FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2079789962> ?p ?o ?g. }

• W2079789962 endingPage "918" @default.
• W2079789962 startingPage "909" @default.
• W2079789962 abstract "The lysyl oxidase family is made up of five members: lysyl oxidase (LOX) and lysyl oxidase-like 1–4 (LOXL1-LOXL4). All members share conserved C-terminal catalytic domains that provide for lysyl oxidase or lysyl oxidase-like enzyme activity; and more divergent propeptide regions. LOX family enzyme activities catalyze the final enzymatic conversion required for the formation of normal biosynthetic collagen and elastin cross-links. The importance of lysyl oxidase enzyme activity to normal bone development has long been appreciated, but regulation and roles for specific LOX isoforms in bone formation in vivo is largely unexplored. Fracture healing recapitulates aspects of endochondral bone development. The present study first investigated the expression of all LOX isoforms in fracture healing. A remarkable coincidence of LOXL2 expression with the chondrogenic phase of fracture healing was found, prompting more detailed analyses of LOXL2 expression in normal growth plates, and LOXL2 expression and function in developing ATDC5 chondrogenic cells. Data show that LOXL2 is expressed by pre-hypertrophic and hypertrophic chondrocytes in vivo, and that LOXL2 expression is regulated in vitro as a function of chondrocyte differentiation. Moreover, LOXL2 knockdown studies in vitro show that LOXL2 expression is required for ATDC5 chondrocyte cell line differentiation through regulation of SNAIL and SOX9, important transcription factors that control chondrocyte differentiation. Taken together, data provide evidence that LOXL2, like LOX, is a multifunctional protein. LOXL2 promotes chondrocyte differentiation by mechanisms that are likely to include roles as both a regulator and an effector of chondrocyte differentiation. The lysyl oxidase family is made up of five members: lysyl oxidase (LOX) and lysyl oxidase-like 1–4 (LOXL1-LOXL4). All members share conserved C-terminal catalytic domains that provide for lysyl oxidase or lysyl oxidase-like enzyme activity; and more divergent propeptide regions. LOX family enzyme activities catalyze the final enzymatic conversion required for the formation of normal biosynthetic collagen and elastin cross-links. The importance of lysyl oxidase enzyme activity to normal bone development has long been appreciated, but regulation and roles for specific LOX isoforms in bone formation in vivo is largely unexplored. Fracture healing recapitulates aspects of endochondral bone development. The present study first investigated the expression of all LOX isoforms in fracture healing. A remarkable coincidence of LOXL2 expression with the chondrogenic phase of fracture healing was found, prompting more detailed analyses of LOXL2 expression in normal growth plates, and LOXL2 expression and function in developing ATDC5 chondrogenic cells. Data show that LOXL2 is expressed by pre-hypertrophic and hypertrophic chondrocytes in vivo, and that LOXL2 expression is regulated in vitro as a function of chondrocyte differentiation. Moreover, LOXL2 knockdown studies in vitro show that LOXL2 expression is required for ATDC5 chondrocyte cell line differentiation through regulation of SNAIL and SOX9, important transcription factors that control chondrocyte differentiation. Taken together, data provide evidence that LOXL2, like LOX, is a multifunctional protein. LOXL2 promotes chondrocyte differentiation by mechanisms that are likely to include roles as both a regulator and an effector of chondrocyte differentiation. The lysyl oxidase family is made up of five members: lysyl oxidase (LOX) 3The abbreviations used are: LOX, lysyl oxidase; ANOVA, analysis of variance; SRCR, scavenger receptor cysteine-rich. and lysyl oxidase-like 1–4 (LOXL1-LOXL4) (1Csiszar K. Prog. Nucleic Acids Res. Mol. Biol. 2001; 70: 1-32Crossref PubMed Google Scholar). All five members share a conserved C-terminal catalytic domain that provides for lysyl oxidase or lysyl oxidase-like enzyme activity, and more divergent propeptide regions. LOX family enzyme activities catalyze the final enzymatic conversion required for the subsequent formation of normal lysine-derived biosynthetic cross-links found in collagens and elastin (2Kagan H.M. Trackman P.C. Am. J. Respir. Cell Mol. Biol. 1991; 5: 206-210Crossref PubMed Scopus (277) Google Scholar). The importance of lysyl oxidase enzyme activity to normal bone development has long been known, and is based in part on studies in which enzyme activities are inhibited by lathyrogens in vivo (3Selye H. Rev. Can. Biol. 1957; 16: 1-82PubMed Google Scholar), including β-aminopropionitrile, a potent inhibitor of LOX and LOX isoform activity (4Tang S.S. Trackman P.C. Kagan H.M. J. Biol. Chem. 1983; 258: 4331-4338Abstract Full Text PDF PubMed Google Scholar). The LOX family can be subdivided into two subgroups. Although all members have similarities in the catalytic C-terminal region, LOX and LOXL1 are more closely related to each other than they are to LOXL2-LOXL4. Moreover, the pro-peptide regions of LOX and LOXL1 have very little similarity to each other and no similarity to LOXL2-LOXL4. The pro-regions of LOXL2-LOXL4 each contain four scavenger receptor cysteine-rich (SRCR) domains whose functions are likely to depend on interactions with other proteins (1Csiszar K. Prog. Nucleic Acids Res. Mol. Biol. 2001; 70: 1-32Crossref PubMed Google Scholar). The pro-regions of all LOX family members may have activities that are independent of lysyl oxidase enzyme activity, as has already been shown for the propeptide region of LOX (5Min C. Kirsch K.H. Zhao Y. Jeay S. Palamakumbura A.H. Trackman P.C. Sonenshein G.E. Cancer Res. 2007; 67: 1105-1112Crossref PubMed Scopus (93) Google Scholar, 6Min C. Yu Z. Kirsch K.H. Zhao Y. Vora S.R. Trackman P.C. Spicer D.B. Rosenberg L. Palmer J.R. Sonenshein G.E. Cancer Res. 2009; 69: 6685-6693Crossref PubMed Scopus (53) Google Scholar, 7Palamakumbura A.H. Jeay S. Guo Y. Pischon N. Sommer P. Sonenshein G.E. Trackman P.C. J. Biol. Chem. 2004; 279: 40593-40600Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar, 8Palamakumbura A.H. Vora S.R. Nugent M.A. Kirsch K.H. Sonenshein G.E. Trackman P.C. Oncogene. 2009; 28: 3390-3400Crossref PubMed Scopus (64) Google Scholar, 9Vora S.R. Palamakumbura A.H. Mitsi M. Guo Y. Pischon N. Nugent M.A. Trackman P.C. J. Biol. Chem. 2010; 285: 7384-7393Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar, 10Vora S.R. Palamakumbura A.H. Mitsi M. Guo Y. Pischon N. Nugent M.A. Trackman P.C. J. Biol. Chem. 2010; 285: 2384-2393Abstract Full Text Full Text PDF Scopus (38) Google Scholar, 11Wu M. Min C. Wang X. Yu Z. Kirsch K.H. Trackman P.C. Sonenshein G.E. Cancer Res. 2007; 67: 6278-6285Crossref PubMed Scopus (79) Google Scholar). Although some information on regulation and functions of LOX in particular in osteoblast development in vitro is known (10Vora S.R. Palamakumbura A.H. Mitsi M. Guo Y. Pischon N. Nugent M.A. Trackman P.C. J. Biol. Chem. 2010; 285: 2384-2393Abstract Full Text Full Text PDF Scopus (38) Google Scholar, 12Hong H.H. Pischon N. Santana R.B. Palamakumbura A.H. Chase H.B. Gantz D. Guo Y. Uzel M.I. Ma D. Trackman P.C. J. Cell. Physiol. 2004; 200: 53-62Crossref PubMed Scopus (65) Google Scholar), and LOXL4 expression has been previously seen in cartilage and in osteoblast cell lines (13Ito H. Akiyama H. Iguchi H. Iyama K. Miyamoto M. Ohsawa K. Nakamura T. J. Biol. Chem. 2001; 276: 24023-24029Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar), relatively little information on regulation and roles for other specific LOX isoforms in bone formation in vivo is available. Fracture healing in mice largely recapitulates endochondral bone development, temporal patterns of chondrocyte and osteoblast differentiation. Expression of corresponding molecular markers are well established (14Gerstenfeld L.C. Cullinane D.M. Barnes G.L. Graves D.T. Einhorn T.A. J. Cell. Biochem. 