FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2079672511> ?p ?o ?g. }

• W2079672511 endingPage "19349" @default.
• W2079672511 startingPage "19340" @default.
• W2079672511 abstract "The central region (residues 125–385) of the integrin β2 subunit is postulated to adopt an I-domain-like fold (the β2I-domain) and to play a critical role in ligand binding and heterodimer formation. To understand structure-function relationships of this region of β2, a homolog-scanning mutagenesis approach, which entails substitution of nonconserved hydrophilic sequences within the β2I-domain with their homologous counterparts of the β1I-domain, has been deployed. This approach is based on the premise that β1 and β2 are highly homologous, yet recognize different ligands. Altogether, 16 segments were switched to cover the predicted outer surface of the β2I-domain. When these mutant β2 subunits were transfected together with wild-type αM in human 293 cells, all 16 β2 mutants were expressed on the cell surface as heterodimers, suggesting that these 16 sequences within the β2I-domain are not critically involved in heterodimer formation between the αM and β2 subunits. Using these mutant αMβ2 receptors, we have mapped the epitopes of nine β2I-domain specific mAbs, and found that they all recognized at least two noncontiguous segments within this domain. The requisite spatial proximity among these non-linear sequences to form the mAb epitopes supports a model of an I-domain-like fold for this region. In addition, none of the mutations that abolish the epitopes of the nine function-blocking mAbs, including segment Pro192–Glu197, destroyed ligand binding of the αMβ2 receptor, suggesting that these function-blocking mAbs inhibit αMβ2 function allosterically. Given the recent reports implicating the segment equivalent to Pro192–Glu197 in ligand binding by β3 integrins, these data suggest that ligand binding by the β2 integrins occurs via a different mechanism than β3. Finally, both the conformation of the β2I-domain and C3bi binding activity of αMβ2 were dependent on a high affinity Ca2+ binding site (K d = 105 μm), which is most likely located within this region of β2. The central region (residues 125–385) of the integrin β2 subunit is postulated to adopt an I-domain-like fold (the β2I-domain) and to play a critical role in ligand binding and heterodimer formation. To understand structure-function relationships of this region of β2, a homolog-scanning mutagenesis approach, which entails substitution of nonconserved hydrophilic sequences within the β2I-domain with their homologous counterparts of the β1I-domain, has been deployed. This approach is based on the premise that β1 and β2 are highly homologous, yet recognize different ligands. Altogether, 16 segments were switched to cover the predicted outer surface of the β2I-domain. When these mutant β2 subunits were transfected together with wild-type αM in human 293 cells, all 16 β2 mutants were expressed on the cell surface as heterodimers, suggesting that these 16 sequences within the β2I-domain are not critically involved in heterodimer formation between the αM and β2 subunits. Using these mutant αMβ2 receptors, we have mapped the epitopes of nine β2I-domain specific mAbs, and found that they all recognized at least two noncontiguous segments within this domain. The requisite spatial proximity among these non-linear sequences to form the mAb epitopes supports a model of an I-domain-like fold for this region. In addition, none of the mutations that abolish the epitopes of the nine function-blocking mAbs, including segment Pro192–Glu197, destroyed ligand binding of the αMβ2 receptor, suggesting that these function-blocking mAbs inhibit αMβ2 function allosterically. Given the recent reports implicating the segment equivalent to Pro192–Glu197 in ligand binding by β3 integrins, these data suggest that ligand binding by the β2 integrins occurs via a different mechanism than β3. Finally, both the conformation of the β2I-domain and C3bi binding activity of αMβ2 were dependent on a high affinity Ca2+ binding site (K d = 105 μm), which is most likely located within this region of β2. fibrinogen Dulbecco's phosphate-buffered saline fluorescence-activated cell sorting monoclonal