGTTGGAGTGCTCTTAG HTI2AExon 2 3′ intronGCTCCCACCACGCTGTCCTGCAAAGCACCG HT10PSSExon 10 5′ intron plus EcoRI siteGAATTCGAGCAAGTAGCGGGTCCAG HT10N90AExon 10 3′ intronACTGCCGCCTCCCGGGACGTGTTTGRT-PCR SPL-LSSIn SPL3 vectorTCTGAGTCACCTGGACAACCTCAAAGG SPL-LNAIn SPL3 vectorATCTCAGTGGTATTTGTGAGCCAGGGC SVP2SIn SPL3 vectorCTGAGCTATTCCAGAAGTAGTGAGGAGGC Open table in a new tab To generate riboprobes, we created constructs 81+2PCS/2PCN and E10+30. 81+2PCS/2PCN contains tau exon 2 plus 150 nucleotides of its upstream intron replacing part of the intron and second exon of in vitro splicing vector 81/AdML (39.Michaud S. Reed R. Genes Dev. 1993; 7: 1008-1020Crossref PubMed Scopus (141) Google Scholar). E10+30 contains all of tau exon 10 and 30 nucleotides of its downstream intron inserted into vector pGEM-TE (Promega). We also made deletions E2-Δ1, E2-Δ2, and E2-Δ4 (Fig. 1A) in81+2PCS/2PCN and deletion E10-Δ3/4 (Fig. 1C) inE10+30. Protein Expression in Cells and Bacteria and GST Pull-down Assays—For eukaryotic expression, cDNAs were expressed from the following promoters: cytomegalovirus (CMV) for htra2β1, SRp30c, SRp55, and the variants of htra2β1 and SRp30c (14.Nayler O. Cap C. Stamm S. Genomics. 1998; 53: 191-202Crossref PubMed Scopus (76) Google Scholar, 40.Cáceres J.F. Misteli T. Screaton G.R. Spector D.L. Krainer A.R. J. Cell Biol. 1997; 138: 225-238Crossref PubMed Scopus (326) Google Scholar, 41.Screaton G.R. Cáceres J.F. Mayeda A. Bell M.V. Plebanski M. Jackson D.G. Bell J.I. Krainer A.R. EMBO J. 1995; 14: 4336-4349Crossref PubMed Scopus (246) Google Scholar); and SV40 for the variants of SRp55 (42.Lemaire R. Winne A. Sarkissian M. Lafyatis R. Eur. J. Immunol. 1999; 29: 823-837Crossref PubMed Google Scholar). Western blots show that the factor variants express stable proteins in equivalent amounts (data not shown). For protein interactions in vitro, htra2β1 and SRp55 were cloned into pGEX-4T1 and pGEX-4T3, respectively (Amersham Biosciences). SRp30c (a generous gift from Dr. Chris Lorson) was in vector pRSET-c (Invitrogen). The recombinant proteins were produced and purified from Escherichia coli strain BL21 (Stratagene) according to the vendor's instructions. For protein and RNA pull-downs, htra2β1 and SRp55 were cloned into pFLAG-CMV-6c, and SRp30c was cloned into pFLAG-CMV-6b (Sigma). Protein expression was verified by using anti-FLAG M2 monoclonal antibody (Sigma) on Western blots of crude lysates from cells transfected with each construct. 1 μl of a GST-factor fusion or GST alone was incubated with 1 μl of SRp30c-His or with 1 μl of htra2β1-FLAG in 0.5 ml of loading buffer (1% Triton X-100, 10% glycerol, 0.25 m NaCl, 1 mm EDTA, and 50 mm Tris, pH 7.5) for 1 h at 4 °C and then incubated with 10 μl (bed volume) of glutathione-agarose beads (Sigma) for 1 h at 4 °C. The beads were washed three times with 500 μl of wash buffer (0.05% Triton X-100, 10% glycerol, 50 mm NaCl, and 50 mm Hepes, pH 7.5). The retained proteins were run on 12% SDS-PAGE and immunoblotted with mouse monoclonal antibodies as primary antibodies (anti-His (Invitrogen) at 1:3000 or anti-FLAG M2 (Sigma) at 1:2500) and goat anti-mouse IgG (Zymed Laboratories Inc.) at 1:10,000 as secondary antibody. Cell Culture, Transfections, and RNA Preparation—Monkey kidney (COS) and human epithelial (HeLa) cells were maintained in Dulbecco's modified Eagle's medium plus 10% fetal calf serum. Plasmid DNA was prepared by Qiagen Tip-50s and introduced into cells by lipofection (LT1; Panvera). Total RNA was isolated by the TRIzol method (Invitrogen). Reverse Transcription and PCRs—We performed PCR analysis of RNA as previously described (30.Li K. Arikan M.C. Andreadis A. Mol. Brain Res. 2003; 116: 94-105Crossref PubMed Scopus (29) Google Scholar) with primer pair SPL-LS/SPL-LN or SVP2/SPL-LN (Table I). The isoform ratio was calculated by scanning the