2003; 88: 873-884Crossref PubMed Scopus (936) Google Scholar, 15Ai-Aql Z.S. Alagl A.S. Graves D.T. Gerstenfeld L.C. Einhorn T.A. J. Dent. Res. 2008; 87: 107-118Crossref PubMed Scopus (483) Google Scholar). An examination of the transcriptome of fracture healing through a large microarray study provided initial data that all five lysyl oxidase-related isoforms were expressed during fracture healing and that some of the isoforms would show specific expression at different developmental stages of healing (16Bais M. McLean J. Sebastiani P. Young M. Wigner N. Smith T. Kotton D.N. Einhorn T.A. Gerstenfeld L.C. PLoS One. 2009; 4: e5393Crossref PubMed Scopus (71) Google Scholar). The present study was initiated to more fully evaluate the expression of all five isoforms in fracture healing. A remarkable coincidence of LOXL2 expression with the chondrogenic phase of fracture healing was found, prompting more detailed analyses of LOXL2 expression in normal growth plates, and LOXL2 expression and function in the ATDC5 cell model of chondrocyte differentiation. Data show that LOXL2 is expressed by pre-hypertrophic and hypertrophic chondrocytes in vivo, and that LOXL2 expression is regulated in vitro as a function of chondrocyte differentiation. Moreover, LOXL2 knockdown studies show that LOXL2 expression plays an essential role in chondrocyte differentiation, regulating levels of SNAIL and SOX9, important transcription factors that control chondrocyte differentiation. Dulbecco's modified Eagle's medium (DMEM), Dulbecco's modified Eagle's medium-F12, penicillin-streptomycin solution, nonessential amino acids, trypsin-EDTA solution, phosphate-buffered saline, sodium pyruvate, NanoOrange® protein quantitation kit, insulin, transferrin, selenite (ITS) were purchased from Invitrogen (Carlsbad, CA). Fetal bovine serum (FBS) was from Sigma. Ascorbate 2-phosphate was bought from Fluka Biochemica, Switzerland; cell culture plates were obtained from Corning Inc. (Corning, NY). RNeasy mini-RNA purification kits and Maxi prep kits were purchased from Qiagen (Valencia, CA). TaqMan probes and reverse transcription reagents for real-time PCR were obtained from Applied Biosystems (Foster City, CA). LOXL2 antibody for Western blots was purchased from Abcam (Cambridge, MA). For immunohistochemistry, LOXL2 antibody, biotinylated anti-rabbit IgG, biotinylated anti-goat IgG, non-immune rabbit IgG, and goat IgG was obtained from Santa Cruz Biotechnology. ABC reagents and diaminobenzidine (DAB) substrate, were obtained from Vector Laboratories (Burlingame, CA). Lentivirus constructs were bought from Open Biosystems (Huntsville, AL). Fugene 6 reagent was bought from Roche (Basel, Switzerland) and p24 ELISA kit was purchased from Cell Biolabs, Inc. (San Diego, CA). Research was conducted in conformity with all Federal and USDA guidelines under an IACUC approved protocol at the Boston University School of Medicine in Boston, MA. For fracture studies, 8–10 week postbirth C57BL/6J (B6) male mice were obtained from the Jackson Laboratory and housed at the Boston University Medical Center animal housing facility for the duration of each study plus 3 days of acclimation. Growth plate studies were carried out on days 7 and 14 postnatal male mice. Unilateral fractures were produced in the right femur of 8–10-week-old male mice as previously described (17Jepsen K.J. Price C. Silkman L.J. Nicholls F.H. Nasser P. Hu B. Hadi N. Alapatt M. Stapleton S.N. Kakar S. Einhorn T.A. Gerstenfeld L.C. J. Bone Miner. Res. 2008; 23: 1204-1216Crossref PubMed Scopus (47) Google Scholar). The location and quality of fractures was assessed by x-ray analysis while animals were still anesthetized after surgery. Fracture configurations that were comminuted or were not localized to the mid-diaphyseal region were excluded from the study. Days 10 and 14 time points during fracture healing were chosen for the histological studies because the B6 mouse strain has a corresponding peak period of cartilage formation and hypertrophic chondrocyte differentiation (17Jepsen K.J. Price C. Silkman L.J. Nicholls F.H. Nasser P. Hu B. Hadi N. Alapatt M. Stapleton S.N. Kakar S. Einhorn T.A. Gerstenfeld L.C. J. Bone Miner. Res. 2008; 23: 1204-1216Crossref PubMed Scopus (47) Google Scholar). For molecular biological studies of fracture healing, mRNA was extracted from callus tissues on day 0 (no fracture) and at intervals up to day 21 of healing. For histological assessment of fractures, femora with surrounding muscle and soft tissues were fixed, decalcified, sectioned, and stained as previously described (18Gerstenfeld L.C. Alkhiary Y.M. Krall E.A. Nicholls F.H. Stapleton S.N. Fitch J.L. Bauer M. Kayal R. Graves D.T. Jepsen K.J. Einhorn T.A. J. Histochem. Cytochem. 