antibody metal ion-dependent adhesion site polyacrylamide gel electrophoresis fluorescein isothiocyanate phosphate-buffered saline αMβ2 is a member of the β2 integrin subfamily, which includes αLβ2 (LFA-1, CD11a/CD18), αXβ2 (p150,95, CD11c/CD18), and αDβ2. Like all integrins, the β2 subfamily members are expressed on cell surfaces as heterodimers, but their expression is restricted primarily to leukocytes. αMβ2 plays a multifunctional role on leukocytes. As examples, this integrin is important in leukocyte adhesion and transmigration through endothelium, in activation of neutrophils and monocytes, in phagocytosis of foreign material, and in apoptosis (1Plow E.F. Haas T.A. Zhang L. Loftus J.C. Smith J.W. J. Biol. Chem. 2000; 275: 21785-21788Abstract Full Text Full Text PDF PubMed Scopus (1126) Google Scholar, 2Springer T.A. Annu. Rev. Physiol. 1995; 57: 827-872Crossref PubMed Scopus (1398) Google Scholar). A wide variety of protein and non-protein ligands have been identified that interact with αMβ2, with representative examples including fibrinogen (Fg)1(3Altieri D.C. Bader R. Mannucci P.M. Edgington T.S. J. Cell Biol. 1988; 107: 1893-1900Crossref PubMed Scopus (304) Google Scholar), ICAM-1 (4Diamond M.S. Staunton D.E. de Fougerolles A.R. Stacker S.A. Garcia-Aguilar J. Hibbs M.L. Springer T.A. J. Cell Biol. 1990; 111: 3129-3139Crossref PubMed Scopus (780) Google Scholar), C3bi (5Wright S.D. Rao P.E. Van Voorhis W.C. Craigmyle L.S. Iida K. Talle M.A. Westberg E.F. Goldstein G. Silverstein S.C. Proc. Natl. Acad. Sci. U. S. A. 1983; 80: 5699-5703Crossref PubMed Scopus (475) Google Scholar), zymosan (6Ross G.D. Cain J.A. Lachmann P.J. J. Immunol. 1985; 134: 3307-3315PubMed Google Scholar), and neutrophil inhibitory factor (7Moyle M. Foster D.L. McGrath D.E. Brown S.M. Laroche Y. De Meutter J. Bogowitz C.A. Fried V.A. Ely J.A. J. Biol. Chem. 1994; 269: 10008-10015Abstract Full Text PDF PubMed Google Scholar). C3bi and Fg are two particularly important ligands of αMβ2; C3bi is critical to phagocytosis of opsonized foreign particles, and Fg, which interacts with αMβ2 via its γ-module (8Ugarova T.P. Solovjov D.A. Zhang L. Loukinov D.I. Yee V.C. Medved L.V. Plow E.F. J. Biol. Chem. 1998; 273: 22519-22527Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar), is involved in leukocyte adhesion and migration. Central to the ligand binding function of αMβ2 is its I(A) domain. The αMI-domain is an inserted segment of ∼200 amino acids and is highly homologous to several I-domains found in integrin α subunits (9Michishita M. Videm V. Arnaout M.A. Cell. 1993; 72: 857-867Abstract Full Text PDF PubMed Scopus (318) Google Scholar). The three-dimensional structures of several I-domains (αM, αL, αX, α2, etc.) have been solved (10Lee J.O. Rieu P. Arnaout M.A. Liddington R.C. Cell. 1995; 80: 631-638Abstract Full Text PDF PubMed Scopus (806) Google Scholar, 11Qu A. Leahy D.J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 10277-10281Crossref PubMed Scopus (290) Google Scholar, 12Emsley J. King S.L. Bergelson J.M. Liddington R.C. J. Biol. Chem. 1997; 272: 28512-28517Abstract Full Text Full Text PDF PubMed Scopus (262) Google Scholar, 13Emsley J. Knight C.G. Farndale R.W. Barnes M.J. Liddington R.C. Cell. 2000; 101: 47-56Abstract Full Text Full Text PDF PubMed Scopus (845) Google Scholar). These I-domains are composed of six or seven α-helices and six β-sheets arranged in a Rossman-type fold. A cation binding site, termed the MIDAS motif, is located within the I-domain. In the MIDAS motif, cation coordination is provided by a DXSXS sequence and by other two distant (in terms of primary sequence) oxygenated residues (10Lee J.O. Rieu P. Arnaout M.A. Liddington R.C. Cell. 1995; 80: 631-638Abstract Full Text PDF PubMed Scopus (806) Google Scholar). In addition to the α subunits with their I-domains, the β subunits also contribute to ligand binding to integrins. Studies of the β subunits have been focused primarily on their central regions (residues ∼125–385 in a typical β subunit of >700 amino acids). This region is predicted to contain a MIDAS motif, and candidate residues for cation coordination have been identified by mutagenesis (14Lin C.K.E. Ratnikov B.I. Tsai P.M. Gonzalez E.R. McDonald S. Pelletier