bands from three independent transfections using the One-Dscan program and the Scanalytics IPLab software. Riboprobe Generation, UV-cross-linking, and RNA-protein Immunoprecipitation—We transcribed 81+2PCS/2PCN, E10+30, and their variants in vitro using the Promega transcription kit, [32P]CTP, [32P]UTP, or both (Amersham Biosciences) and RNA polymerase T3 and T7, respectively (Promega). For UV-cross-linking, exon 2 riboprobes and GST fusions of htra2β1, SRp30c, and SRp55 were incubated at room temperature for 20 min in binding buffer (10 mm Hepes, pH 7.9, 1 mm EDTA, 1 mm dithiothreitol, 5% glycerol, 50 mm KCl, and 1 μg of tRNA). Reaction mixtures were pre-chilled on ice and irradiated with UV light (254 nm) for 10 min. The samples were digested with RNase A at 37 °C for 1 h and run on 12% SDS-PAGE. The gels were fixed, dried, and subjected to autoradiography. For RNA pull-downs, equal counts of the riboprobes were added to lysates from HeLa cells transfected with htra2β1, SRp30c, and SRp55 FLAG fusions. The vectors were used as negative controls. We immunoprecipitated the proteins using anti-FLAG monoclonal antibody conjugated with agarose (Sigma) according to the Novagen instructions and counted the radioactivity of the precipitated pellet in a beta scintillation counter. Scanning of Exon 2 by Deletions Uncovers an Exonic Silencer—Because the default behavior of exon 2 and 10 is inclusion (25.Gao Q.S. Memmott J. Lafyatis R. Stamm S. Screaton G. Andreadis A. J. Neurochem. 2000; 74: 490-500Crossref PubMed Scopus (78) Google Scholar, 29.Andreadis A. Broderick J.A. Kosik K.S. Nucleic Acids Res. 1995; 23: 3585-3593Crossref PubMed Scopus (68) Google Scholar), the most likely explanation for their exclusion in fetal brain (18.Andreadis A. Biochim. Biophys. Acta. 2005; 1739: 91-103Crossref PubMed Scopus (217) Google Scholar) is that in that tissue an inhibitory protein recognizes a silencer sequence on each exon. In our previous work we found one weak silencer within exon 2 by point mutagenesis (30.Li K. Arikan M.C. Andreadis A. Mol. Brain Res. 2003; 116: 94-105Crossref PubMed Scopus (29) Google Scholar). However, this element is context-specific and is not influenced by factors that strongly inhibit exon 2 splicing (30.Li K. Arikan M.C. Andreadis A. Mol. Brain Res. 2003; 116: 94-105Crossref PubMed Scopus (29) Google Scholar), suggesting that the point mutation may strengthen an enhancer rather than disrupt a silencer. In this study, we decided to employ a strategy used successfully for tau exon 10 (37.Jiang Z. Tang H. Havlioglu N. Zhang X. Stamm S. Yan R. Wu J.Y. J. Biol. Chem. 2003; 278: 18997-19007Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar, 38.Kondo S. Yamamoto N. Murakami T. Okumura M. Mayeda A. Imaizumi K. Genes Cells. 2004; 9: 121-130Crossref PubMed Scopus (57) Google Scholar) by creating nine deletions that scan exon 2 (Fig. 1A). Fig. 1B shows the splicing behavior of the nine deletions. Two (E2-Δ7 and E2-Δ8) leave exon 2 splicing essentially unchanged. Four (E2-Δ3, E2-Δ5, E2-Δ6, and E2-Δ9) show a significant decrease of exon 2 inclusion, and one (E2-Δ4) shows a moderate decrease of exon 2 inclusion, suggesting that these deletions excise exonic enhancers; E2-Δ4 and E2-Δ5 partly overlap an enhancer previously defined by a point mutation (E2–6, shown in Fig. 1A) (30.Li K. Arikan M.C. Andreadis A. Mol. Brain Res. 2003; 116: 94-105Crossref PubMed Scopus (29) Google Scholar). Finally, two (E2-Δ1 and E2-Δ2) increase exon 2 inclusion, indicating that the first ∼20 residues of exon 2 act as a silencer. In the case of exon 10, we found that the regions defined by E10-Δ2/3/4, E10-Δ8/9, and E10-Δ15 act as splicing silencers (Fig. 2C, lanes 3, 5, and 7; Fig. 2D, lane 3), in agreement with previous reports (26.Grover A. Houlden H. Baker M. Adamson J. Lewis J. Prihar G. Pickering-Brown S. Duff K. Hutton M. J. Biol. Chem. 1999; 274: 15134-15143Abstract Full Text Full Text PDF PubMed Scopus (243) Google Scholar). Conversely, mutant M280 defines an enhancer (Fig. 4E, lane 1). This mutant is the obverse of mutant ENH (N279K) that extends a purine-rich region that binds htra2β1 (27.Wang J. Gao Q.S. Wang Y. Lafyatis R. Stamm S. Andreadis A. J. Neurochem. 