2006; 54: 1215-1228Crossref PubMed Scopus (131) Google Scholar). For growth plate assessments, femora from either 7- or 14-day-old mice were used. ATDC5 cells were cultured in DMEM-F12 Dulbecco's modified Eagle's medium-F12 supplemented with 10% fetal bovine serum and 50 units/ml penicillin and 50 μg/ml streptomycin, in a humidified atmosphere of 37 °C and 5% CO2. For differentiation studies, ATDC5 cells in DMEM-F12 supplemented with 10% FBS were seeded in 6-well tissue culture plates until they reached full confluence. Seven days after reaching visual confluence, culture media were replaced with medium containing in addition 10 μg/ml bovine insulin, 10 μg/ml human transferrin, 3 × 10−8 m sodium selenite (GIBCO®; ITS) and 37.5 μg/ml of ascorbate 2-phosphate. Media were changed every other day throughout the length of the experiment. Total RNA from ATDC5 cells was extracted using the RNeasy® Mini kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. Briefly, culture media were aspirated completely from culture plates, cells were disrupted by addition of buffer RLT, and the cell layer was collected. The cell lysate was transferred directly into a Qiashredder spin column, placed in a collection tube and centrifuged at full speed for 2 min. One volume of 70% ethanol was added to the homogenized lysate and mixed by pipetting. Then the sample was transferred into an RNeasy spin column for RNA binding, followed by washing with buffer RW1 and buffer RPE. Bound RNA was eluted in RNase-free water. RNA samples were then stored at −80 °C. RNA samples from fractured femurs, including early fracture callus were harvested at different time points as described (19Kayal R.A. Tsatsas D. Bauer M.A. Allen B. Al-Sebaei M.O. Kakar S. Leone C.W. Morgan E.F. Gerstenfeld L.C. Einhorn T.A. Graves D.T. J. Bone Miner Res. 2007; 22: 560-568Crossref PubMed Scopus (189) Google Scholar). RNA obtained was analyzed on 1% agarose gels to ensure RNA quality by visualizing 18 S and 28 S rRNA in proper relative proportions after ethidium bromide staining. RNA was quantified via spectrophotometry (NanoDrop, Thermo Fisher Scientific, Pittsburgh, PA), and 1 μg of RNA per treatment condition was added to 30 μl of reverse transcription reactions (1× RT buffer, 5.5 mm MgCl2, 500 μm per dNTP, 2.5 μm random hexamers, 0.4 units/μl RNase inhibitor, and 3.125 units/μl MultiScribe reverse transcriptase) using the Applied Biosystems Reverse Transcription kit. The reverse transcription thermal cycling conditions are: 25 °C for 10 min, 37 °C for 60 min and 95 °C for 5 min, followed by 4 °C on hold. cDNA was stored at −20 °C prior to use in real-time PCR. 2 μl of each reverse transcription reaction was used for 25 μl of real-time PCR reaction (12.5 μl of Taqman Universal PCR master mix, 1.25 μl specific primer and 2 μl of template) using the 96-well format. TaqMan probe sets (Applied Biosystems, Foster City, CA) employed were for LOX (Mm00495386), LOXL1 (Mm01145738), LOXL2 (Mm00804740), LOXL3 (Mm00442953), LOXL4 (Mm00446385), SOX9 (mm00448840_m), COLII (Mm00491889), COLX (Mm00487041), and Aggrecan (Mm00545794). GAPDH (Mm99999915) was used as an endogenous control. The fold change in the target gene, normalized to endogenous control and relative to the expression of the calibrator sample, was calculated by the 2−ΔΔct method (20Huggett J. Dheda K. Bustin S. Zumla A. Genes Immun. 2005; 6: 279-284Crossref PubMed Scopus (1438) Google Scholar). Total cell extracts from ATDC5 cells at different time intervals were obtained by lysing cells in SDS-PAGE sample buffer (62.5 mm Tris, 10% glycerol, 2% SDS, and 5% β-mercaptoethanol). Protein concentrations were determined with the Nano-Orange protein quantitation kit using bovine serum albumin as standard following the manufacturer's instructions. Protein samples (20 μg) were subjected to 8% SDS-PAGE, and were transferred onto polyvinylidene difluoride membranes (PVDF Perkin Elmer, Boston, MA) overnight in blotting buffer (0.025 m Tris, 0.192 m glycine, and 20% methanol). Membranes were blocked in 5% dry milk dissolved in TBST (20 mm Tris-HCl, pH 7.5, 150 mm NaCl, and 0.1% Tween), for 1 h. Then, the membranes were incubated with blocking solution containing goat anti-LOXL2 antibody (Abcam, Cambridge, MA) (1:400) and kept overnight at 4 °C with mild shaking. Membranes were washed three times with TBS-T for 10 min each and then incubated with horseradish peroxidase-coupled secondary antibodies (1:2500) for 1 h in blocking solution at room temperature with light shaking, and washed with TBS-T