A.J. Smith J.W. J. Biol. Chem. 1997; 272: 14236-14243Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar, 15Puzon-McLaughlin W. Takada Y. J. Biol. Chem. 1996; 271: 20438-20443Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar, 16Tozer E.C. Liddington R.C. Sutcliffe M.J. Smeeton A.H. Loftus J.C. J. Biol. Chem. 1996; 271: 21978-21984Abstract Full Text Full Text PDF PubMed Scopus (161) Google Scholar, 17Goodman T.G. Bajt M.L. J. Biol. Chem. 1996; 271: 23729-23736Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar). Protein sequence analysis suggests that this region may also fold into an I-domain-like structure (10Lee J.O. Rieu P. Arnaout M.A. Liddington R.C. Cell. 1995; 80: 631-638Abstract Full Text PDF PubMed Scopus (806) Google Scholar, 18Tuckwell D.S. Humphries M.J. FEBS Lett. 1997; 400: 297-303Crossref PubMed Scopus (100) Google Scholar). However, due to the low homology between the I-domains of the α and β subunits, it is uncertain whether this putative I-domain region does, indeed, fold into an I-domain, or merely contains a MIDAS motif. What is clear is that this region does play a critical role in mediating ligand binding to integrins. In β3, it was reported that bound RGD peptides can be cross-linked to this region (19D'Souza S.E. Ginsberg M.H. Burke T.A. Lam S.C.T. Plow E.F. Science. 1988; 242: 91-93Crossref PubMed Scopus (292) Google Scholar, 20Smith J.W. Cheresh D.A. J. Biol. Chem. 1988; 263: 18726-18731Abstract Full Text PDF PubMed Google Scholar). Substituting this segment within the β1I- or β5I-domain with its homologous counterpart from β3 imparts β3ligand specificity to the β1 or β5 integrin (21Lin E.C. Ratnikov B.I. Tsai P.M. Carron C.P. Myers D.M. Barbas C.F. Smith J.W. J. Biol. Chem. 1997; 272: 23912-23920Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar, 22Takagi J. Kamata T. Meredith J. Puzon-McLaughlin W. Takada Y. J. Biol. Chem. 1997; 272: 19794-19800Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar). A natural mutation of Arg214 to Gln in β3 abolishes ligand binding of αIIbβ3, and a synthetic peptide containing the sequence of β3 (211) blocks Fg binding to purified αIIbβ3 (23Bajt M.L. Ginsberg M.H. Frelinger III, A.L. Berndt M.C. Loftus J.C. J. Biol. Chem. 1992; 267: 3789-3794Abstract Full Text PDF PubMed Google Scholar). Similar observations implicate the β1I-domain in the ligand binding functions of the β1 integrins. For example, it was shown that both activating and inhibiting mAbs recognize a small stretch of β1 (residues 124–160 and 207–218) (24Shih D.T. Boettiger D. Buck C.A. J. Cell Sci. 1997; 110: 2619-2628Crossref PubMed Google Scholar, 25Takada Y. Puzon W. J. Biol. Chem. 1993; 268: 17597-17601Abstract Full Text PDF PubMed Google Scholar). Recently, the D134 XSXS sequence of the proposed MIDAS motif within β2 was implicated in the binding of Fg, C3bi, and ICAM-1 to αMβ2 (26Bajt M.L. Goodman T.G. McGuire S.L. J. Biol. Chem. 1995; 270: 94-98Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar, 27Zhang L. Plow E.F. J. Biol. Chem. 1996; 271: 18211-18216Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). These data indicate that this putative I-domain is important to ligand binding functions of the β2 integrins as well. Recently, we have deployed homolog-scanning mutagenesis (28Cunningham B.C. Jhurani P. Ng P. Wells J.A. Science. 1989; 243: 1330-1336Crossref PubMed Scopus (265) Google Scholar) to identify several segments critical to Fg and C3bi binding within the αMI-domain (8Ugarova T.P. Solovjov D.A. Zhang L. Loukinov D.I. Yee V.C. Medved L.V. Plow E.F. J. Biol. Chem. 1998; 273: 22519-22527Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar, 29Zhang L. Plow E.F. Biochemistry. 