FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2079842211> ?p ?o ?g. }

• W2079842211 endingPage "13281" @default.
• W2079842211 startingPage "13270" @default.
• W2079842211 abstract "We have identified YkbA from Bacillus subtilis as a novel member of the l-amino acid transporter (LAT) family of amino acid transporters. The protein is ∼30% identical in amino acid sequence to the light subunits of human heteromeric amino acid transporters. Purified His-tagged YkbA from Escherichia coli membranes reconstituted in proteoliposomes exhibited sodium-independent, obligatory exchange activity for l-serine and l-threonine and also for aromatic amino acids, albeit with less activity. Thus, we propose that YkbA be renamed SteT (Ser/Thr exchanger transporter). Kinetic analysis supports a sequential mechanism of exchange for SteT. Freeze-fracture analysis of purified, functionally active SteT in proteoliposomes, together with blue native polyacrylamide gel electrophoresis and transmission electron microscopy of detergent-solubilized purified SteT, suggest that the transporter exists in a monomeric form. Freeze-fracture analysis showed spherical particles with a diameter of 7.4 nm. Transmission electron microscopy revealed elliptical particles (diameters 6 × 7 nm) with a distinct central depression. To our knowledge, this is the first functional characterization of a prokaryotic member of the LAT family and the first structural data on an APC (amino acids, polyamines, and choline for organocations) transporter. SteT represents an excellent model to study the molecular architecture of the light subunits of heteromeric amino acid transporters and other APC transporters. We have identified YkbA from Bacillus subtilis as a novel member of the l-amino acid transporter (LAT) family of amino acid transporters. The protein is ∼30% identical in amino acid sequence to the light subunits of human heteromeric amino acid transporters. Purified His-tagged YkbA from Escherichia coli membranes reconstituted in proteoliposomes exhibited sodium-independent, obligatory exchange activity for l-serine and l-threonine and also for aromatic amino acids, albeit with less activity. Thus, we propose that YkbA be renamed SteT (Ser/Thr exchanger transporter). Kinetic analysis supports a sequential mechanism of exchange for SteT. Freeze-fracture analysis of purified, functionally active SteT in proteoliposomes, together with blue native polyacrylamide gel electrophoresis and transmission electron microscopy of detergent-solubilized purified SteT, suggest that the transporter exists in a monomeric form. Freeze-fracture analysis showed spherical particles with a diameter of 7.4 nm. Transmission electron microscopy revealed elliptical particles (diameters 6 × 7 nm) with a distinct central depression. To our knowledge, this is the first functional characterization of a prokaryotic member of the LAT family and the first structural data on an APC (amino acids, polyamines, and choline for organocations) transporter. SteT represents an excellent model to study the molecular architecture of the light subunits of heteromeric amino acid transporters and other APC transporters. The APC (amino acids, polyamines, and choline for organocations) superfamily of transport proteins includes nearly 250 members that function as solute-cation symporters and solute-solute antiporters (1Jack D.L. Paulsen I.T. Saier Jr., M.H. Microbiology. 2000; 146: 1797-1814Crossref PubMed Scopus (222) Google Scholar). They occur in all phyla from prokaryotes to higher eukaryotes and vary in length between 350 and 850 amino acid residues. The smaller proteins are generally of prokaryotic origin, whereas the larger ones are of eukaryotic origin and have N- and C-terminal hydrophilic extensions. Most APC members are predicted to possess 12 transmembrane (TM) 10The abbreviations used are: TM, transmembrane; BN-PAGE, blue native polyacrylamide gel electrophoresis; DDM, n-dodecyl-β-d-maltopyranoside; DM, n-decyl-β-d-maltopyranoside; PL, proteoliposome; TEM, transmission electron microscopy; LAT, l-amino acid transporter; HAT, heteromeric amino acid transporter; NTA, nitrilotriacetic acid. α-helical domains. The l-amino acid transporter (LAT) family belongs to the APC superfamily. LAT family members correspond to the light subunits of the heteromeric amino acid transporters (HATs), also called glycoprotein-associated amino acid transporters (2Palacin M. Kanai Y. Pflugers Arch. 2004; 447: 490-494Crossref PubMed Scopus (134) Google Scholar, 3Verrey F. Closs E.I. Wagner C.A. Palacin M. Endou H. Kanai Y. Pflugers Arch. 2004; 447: 532-542Crossref PubMed Scopus (559) Google Scholar, 4Palacin M. Nunes V. Font-Llitjos M. Jimenez-Vidal M. Fort J. Gasol E. Pineda M. Feliubadalo L. Chillaron J. Zorzano A. Physiology (Bethesda). 