2004; 88: 1078-1090Crossref PubMed Scopus (78) Google Scholar, 37.Jiang Z. Tang H. Havlioglu N. Zhang X. Stamm S. Yan R. Wu J.Y. J. Biol. Chem. 2003; 278: 18997-19007Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar) (Fig. 3B, lane 1; Fig. 4D, lane 1). Deletion E10-Δ5 (also denoted Δ280K) overlaps mutation M280 and almost completely abolishes exon 10 splicing (27.Wang J. Gao Q.S. Wang Y. Lafyatis R. Stamm S. Andreadis A. J. Neurochem. 2004; 88: 1078-1090Crossref PubMed Scopus (78) Google Scholar, 31.D'Souza I. Poorkaj P. Hong M. Nochlin D. Lee V.M. Bird T.D. Schellenberg G.D. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 5598-5603Crossref PubMed Scopus (421) Google Scholar) (Fig. 4F, lane 1). We believe that inclusion of exon 10 in the M280 mutant would be even lower in the absence of the compensating M3 mutation, which affects a silencer (26.Grover A. Houlden H. Baker M. Adamson J. Lewis J. Prihar G. Pickering-Brown S. Duff K. Hutton M. J. Biol. Chem. 1999; 274: 15134-15143Abstract Full Text Full Text PDF PubMed Scopus (243) Google Scholar, 27.Wang J. Gao Q.S. Wang Y. Lafyatis R. Stamm S. Andreadis A. J. Neurochem. 2004; 88: 1078-1090Crossref PubMed Scopus (78) Google Scholar, 31.D'Souza I. Poorkaj P. Hong M. Nochlin D. Lee V.M. Bird T.D. Schellenberg G.D. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 5598-5603Crossref PubMed Scopus (421) Google Scholar).Fig. 4The N-terminal RS domain (RS1) of htra2β1 is required for inhibition of exon 2 splicing, whereas its C-terminal RS domain (RS2) is crucial for activation of exon 10 splicing. A, diagram of htra2β1 deletion variants. The RRM motifs and RS regions are indicated. Numbers show the amino acid composition of the variants. B, RT-PCR products come from 1:1 co-transfections of construct SP/2L with the htra2β1 deletion variants in COS cells. C-F, RT-PCRs from 1:1 co-transfections of constructs (C) SP/10L, (D) E10-Δ5, (E) ENH, and (F) M280/M3 with the htra2β1 deletion variants in COS cells. Exon ratio calculations and graph conventions are as described in Fig. 1. Primer pair: SPL-LS/SPL-LN.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig. 3Inhibitors SRp55 and SRp30c are dominant over activator htra2β1, but mutant ENH is no longer inhibited by SRp30c. RT-PCRs from co-transfections of 1 μg of (A) SP/10L and (B) ENH with varying amounts of the three factors in COS cells. The numbers in the middle show the amount of factor plasmid added (in micrograms). Exon ratio calculations, graph conventions, and primers are as described in Fig. 1. Primer pair: SPL-LS/SPL-LN.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Combinations of Deletion Constructs and Regulators Pinpoint Possible Binding Sites for SRp30c, SRp55, and htra2β1 within Exons 2 and 10 —Our previous work showed that SRp30c and SRp55 strongly inhibit exon 2 splicing (30.Li K. Arikan M.C. Andreadis A. Mol. Brain Res. 2003; 116: 94-105Crossref PubMed Scopus (29) Google Scholar), whereas htra2β1 strongly inhibits exon 2 (30.Li K. Arikan M.C. Andreadis A. Mol. Brain Res. 2003; 116: 94-105Crossref PubMed" @default.
• W2079520339 created "2016-06-24" @default.
• W2079520339 creator A5002412366 @default.
• W2079520339 creator A5032437502 @default.
• W2079520339 creator A5032903359 @default.
• W2079520339 creator A5041074022 @default.
• W2079520339 creator A5043997581 @default.
• W2079520339 creator A5051794852 @default.
• W2079520339 date "2005-04-01" @default.
• W2079520339 modified "2023-10-11" @default.