1999; 38: 8064-8071Crossref PubMed Scopus (68) Google Scholar). This approach entails switching sequences within the αMI-domain to their homologous sequences within the αLI-domain. This approach is feasible because the αMI- and αLI-domains are highly homologous, but αMβ2 and αLβ2 recognize different ligands. In the study reported here, we have applied this same strategy to the putative β2I-domain region. Our data are consistent with folding of the region into an I-domain-like structure. However, our results suggest that ligand recognition by the region of the β2subunit is achieved in a distinct fashion from that involved in ligand recognition by the β3 integrins. In addition, we show that the epitopes of several blocking mAbs map to this region but their inhibitory activity is likely to be achieved via an allosteric mechanism. Finally, we show that the conformation and ligand binding functions of the β2I-domain are enhanced selectively by Ca2+, suggesting a unique cation-specific effect on the β2I-domain. Taken together, these results provide insight into the structure-function relationships of αMβ2, which may also extend to other integrins in general. Human kidney 293 cells and the expression vector, pCIS2M, were gifts from Dr. F. J. Castellino (University of Notre Dame, Notre Dame, IN). The cDNAs of CD11b and CD18 were obtained from Dr. B. Karan-Tamir (Amgen, Thousand Oaks, CA). The recombinant γ-module of Fg was provided by Dr. Medved (American Red Cross, Rockville, MD). The mAbs used in this study were obtained from the following sources. mAb 6.5E was provided by Dr. D. P. Andrew (Amgen Inc., Boulder, CO); mAb MHM23 was from Dako (Carpinteria, CA); IB4 and TS1/18 were from the ATCC (Rockville, MD); mAb 44 was from Sigma; CLB-LFA-1/1,54 (CLB54) was from RDI (Flanders, NJ); YFC118.3 and R3.3 were from Chemicon (Temecula, CA); H20A was from VMRD Inc. (Pullman, WA); 6.7 was from PharMingen (San Diego, CA); 685A5, MEM-48, and 7E4 were from Biodesign (Kennebunk, ME). The detailed procedures used for homolog-scanning mutagenesis and to establish stable cell lines expressing wild-type and mutant αMβ2 receptors in human kidney 293 cells have been published (30Zhang L. Plow E.F. J. Biol. Chem. 1997; 272: 17558-17564Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). Similar methods were used to express the αMβ2 heterodimer and the single β2 subunit on the surface of the Chinese hamster ovary cells. To obtain cell lines with similar expressions, each mutant cell line was subcloned by cell sorting using an αM-specific mAb (2LPM19c). Up to 20 colonies were selected and analyzed for integrin expression by FACS analysis. Cells with receptor expression levels similar to wild-type αMβ2 were chosen, and five different subclones were used for the subsequent studies reported in this work. To exclude the possibility of subcloning artifacts, all studies were repeated using the original pool of each mutant receptor. Cells expressing wild-type and mutant αMβ2 were washed once with DPBS, biotinylated with EZ-link Sulfo-NHS-LC-Biotin (sulfosuccinimidyl 6-biotinamidohexanoate, Pierce), and lysed with a solution containing 20 mm Tris-Cl, 150 mm NaCl, pH 7.4, 1% Triton X-100, 1 mm phenylmethylsulfonyl fluoride, 10 mm benzamidine, 25 μg/ml soybean trypsin inhibitor, and 20 μg/ml leupeptin. The cell lysates were subjected to immunoprecipitation with an αM-specific mAb 44a and a β2-specific mAb 6.7. The immunoprecipitates were analyzed on 7% acrylamide gels, and the surface-expressed αMβ2 was visualized by Western blotting using a horseradish peroxidase-avidin conjugate. The ligand binding activity of the β2 mutants was assessed using two classic αMβ2 ligands, C3bi and Fg, according to our published methods (27Zhang L. Plow E.F. J. Biol. Chem. 1996; 271: 18211-18216Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). For adhesion of αMβ2-expressing cells to Fg, the recombinant γ-module (10 μg/ml) was deposited at the center of each well in a 24-well non-tissue culture polystyrene plate. After blocking with 400 μl of 0.05% polyvinylpyrrolidone in DPBS, a total of 2 × 106 cells in Hank's balanced salt solution containing 1 mm Ca2+ and 1 mm Mg2+was added to each well and incubated at 37 °C for 20 min. The unbound cells were removed by three washes with DPBS, and the adherent cells were quantified by cell-associated acid phosphatase as described previously (27Zhang L. Plow E.F. J. Biol. Chem. 1996; 271: 18211-18216Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). A total of 106 cells expressing wild-type or mutant αMβ2 in Hank's balanced salt solution containing 1 mm Mg2+ and 1 mm Ca2+ was incubated with 1 μg of mAb for 30 min at 4 °C. A subtype-matched mouse IgG served as a control. After washing with PBS, cells were mixed with FITC-conjugated goat-anti-mouse