three times for 10 min each. Chemiluminescent detection of bound horseradish peroxidase-conjugated secondary antibodies was determined using the ECL Western blotting Detection Reagents (Denville Scientific, Metuchen, NJ) and exposed to film. Membranes were subsequently stripped using Restore Western Stripping Solution (Thermo Scientific/Pierce, Pittsburgh, PA) and re-probed with β-actin antibody (Cell Signaling) for loading control as required. Densitometry was carried out only on films with non-saturating exposures utilizing a Bio-Rad Versadoc Photodocumentation System and Quantity One software. Femurs of 9-week-old mice were fractured as described, and tissues collected at intervals of healing (19Kayal R.A. Tsatsas D. Bauer M.A. Allen B. Al-Sebaei M.O. Kakar S. Leone C.W. Morgan E.F. Gerstenfeld L.C. Einhorn T.A. Graves D.T. J. Bone Miner Res. 2007; 22: 560-568Crossref PubMed Scopus (189) Google Scholar). Legs from uninjured mice were obtained from 7- and 14-day-old mice, for analysis of epiphyseal growth plates. Samples were fixed and then embedded in paraffin. Paraffin sections (5 μm) were deparaffinized in xylene, and rehydrated through graded alcohols. Microwave heating in 10 mm sodium citrate buffer at pH 6, was used for endogenous antigen retrieval, and then sections were allowed to cool for 20 min. Immunohistochemistry was next carried out as we have previously described in detail (21Uzel M.I. Kantarci A. Hong H.H. Uygur C. Sheff M.C. Firatli E. Trackman P.C. J. Periodontol. 2001; 72: 921-931Crossref PubMed Scopus (126) Google Scholar), but with the following antibodies: primary antibodies were affinity-purified rabbit anti LOX-PP antibody (22Hurtado P.A. Vora S. Sume S.S. Yang D. St Hilaire C. Guo Y. Palamakumbura A.H. Schreiber B.M. Ravid K. Trackman P.C. Biochem. Biophys. Res. Commun. 2008; 366: 156-161Crossref PubMed Scopus (43) Google Scholar), (1:250) and goat-anti LOXL2 antibody (1:25) (Santa Cruz Biotechnology). Secondary antibodies utilized were biotinylated anti-rabbit IgG for LOX-PP and biotinylated anti-goat IgG for LOXL2. Non-immune rabbit IgG and goat IgG (Santa Cruz Biotechnology) served as negative controls for corresponding primary antibodies. Slides were incubated overnight with primary antibodies at 4 °C, and were then processed and photographed as previously described (21Uzel M.I. Kantarci A. Hong H.H. Uygur C. Sheff M.C. Firatli E. Trackman P.C. J. Periodontol. 2001; 72: 921-931Crossref PubMed Scopus (126) Google Scholar). All work with lentivirus was performed under BL2 conditions. Viral constructs were bought from Open Biosystems (Huntsville, AL) except for the non-target construct (23Sarbassov D.D. Guertin D.A. Ali S.M. Sabatini D.M. Science. 2005; 307: 1098-1101Crossref PubMed Scopus (5179) Google Scholar) that was obtained via Addgene (Cambridge, MA) and plasmids were isolated using Qiagen Maxi prep kit according to the manufacturer's protocol (Qiagen). The shRNA sequences were: Virus 8 (TRCN0000076708) CCGGGCTGAGAAGAAAGGTGCTCATCTCGAGATGAGCACCTTTCTTCTCAGCTTTTTG; Virus 9 (TRCN0000076709) CCGGGCATGGAAATATCTTCGCCAACTCGAGTTGGCGAAGATATTTCCATGCTTTTTG; Virus 10 (TRCN0000076710) CCGGCCTGGTGCTTAATGCTGAGATCTCGAGATCTCAGCATTAAGCACCAGGTTTTTG; Virus 11 (TRCN0000076711) CCGGCCAAATAGAGAGCCTAAATATCTCGAGA-TATTTAGGCTCTCTATTTGGTTTTTG; Virus 12 (TRCN0000076712) CCGGCAACCAAATAGAGAGCCTAAACTCGAGTTTAGGCTCTCTATTTGGTTGTTTTTG; non-target control virus (plasmid 1864) CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTT-AACCTTAGG. Lentiviruses were produced by plating 293-T cells at a density of 2 × 106 cells per 10 cm2 at 37 °C under 5% CO2 in DMEM high glucose media, supplemented with 10% FBS and 100 units/ml of penicillin, 100 μg/ml of streptomycin. Cells were co-transfected using Fugene 6 reagent (150 μl) (Roche), and 3 plasmids: lentivirus plasmid, pcMV-VSV-G and pCMV-dR8.2 dvpr at the ratio of 8:1:8. Non-Target lentivirus plasmid served as a negative control (24Bais M.V. Wigner N. Young M. Toholka R. Graves D.T. Morgan E.F. Gerstenfeld L.C. Einhorn T.A. Bone. 2009; 45: 254-266Crossref PubMed Scopus (82) Google Scholar). The supernatant fluid was collected at 24-h intervals for three consecutive days and was replaced with fresh differentiation media (35 ml). Virus particles were concentrated by ultracentrifugation at 16,500 × g for 90 min and were resuspended