• W2079520339 title "Tau Exons 2 and 10, Which Are Misregulated in Neurodegenerative Diseases, Are Partly Regulated by Silencers Which Bind a SRp30c·SRp55 Complex That Either Recruits or Antagonizes htra2β1" @default.
• W2079520339 cites W1481835696 @default.
• W2079520339 cites W150987474 @default.
• W2079520339 cites W1511517753 @default.
• W2079520339 cites W1542398517 @default.
• W2079520339 cites W1546538401 @default.
• W2079520339 cites W1594645405 @default.
• W2079520339 cites W1685478544 @default.
• W2079520339 cites W1926421284 @default.
• W2079520339 cites W1970186069 @default.
• W2079520339 cites W1970503178 @default.
• W2079520339 cites W1971125966 @default.
• W2079520339 cites W1972355725 @default.
• W2079520339 cites W1974293813 @default.
• W2079520339 cites W1985696544 @default.
• W2079520339 cites W1988643985 @default.
• W2079520339 cites W1990372895 @default.
• W2079520339 cites W1991800715 @default.
• W2079520339 cites W1993133035 @default.
• W2079520339 cites W2002039442 @default.
• W2079520339 cites W2003060921 @default.
• W2079520339 cites W2008675281 @default.
• W2079520339 cites W2011842392 @default.
• W2079520339 cites W2013013393 @default.
• W2079520339 cites W2018393974 @default.
• W2079520339 cites W2023506303 @default.
• W2079520339 cites W2023684724 @default.
• W2079520339 cites W2028818794 @default.
• W2079520339 cites W2039270622 @default.
• W2079520339 cites W2041998806 @default.
• W2079520339 cites W2045131720 @default.
• W2079520339 cites W2051233811 @default.
• W2079520339 cites W2053652338 @default.
• W2079520339 cites W2057157392 @default.
• W2079520339 cites W2071669944 @default.
• W2079520339 cites W2075701979 @default.
• W2079520339 cites W2080635175 @default.
• W2079520339 cites W2087672655 @default.
• W2079520339 cites W2089465951 @default.
• W2079520339 cites W2098759196 @default.
• W2079520339 cites W2103116226 @default.
• W2079520339 cites W2105234784 @default.
• W2079520339 cites W2107881958 @default.
• W2079520339 cites W2109936378 @default.
• W2079520339 cites W2113112766 @default.
• W2079520339 cites W2115289458 @default.
• W2079520339 cites W2122115272 @default.
• W2079520339 cites W2125946663 @default.
• W2079520339 cites W2127118078 @default.
• W2079520339 cites W2129682060 @default.
• W2079520339 cites W2136860943 @default.
• W2079520339 cites W2153279694 @default.
• W2079520339 cites W2159377066 @default.
• W2079520339 cites W2159864549 @default.
• W2079520339 cites W2165954869 @default.
• W2079520339 cites W2167616277 @default.
• W2079520339 cites W2169082772 @default.
• W2079520339 cites W48376435 @default.
• W2079520339 doi "https://doi.org/10.1074/jbc.m413846200" @default.
• W2079520339 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15695522" @default.
• W2079520339 hasPublicationYear "2005" @default.
• W2079520339 type Work @default.
• W2079520339 sameAs 2079520339 @default.
• W2079520339 citedByCount "72" @default.
• W2079520339 countsByYear W20795203392012 @default.
• W2079520339 countsByYear W20795203392013 @default.
• W2079520339 countsByYear W20795203392014 @default.
• W2079520339 countsByYear W20795203392015 @default.
• W2079520339 countsByYear W20795203392016 @default.
• W2079520339 countsByYear W20795203392017 @default.
• W2079520339 countsByYear W20795203392018 @default.
• W2079520339 countsByYear W20795203392019 @default.
• W2079520339 countsByYear W20795203392020 @default.
• W2079520339 countsByYear W20795203392021 @default.
• W2079520339 countsByYear W20795203392022 @default.
• W2079520339 countsByYear W20795203392023 @default.
• W2079520339 crossrefType "journal-article" @default.
• W2079520339 hasAuthorship W2079520339A5002412366 @default.
• W2079520339 hasAuthorship W2079520339A5032437502 @default.
• W2079520339 hasAuthorship W2079520339A5032903359 @default.
• W2079520339 hasAuthorship W2079520339A5041074022 @default.
• W2079520339 hasAuthorship W2079520339A5043997581 @default.
• W2079520339 hasAuthorship W2079520339A5051794852 @default.
• W2079520339 hasBestOaLocation W20795203391 @default.
• W2079520339 hasConcept C104317684 @default.
• W2079520339 hasConcept C169760540 @default.
• W2079520339 hasConcept C36823959 @default.
• W2079520339 hasConcept C54355233 @default.

• next