IgG(H+L) F(ab′)2 fragment (1:20 dilution) (Zymed Laboratories Inc.), and kept at 4 °C for another 30 min. Cells were then washed with PBS and resuspended in 500 μl of DPBS. The FACS analyses were performed using FACScan (Becton-Dickinson), counting 10,000 events. Mean fluorescence intensities were quantified using the FACScan program, and these values were used to compare αMβ2 expression levels or the reactivity of the different αMβ2mutants with specific mAbs. As shown in Fig.1, the purported I-domain within integrin β2 shares considerable sequence homology with the corresponding region of the β1 subunit. The major sequence differences are confined to regions that are predicted to be hydrophilic and surface-oriented based on hydropathy plots and molecular modeling, and, thereby, are the segments that are likely to contribute to the unique functions of the β2 integrins. For example, the β2 subunit partners with an entirely separate set of α subunits from β1, and the β2 integrins recognize a set of ligands very distinct from the β1 integrins (there is no known peptide sequence recognized by both β1 and β2 integrins). Based on the sequence homology between the β1I- and β2I-domains, we sought to systematically probe the function of the hydrophilic and unique segments of this region (residues 125–385) using homolog-scanning mutagenesis. Accordingly, we replaced 16 non-conserved segments of three to nine residues within the β2I-domain with the corresponding segments from the β1 subunit (Fig. 1). These 16 segments covered the entire hydrophilic region of the β2I-domain predicted from hydropathy plots and molecular modeling. The primers used for mutagenesis are listed in Table I. The DNA sequence of the entire I-domain was confirmed for each mutant before and after transfer back into the pCIS2M expression vector containing the cDNA of β2.Table IPrimers used in the homolog-scanning mutagenesis of the putative β2I-domainMutant namesFromToMutagenic primers (from 5′ to 3′)1Arg144–Lys148RNVKKENVKSATGCTTGATGACCTCGAGAATGTCAAGTCCCTAGGTGGCGACCTG2Leu154–Glu159LRALNEMNEMRRCTAGGTGGCGACCTGATGAACGAGATGCGCAGGATCACCGAGTCCGGC3Glu162–Gly164ESGSDFAGCCAATGCGGAAGTCGGAGGTGATCTCG4Asn181–Asp185NTHPDSTTPATGGGTTTCGCAGCTTGGCAGGGGTGGTGGACACGAACGGCAGCAC5Pro192–Glu197PNKEKETSEQNAAGCTGCGAAACCCATGTACAAGCGAACAGAACTGCCAGCCCCCGTTT6Gln199–Ala203QPPFATTPFSAAGGAGAAAGAGTGCACCACCCCGTTTAGCTTCAGGCACGTGCTG7Asn213–Glu220NSNQFQTEKGEVFNELCTGAAGCTGACCAACAAGGGAGAAGTCTTTAATGAACTCGTCGGGAAG CAGCTG8Pro247–Glu249PEEGSLGCGCCAGCCGATCAGGCTTCCGCAGGCGGCGACCTG9Ala262–Asp265ATDDSTDAGCTGCTGGTGTTTTCTACTGATGCCGGCTTCCATTTC10Asp290–Glu298DNLYKRSNENNMYTMSHYCGCTGTCACCTGGAGAACAACATGTACACAATGAGCCACTACTTCGACTAC CCATCGGTG11Gly305–His309GQLAHAHLVQGACTACCCATCGGTGGCCCATCTGGTGCAGAAGCTGGCTGAAAAC12Ser324–Thr329SRMVKTEEFQPVCCCATCTTCGCGGTGACCGAGGAGTTCCAGCCCGTGTACGAGAAACTCACC13Thr334–Ile336TEIKNLGGCTGACTTGGGGATGAGGTTCTTGAGTTTCTCGTAGGT14Glu344–Asp348ELSEDTLSANAAGTCAGCCGTGGGGACCCTCTCCGCCAACTCCAGCAATGTGGTC15His354–Asn358HLIKNQLIIDTCCAGCAATGTGGTCCAGCTCATCATCGACGCTTACAATAAACTC16His371–Lys379HNALPDTLKNGKLSEGVTAGGGTCTTCCTGGATAATGGCAAGCTCTCCGAGGGCGTGACAGTCACCTAC GACTCCTTC Open table in a new tab A large number of natural mutations occur within the β2I-domain, which abolish surface expression and/or heterodimer formation (31Arnaout M.A. Dana N. Gupta S.K. Tenen D.G. Fathallah D.M. J. Clin. Invest. 1990; 85: 977-981Crossref PubMed Scopus (85) Google Scholar, 32Wardlaw A.J. Hibbs M.L. Stacker S.A. Springer T.A. J. Exp. Med. 1990; 172: 335-345Crossref PubMed Scopus (81) Google Scholar, 33Back A.L. Kwok W.W. Hickstein D.D. J. Biol. Chem. 1992; 267: 5482-5487Abstract Full Text PDF PubMed Google Scholar, 34Corbi A.L. Vara A. Ursa A. Garcia R.M. Fontan G. Sanchez-Madrid F. Eur. J. Immunol. 1992; 22: 1877-1881Crossref PubMed Scopus (25) Google Scholar, 35Matsuura S. Kishi F. Tsukahara M. Nunoi H. Matsuda I. Kobayashi K. Kajii T. Biochem. Biophys. Res. Commun. 1992; 184: 1460-1467Crossref PubMed Scopus (30) Google Scholar, 36Nelson C. Rabb H. Arnaout M.A. J. Biol. Chem. 1992; 267: 3351-3357Abstract Full Text PDF PubMed Google Scholar, 37Hogg N. Stewart M.P. Scarth S.L. Newton R. Shaw J.M. Law S.K. Klein N. J. Clin. Invest. 