in PBS and stored at −70 °C. Virus titer was determined by using a p24 ELISA kit (Cell Biolabs, Inc.) according to the manufacturer's protocol. ATDC5 cells were plated in 6-well plates. Seven days after confluence, the lentivirus transduction was carried out in differentiation media containing 8 μg/ml hexadimethrine bromide. The media were changed the next day and then every other day thereafter. Alcian blue staining of ATDC5 cultures was performed after fixation of ATDC5 cells with 4% paraformaldehyde for 30 min and washed with water three times and air dried. The staining was performed with the commercially available 1% Alcian Blue solution, pH 2.5 (American Mastertech), for 5 h and washed several times with distilled water before being photographed (25Nakatani S. Mano H. Im R. Shimizu J. Wada M. Biol. Pharm. Bull. 2007; 30: 433-438Crossref PubMed Scopus (15) Google Scholar). Alizarin red staining was carried out as described previously (10Vora S.R. Palamakumbura A.H. Mitsi M. Guo Y. Pischon N. Nugent M.A. Trackman P.C. J. Biol. Chem. 2010; 285: 2384-2393Abstract Full Text Full Text PDF Scopus (38) Google Scholar). Two way ANOVA with Bonferroni post-tests were performed using GraphPad Prism (San Diego) software version 5.02 for Windows; data were considered significant at p < 0.05. The expression pattern of lysyl oxidase, and its isoforms during fracture repair was first determined. Total RNA samples from mouse fractured femur calluses were extracted at different time points after fracture, and samples were subjected to qPCR. Results show that mRNA levels of LOX, LOXL1, LOXL3, and LOXL4 all had similar bi-phasic expression patterns throughout the healing process with peaks of expression on days 7 and 21 (Fig. 1, A, B, D, and E). The expression pattern for LOXL2, however, was found to be different from the other isoforms with a peak of expression seen on day 7 after fracture (Fig. 1C). This time point corresponds to the onset of the chondrogenic phase of fracture healing (26Ferguson C. Alpern E. Miclau T. Helms J.A. Mech. Dev. 1999; 87: 57-66Crossref PubMed Scopus (438) Google Scholar). We, therefore, developed the hypothesis that LOXL2 could have unique importance in chondrogenesis. To investigate directly whether LOXL2 is expressed by chondrocytes in vivo, immunohistochemistry studies were carried out on healing fractures introduced into 10-week-old mice and were analyzed on post-fracture days 10 and 14, and on normal epiphyseal growth plates on postnatal days 7 and 14. In healing fractures, LOXL2 protein was strongly detected in chondrocytes abundant on day 10 of healing (supplemental Fig. S1). LOX staining was found to be strongest in osteoblasts lining bone that were highly abundant on day 14, while LOX expression is weaker in chondrocytes. Weaker LOXL2 staining is seen in cells lining bone (osteoblasts) at all time points (supplemental Fig. S2). Similarly, in epiphyseal growth plates, strong staining for LOXL2 was detected in chondrocytes present within the hypertrophic and proliferating zones, and in calcified cartilage (Fig. 2). These findings suggest that LOXL2 is a predominant lysyl oxidase isoform made by chondrocytes in vivo. We next wished to determine whether LOXL2 expression is regulated as a function of chondrocyte differentiation. The ATDC5 cell line undergoes a well characterized program of chondrocyte differentiation (27Atsumi T. Miwa Y. Kimata K. Ikawa Y. Cell Differ. Dev. 1990; 30: 109-116Crossref PubMed Scopus (336) Google Scholar). Cells were plated in 6-well plates in DMEM-F12 growth medium. Seven days after visual confluence, the growth medium was supplemented with ascorbate and insulin-transferrin-selenite solution. Total RNA was isolated at different time points and subjected to quantitative real time PCR. LOX, LOXL1, LOXL3, and LOXL4 mRNA levels showed small changes in expression compared with the robust changes in LOXL2 (Fig. 3). Total mRNA expression of LOXL2 in differentiating ATDC5 cells showed an approximate 4.5-fold increase by day 7, increasing to 12-and 14-fold by day 14–21, and then dramatically reaching its highest level of 43-fold on day 28, decreasing to 18-fold on day 35 (Fig. 3C). To investigate LOXL2 expression in relation to well characterized chondrogenic markers, we examined the expression of collagen type II, X, and