1999; 103: 97-106Crossref PubMed Scopus (148) Google Scholar). Nevertheless, when the β2 mutants were co-transfected with wild-type αM in human kidney 293 cells, all 16 mutants were expressed on the cell surface as heterodimers and the subunits had appropriate molecular weights. As shown in Fig.2, immunoprecipitation of surface-labeled cells with 44a, a mAb specific for the αM subunit, yielded two bands of ∼165 kDa (αM) and 95 kDa (β2) on SDS-PAGE. The patterns were similar to those obtained for wild-type αMβ2 (27Zhang L. Plow E.F. J. Biol. Chem. 1996; 271: 18211-18216Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). In addition, FACS analyses were conducted on these 16 mutants using a panel of β2-specific mAbs (TableII). All 16 β2 mutants were recognized by three different mAbs to the β2 subunit MEM48, 7E4, and 6.7, as well as by the αM-specific mAb 44. To exclude selection artifacts, we established at least five independent stable cell lines for each mutant β2 integrin that expressed similar levels of receptors on their cell surfaces, as judged by FACS analysis using mAb 44. Heterodimer formation, as well as other results described below, was similar for all five clones.Table IIReactivity of function-blocking monoclonal antibodies with the β2I-domain mutantsMutants44MEM48/6.7/7E4TS1/18CLB54YFC118.3H20A/R3.3/MHM23/IB4685A56.5EWild++++++++1 Arg144–Lys148++++−−−±2 Leu154–Glu159++−−−+±+3 Glu162–Gly164++++++++4 Asn181–Asp185++++++++5 Pro192–Glu197+++++−−±6 Gln199–Ala203++++++++7 Asn213–Glu220++++++−+8 Pro247–Glu249++++++++9 Ala262–Asp265++++++++10 Asp290–Glu298++++++++11 Gly305–His309++++++++12 Ser324–Thr329++++++++13 Thr334–Ile336++++++++14 Glu344–Asp348++−+++++15 His354–Asn358+++−−+++16 His371–Lys379++++++++FACS analysis was performed using 1 μg of each mAb and 106αMβ2-expressing cells. A “+” indicates that the mean fluorescence intensity of the mAb is at least 10 times that of the IgG control. A “−” indicates that the mean fluorescence intensity of the mAb is no more than that of the IgG control. Open table in a new tab FACS analysis was performed using 1 μg of each mAb and 106αMβ2-expressing cells. A “+” indicates that the mean fluorescence intensity of the mAb is at least 10 times that of the IgG control. A “−” indicates that the mean fluorescence intensity of the mAb is no more than that of the IgG control. To help locate the functional sites within the β2I-domain, we sought to map the epitopes of several β2-specific function-blocking mAbs: MHM23, IB4, 6.5E, TS1/18, CLB54, YFC118.3, R3.3, H20A, 685A5, and 7E4. The ability of these mAbs to block β2 integrin functions, such as αMβ2-mediated adhesion and C3bi binding and αLβ2-mediated binding to ICAM-1, has been well documented (38Lorenz H.M. Harrer T. Lagoo A.S. Baur A. Eger G. Kalden J.R. Cell. Immunol. 1993; 147: 110-128Crossref PubMed Scopus (37) Google Scholar, 39McNally A.K. Anderson J.M. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 10119-10123Crossref PubMed Scopus (162) Google Scholar, 40Lindbom L. Lundberg C. Prieto J. Raud J. Nortamo P. Gahmberg C.G. Patarroyo M. Clin. Immunol. Immunopathol. 1990; 57: 105-119Crossref PubMed Scopus (28) Google Scholar, 41Marr K.A. Lees P. Cunningham F.M. Vet. Immunol. Immunopathol. 1999; 71: 77-88Crossref PubMed Scopus (9) Google Scholar, 42Huang C. Zang Q. Takagi J. Springer T.A. J. Biol. Chem. 2000; 275: 21514-21524Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar). Representative FACS analyses using mAb IB4 with five of the αMβ2 mutants are shown in Fig.3 A and a summary of the FACS analyses for all 16 mutants and 12 β2-specific mAbs is shown in Table II. Among these 12 mAbs, 3 (6.7, MEM-48, and 7E4) reacted well with all 16 mutants, but not the mock-transfected 293 cells. The other nine mAbs recognized the β2I-domain, and their epitopes consisted of at least two noncontiguous sequences. For example, mAb IB4 reacted well with wild-type αMβ2, and mutants αMβ2(Leu154–Glu159), αMβ2(Asn213–Glu220) and αMβ2(His354–Asn358), but its binding to the two mutants αMβ2(Arg144–Lys148) and αMβ2(Pro192–Glu197) was ablated (Fig. 3A), suggesting that these two segments (Arg144–Lys148 and Pro192-Glu197) contribute to the epitope of IB4. As shown in Table II, in addition to IB4, mAbs MHM23, H20A, R3.3, and perhaps 6.5E also depended on segments Arg144–Lys148 and Pro192–Glu197 for their interactions with αMβ2. mAb 685A5 required segments Arg144–Lys148, Pro192–Glu197, and Asn213–Glu220; mAb TS1/18 required segments Leu154–Glu159 and Glu344–Asp348; mAb CLB54 required segments Leu154–Glu159 and His354–Asn358; and finally mAb YFC118.3 required segments Arg144–Lys148, Leu154–Glu159, and His354–Asn358. These epitopes can be roughly divided into two different groups (see Fig. 8). The first contains segments Leu154–Glu159, Glu344–Asp348, and His354–Asn358, and is important for αMβ2 interaction with mAbs TS1/18, CLB54, and YFC118.3, and the second contains segments Arg144–Lys148, Pro192–Glu197, and Asn213–Glu220, and is important for αMβ2 binding of mAbs MHM23, H20A, IB4, R3.3, and 685A5. To further support our epitope mapping results and this grouping of the mAbs, we performed two additional experiments. First, competition was performed between mAbs MHM23, IB4, and R3.3 from group 2, TS1/18 from group 1, and 7E4, which recognizes an epitope that is likely located outside of the β2I-domain. In these experiments, αMβ2-expressing cells were incubated first with the competitor mAb, IB4, R3.3, TS1/18, or 7E4, and then the reporter mAb MHM23 was added. Binding of MHM23 was measured by FACS analysis, and the results are shown in Fig. 3 B. As predicated, mAbs IB4 and R3.3, which belong to the same group as MHM23 (group 2), blocked more than 95% of the binding of mAb MHM23 to αMβ2. In contrast, mAb TS1/18 (group 1) and mAb 7E4 had little effect on MHM23 binding. The specificity of these assays was confirmed by the ability of unlabeled MHM23 but not a control IgG to block the binding of the fluorescence-labeled MHM23 to the cells. Second, the ability of mAb IB4 to block adhesion of αMβ2-expressing cells to a representative ligand, the γ-module of fibrinogen, was assessed using wild-type and two different αMβ2 mutants. As shown in Fig. 3 C, cells expressing these three different αMβ2 receptors all adhered well to the γ-module in the presence of a control IgG. Addition of mAb IB4 completely inhibited adhesion of cells expressing the wild-type and one of the mutant receptors αMβ2(Leu154–Glu159). However, mAb IB4 had no effect on adhesion by the second mutant αMβ2(Arg144–Lys148). These results are consistent with the FACS data presented in Fig.3 A, which show that the epitope of mAb IB4 was destroyed in mutant αMβ2(Arg144–Lys148) but not in mutant αMβ2(Leu154–Glu159).Figure 8Epitopes of function-blocking mAbs in the β2I-domain. The structure of the β2I-domain is modeled according to the crystal coordinates of the αMI-domain (10Lee J.O. Rieu P. Arnaout M.A. Liddington R.C. Cell. 1995; 80: 631-638Abstract Full Text PDF PubMed Scopus (806) Google Scholar) and a recently published model of the β2I-domain by Huanget al. (42Huang C. Zang Q. Takagi J. Springer T.A. J. Biol. Chem. 2000; 275: 21514-21524Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar). The model is further modified based on the epitope mapping data in Table II using the Biosym software. The backbone of the β2I-domain is shown with helix 1 ingreen, helix 2 in silver, helix 6 incyan, β-sheet 6 in purple, the disulfide loop in yellow, and the bound Ca2+ inblue. The epitopes identified in this study can be divided in two groups. Group 1 (yellow circle) includes mAbs TS1/18 (Leu154–Glu159 and Glu344–Asp348), CLB54 (Leu154–Glu159and His354–Asn358), and YFC118.3 (Arg144–Lys148, Leu154–Glu159, and His354–Asn358); and group 2 (cyan circle) includes mAbs MHM23, H20A, IB4, and R3.3 (Arg144–Lys148 and Pro192–Glu197), and 685A5 (Arg144–Lys148, Pro192–Glu197, and Asn213–Glu220).View Large Image Figure ViewerDownload Hi-res image Download (PPT) A short disulfide loop of 7–8 amino acids has been implicated in the ligand binding functions of the β3 integrins (21Lin E.C. Ratnikov B.I. Tsai P.M. Carron C.P. Myers D.M. Barbas C.F. Smith J.W. J. Biol. Chem. 1997; 272: 23912-23920Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar, 22Takagi J. Kamata T. Meredith J. Puzon-McLaughlin W. Takada Y. J. Biol. Chem. 1997; 272: 19794-19800Abstract Full Text Full Text PDF PubMed Scopus (112) Google S" @default.
• W2079672511 created "2016-06-24" @default.
• W2079672511 creator A5024838548 @default.
• W2079672511 creator A5066716873 @default.