aggrecan. Expression of chondrogenic markers was dramatically increased with time as expected (Fig. 4). The sequence of expression of these chondrogenic markers followed the normal pattern of type II collagen expression preceding aggrecan, followed by expression of type X collagen (Fig. 4). Interestingly, LOXL2 expression was significantly elevated as early as day 7 of differentiation, but the peak of LOXL2 mRNA expression was later than the peak of type II collagen expression, but earlier than that of type X collagen.FIGURE 4Quantitative real-time PCR analyses of (A) type II collagen, (B) aggrecan, and (C) type X collagen in differentiating ATDC5 cells. RNA was extracted at different time points. The mRNA expression relative to GAPDH was determined, and the fold changes were calculated relative to day 0. (*, p < 0.05; ANOVA; n = 3).View Large Image Figure ViewerDownload Hi-res image Download (PPT) We next wished to determine LOX and LOXL2 protein expression in developing ATDC5 cells. Cells were grown to full confluence and then induced to differentiate as described above. Cells layers were extracted into SDS-PAGE sample buffer at intervals, and equal amounts of proteins were subjected to SDS-PAGE followed by immunoblotting for LOX and LOXL2. Data show that LOX proenzyme levels decrease with differentiation, whereas LOXL2 pro-protein increases ∼40-fold during the first 14 days of differentiation, and remains high through day 35 (Fig. 5). These data are consistent with mRNA regulation seen in Fig. 3. We next wished to determine if LOXL2 plays any role in chondrocyte differentiation, or whether the regulated expression of LOXL2 is simply a consequence of chondrocyte differentiation. Five commercially available lentiviral LOXL2 shRNA constructs were screened for their ability to prevent LOXL2 mRNA increases on day 7 of differentiation. Lentiviruses were produced by co-transfection of 293-T cells with 3 plasmid vectors (lentivirus, pcMV-VSV-G, and pCMV-dR8.2 dvpr) at a ratio of 8:1:8. A Non-Target Virus served as a control (23Sarbassov D.D. Guertin D.A. Ali S.M. Sabatini D.M. Science. 2005; 307: 1098-1101Crossref PubMed Scopus (5179) Google Scholar). As virus 11 gave the most effective knockdown (data not shown), all subsequent studies were performed with this virus, and the non-target virus control. This shRNA clone has no potential to directly knockdown other LOX isoforms, as confirmed by BLAST analyses (supplemental Fig. S3) that shows no common sequence with any other lysyl oxidase isoform, or sufficient similarity to any murine mRNA or gene coding sequence (28Du Q. Thonberg H. Wang J. Wahlestedt C. Liang Z. Nucleic Acids Res. 2005; 33: 1671-1677Crossref PubMed Scopus (197) Google Scholar, 29Elbashir S.M. Martinez J. Patkaniowska A. Lendeckel W. Tuschl T. EMBO J. 2001; 20: 6877-6888Crossref PubMed Scopus (1199) Google Scholar). Data in Fig. 6 demonstrate that LOXL2 protein levels are diminished in differentiating ATDC5 cells compared with the non-target virus control, confirming that the shRNA lentivirus successfully diminished LOXL2 production. We next determined the effect of LOXL2 knockdown on the expression of chondrocyte-specific differentiation marker mRNAs. Data in Fig. 7 show remarkable inhibition of expression of the chondrocyte differentiation markers: SOX9, type II collagen, type X collagen, and aggrecan. Alcian blue (Fig. 8) and alizarin red (Fig. 9) staining of differentiating LOXL2 knockdown and non-target lentivirus transduced ATDC5 cells show nearly complete inhibition of chondrocyte-like extracellular matrix, and mineralized nodule formation in LOXL2 knockdown cultures. Interestingly, though LOXL2 shRNA clone 11 is specific LOXL1, LOXL3, and LOXL4, but not LOX mRNAs, were also significantly down-regulated compared with non-target shRNA (supplemental Fig. S4, two way ANOVA). Taken together, these data indica" @default.
• W2079789962 created "2016-06-24" @default.
• W2079789962 creator A5000708837 @default.
• W2079789962 creator A5014429189 @default.
• W2079789962 creator A5028448259 @default.
• W2079789962 creator A5063351158 @default.
• W2079789962 creator A5068260159 @default.
• W2079789962 creator A5079624507 @default.
• W2079789962 creator A5091330893 @default.
• W2079789962 date "2011-01-01" @default.
• W2079789962 modified "2023-10-05" @default.