• W2079672511 date "2001-06-01" @default.
• W2079672511 modified "2023-10-01" @default.
• W2079672511 title "Structure-Function of the Putative I-domain within the Integrin β2 Subunit" @default.
• W2079672511 cites W1492715703 @default.
• W2079672511 cites W1493760709 @default.
• W2079672511 cites W1516591371 @default.
• W2079672511 cites W1518845984 @default.
• W2079672511 cites W1530154863 @default.
• W2079672511 cites W1532442718 @default.
• W2079672511 cites W1550140963 @default.
• W2079672511 cites W1555059577 @default.
• W2079672511 cites W1570768589 @default.
• W2079672511 cites W1584740642 @default.
• W2079672511 cites W1590595696 @default.
• W2079672511 cites W1594207045 @default.
• W2079672511 cites W1594881395 @default.
• W2079672511 cites W1598106324 @default.
• W2079672511 cites W1609249008 @default.
• W2079672511 cites W1868155459 @default.
• W2079672511 cites W1970483666 @default.
• W2079672511 cites W1972470306 @default.
• W2079672511 cites W1974656135 @default.
• W2079672511 cites W1977723670 @default.
• W2079672511 cites W1987817886 @default.
• W2079672511 cites W1991767888 @default.
• W2079672511 cites W1999922759 @default.
• W2079672511 cites W2002475242 @default.
• W2079672511 cites W2003111769 @default.
• W2079672511 cites W2005020306 @default.
• W2079672511 cites W2010397566 @default.
• W2079672511 cites W2023124533 @default.
• W2079672511 cites W2028028180 @default.
• W2079672511 cites W2034234555 @default.
• W2079672511 cites W2035178191 @default.
• W2079672511 cites W2037301837 @default.
• W2079672511 cites W2039805883 @default.
• W2079672511 cites W2040361917 @default.
• W2079672511 cites W2043781898 @default.
• W2079672511 cites W2044831835 @default.
• W2079672511 cites W2048890479 @default.
• W2079672511 cites W2050286820 @default.
• W2079672511 cites W2052258955 @default.
• W2079672511 cites W2052447181 @default.
• W2079672511 cites W2057203202 @default.
• W2079672511 cites W2066371830 @default.
• W2079672511 cites W2068453204 @default.
• W2079672511 cites W2068468264 @default.
• W2079672511 cites W2073797855 @default.
• W2079672511 cites W2074619197 @default.
• W2079672511 cites W2075221289 @default.
• W2079672511 cites W2075524784 @default.
• W2079672511 cites W2077634410 @default.
• W2079672511 cites W2080517001 @default.
• W2079672511 cites W2085299722 @default.
• W2079672511 cites W2088528987 @default.
• W2079672511 cites W2089625435 @default.
• W2079672511 cites W2091314328 @default.
• W2079672511 cites W2098330537 @default.
• W2079672511 cites W2107553760 @default.
• W2079672511 cites W2136016201 @default.
• W2079672511 cites W2141924291 @default.
• W2079672511 cites W2150144236 @default.
• W2079672511 cites W2158541834 @default.
• W2079672511 cites W2160726577 @default.
• W2079672511 cites W2244726815 @default.
• W2079672511 cites W2398223882 @default.
• W2079672511 cites W2439008136 @default.
• W2079672511 cites W3119074784 @default.
• W2079672511 doi "https://doi.org/10.1074/jbc.m008903200" @default.
• W2079672511 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11278448" @default.
• W2079672511 hasPublicationYear "2001" @default.
• W2079672511 type Work @default.
• W2079672511 sameAs 2079672511 @default.
• W2079672511 citedByCount "27" @default.
• W2079672511 countsByYear W20796725112019 @default.
• W2079672511 countsByYear W20796725112023 @default.
• W2079672511 crossrefType "journal-article" @default.
• W2079672511 hasAuthorship W2079672511A5024838548 @default.
• W2079672511 hasAuthorship W2079672511A5066716873 @default.
• W2079672511 hasBestOaLocation W20796725111 @default.
• W2079672511 hasConcept C104292427 @default.
• W2079672511 hasConcept C104317684 @default.
• W2079672511 hasConcept C109214941 @default.
• W2079672511 hasConcept C121332964 @default.
• W2079672511 hasConcept C134306372 @default.
• W2079672511 hasConcept C14036430 @default.
• W2079672511 hasConcept C153911025 @default.
• W2079672511 hasConcept C170493617 @default.
• W2079672511 hasConcept C185592680 @default.
• W2079672511 hasConcept C195687474 @default.
• W2079672511 hasConcept C2984217123 @default.
• W2079672511 hasConcept C33923547 @default.
• W2079672511 hasConcept C36503486 @default.
• W2079672511 hasConcept C55493867 @default.

• next