• W2079789962 title "Lysyl Oxidase-like-2 (LOXL2) Is a Major Isoform in Chondrocytes and Is Critically Required for Differentiation" @default.
• W2079789962 cites W1516816071 @default.
• W2079789962 cites W175967323 @default.
• W2079789962 cites W1965148579 @default.
• W2079789962 cites W1965895242 @default.
• W2079789962 cites W1978327680 @default.
• W2079789962 cites W1982944995 @default.
• W2079789962 cites W1993830959 @default.
• W2079789962 cites W1993969378 @default.
• W2079789962 cites W2001633106 @default.
• W2079789962 cites W2011833926 @default.
• W2079789962 cites W2023715830 @default.
• W2079789962 cites W2027177582 @default.
• W2079789962 cites W2027696305 @default.
• W2079789962 cites W2031065422 @default.
• W2079789962 cites W2034302018 @default.
• W2079789962 cites W2034356701 @default.
• W2079789962 cites W2035474317 @default.
• W2079789962 cites W2035797927 @default.
• W2079789962 cites W2036856612 @default.
• W2079789962 cites W2048050845 @default.
• W2079789962 cites W2052335713 @default.
• W2079789962 cites W2063165063 @default.
• W2079789962 cites W2063405742 @default.
• W2079789962 cites W2064167215 @default.
• W2079789962 cites W2064275658 @default.
• W2079789962 cites W2065704432 @default.
• W2079789962 cites W2069299659 @default.
• W2079789962 cites W2075520774 @default.
• W2079789962 cites W2076370839 @default.
• W2079789962 cites W2080754455 @default.
• W2079789962 cites W2084097144 @default.
• W2079789962 cites W2085803388 @default.
• W2079789962 cites W2087543076 @default.
• W2079789962 cites W2109293470 @default.
• W2079789962 cites W2127535576 @default.
• W2079789962 cites W2133819222 @default.
• W2079789962 cites W2135097235 @default.
• W2079789962 cites W2135652726 @default.
• W2079789962 cites W2140654254 @default.
• W2079789962 cites W2152297596 @default.
• W2079789962 cites W2152637989 @default.
• W2079789962 cites W2157149444 @default.
• W2079789962 cites W2159323339 @default.
• W2079789962 cites W2160514176 @default.
• W2079789962 cites W2163889800 @default.
• W2079789962 cites W2173962683 @default.
• W2079789962 cites W4238567307 @default.
• W2079789962 cites W4248856167 @default.
• W2079789962 doi "https://doi.org/10.1074/jbc.m110.155622" @default.
• W2079789962 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3020776" @default.
• W2079789962 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/21071451" @default.
• W2079789962 hasPublicationYear "2011" @default.
• W2079789962 type Work @default.
• W2079789962 sameAs 2079789962 @default.
• W2079789962 citedByCount "37" @default.
• W2079789962 countsByYear W20797899622012 @default.
• W2079789962 countsByYear W20797899622013 @default.
• W2079789962 countsByYear W20797899622015 @default.
• W2079789962 countsByYear W20797899622016 @default.
• W2079789962 countsByYear W20797899622017 @default.
• W2079789962 countsByYear W20797899622018 @default.
• W2079789962 countsByYear W20797899622019 @default.
• W2079789962 countsByYear W20797899622020 @default.
• W2079789962 countsByYear W20797899622021 @default.
• W2079789962 countsByYear W20797899622022 @default.
• W2079789962 countsByYear W20797899622023 @default.
• W2079789962 crossrefType "journal-article" @default.
• W2079789962 hasAuthorship W2079789962A5000708837 @default.
• W2079789962 hasAuthorship W2079789962A5014429189 @default.
• W2079789962 hasAuthorship W2079789962A5028448259 @default.
• W2079789962 hasAuthorship W2079789962A5063351158 @default.
• W2079789962 hasAuthorship W2079789962A5068260159 @default.
• W2079789962 hasAuthorship W2079789962A5079624507 @default.
• W2079789962 hasAuthorship W2079789962A5091330893 @default.
• W2079789962 hasBestOaLocation W20797899621 @default.
• W2079789962 hasConcept C104317684 @default.
• W2079789962 hasConcept C181199279 @default.
• W2079789962 hasConcept C185592680 @default.
• W2079789962 hasConcept C193143273 @default.
• W2079789962 hasConcept C53345823 @default.
• W2079789962 hasConcept C55493867 @default.
• W2079789962 hasConcept C86803240 @default.
• W2079789962 hasConcept C95444343 @default.
• W2079789962 hasConceptScore W2079789962C104317684 @default.
• W2079789962 hasConceptScore W2079789962C181199279 @default.
• W2079789962 hasConceptScore W2079789962C185592680 @default.

• next