2005; 20: 112-124Crossref PubMed Scopus (117) Google Scholar). HATs are composed of two subunits, a polytopic membrane protein (the light subunit) and a disulfide-linked N-glycosylated type II membrane glycoprotein (the heavy subunit). The light subunit is the catalytic component of the transporter, whereas the heavy subunit appears to be essential only for trafficking to the plasma membrane. Two types of heavy subunit (4F2hc and rBAT) and 10 types of light subunit have so far been identified. A number of human pathologies have highlighted the physiological roles of HATs. For example, two transporters of this family are responsible for inherited aminoacidurias; mutations in either of the two genes coding for the subunits of system b0,+ (b0,+AT and rBAT) lead to cystinuria (MIM 220100) (5Calonge M.J. Gasparini P. Chillaron J. Chillon M. Gallucci M. Rousaud F. Zelante L. Testar X. Dallapiccola B. Di Silverio F. Barcelo P. Estivill X. Zorzano A. Nunes V. Palacin M. Nat. Genet. 1994; 6: 420-425Crossref PubMed Scopus (344) Google Scholar, 6Feliubadalo L. Font M. Purroy J. Rousaud F. Estivill X. Nunes V. Golomb E. Centola M. Aksentijevich I. Kreiss Y. Goldman B. Pras M. Kastner D.L. Pras E. Gasparini P. Bisceglia L. Beccia E. Gallucci M. de Sanctis L. Ponzone A. Rizzoni G.F. Zelante L. Bassi M.T. George Jr., A.L. Manzoni M. De Grandi A. Riboni M. Endsley J.K. Ballabio A. Borsani G. Reig N. Fernandez E. Estevez R. Nat. Genet. 1999; 23: 52-57Crossref PubMed Scopus (294) Google Scholar), whereas mutations in y+LAT1 (a 4F2hc-associated system y+L) result in lysinuric protein intolerance (LPI) (MIM222700) (7Torrents D. Mykkanen J. Pineda M. Feliubadalo L. Estevez R. de Cid R. Sanjurjo P. Zorzano A. Nunes V. Huoponen K. Reinikainen A. Simell O. Savontaus M.L. Aula P. Palacin M. Nat. Genet. 1999; 21: 293-296Crossref PubMed Scopus (236) Google Scholar, 8Borsani G. Bassi M.T. Sperandeo M.P. De Grandi A. Buoninconti A. Riboni M. Manzoni M. Incerti B. Pepe A. Andria G. Ballabio A. Sebastio G. Nat. Genet. 1999; 21: 297-301Crossref PubMed Scopus (191) Google Scholar). In addition, xCT, a LAT transporter that in association with 4F2hc mediates cystine uptake and glutamate efflux (9Sato H. Tamba M. Ishii T. Bannai S. J. Biol. Chem. 1999; 274: 11455-11458Abstract Full Text Full Text PDF PubMed Scopus (746) Google Scholar, 10Bassi M.T. Gasol E. Manzoni M. Pineda M. Riboni M. Martin R. Zorzano A. Borsani G. Palacin M. Pflugers Arch. 2001; 442: 286-296Crossref PubMed Scopus (120) Google Scholar), has been recently identified as the receptor of Kaposi’s sarcoma-associated Herpesvirus (human herpesvirus 8) (11Kaleeba J.A. Berger E.A. Science. 2006; 311: 1921-1924Crossref PubMed Scopus (132) Google Scholar). In vivo, this transport system is involved in cocaine relapse through the control of the basal levels of extrasynaptic glutamate (12Baker D.A. McFarland K. Lake R.W. Shen H. Tang X.C. Toda S. Kalivas P.W. Nat. Neurosci. 2003; 6: 743-749Crossref PubMed Scopus (610) Google Scholar), and it contributes to the maintenance of the plasma redox balance (13Sato H. Shiiya A. Kimata M. Maebara K. Tamba M. Sakakura Y. Makino N. Sugiyama F. Yagami K. Moriguchi T. Takahashi S. Bannai S. J. Biol. Chem. 2005; 280: 37423-37429Abstract Full Text Full Text PDF PubMed Scopus (291) Google Scholar). Despite the important roles attributed to HATs, only a few studies have addressed the structure-function relationships of these transporters: (i) most HATs are obligate antiporters with a 1:1 stoichiometry (14Chillaron J. Roca R. Valencia A. Zorzano A. Palacin M. Am. J. Physiol. 2001; 281: F995-F1018Crossref PubMed Google Scholar), and a sequential mode of exchange has been proposed for system b0,+ (15Torras-Llort M. Torrents D. Soriano-Garcia J.F. Gelpi J.L. Estevez R. Ferrer R. Palacin M. Moreto M. J. Membr. Biol. 2001; 180: 213-220Crossref PubMed Scopus (39) Google Scholar); (ii) light subunits appear to be sufficient for transport activity, as demonstrated for b0,+AT (16Reig N. Chillaron J. Bartoccioni P. Fernandez E. Bendahan A. Zorzano A. Kanner B. Palacin M. Bertran J. EMBO J. 2002; 21: 4906-4914Crossref PubMed Scopus (91) Google Scholar); (iii) using xCT as a model for the light subunits, a membrane topology with 12 transmembrane segments and with a re-entrant loop between transmembrane segments 2 and 3 has been reported (17Gasol E. Jimenez-Vidal M. Chillaron J. Zorzano A. Palacin M. J. Biol. Chem. 2004; 279: 31228-31236Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar); and (iv) the xCT residues His110 and Cys327 have been shown to be crucial for function (17Gasol E. Jimenez-Vidal M. Chillaron J. Zorzano A. Palacin M. J. Biol. Chem. 2004; 279: 31228-31236Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar, 18Jimenez-Vidal M. Gasol E. Zorzano A. Nunes V. Palacin M. Chillaron J. J. Biol. Chem. 2004; 279: 11214-11221Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar), whereas the cystinuria-specific mutation A354T inactivates b0,+AT (16Reig N. Chillaron J. Bartoccioni P. Fernandez E. Bendahan A. Zorzano A. Kanner B. Palacin M. Bertran J. EMBO J. 2002; 21: 4906-4914Crossref PubMed Scopus (91) Google Scholar). Similarly, structure-function studies on the APC superfamily as a whole have been very limited and primarily related to membrane topology studies and the identification of relevant residues for substrate interaction (19Kashiwagi K. Kuraishi A. Tomitori H. Igarashi A. Nishimura K. Shirahata A. Igarashi K. J. Biol. Chem. 2000; 275: 36007-36012Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar, 20Hu L.A. King S.C. Biochem. J. 1999; 339: 649-655Crossref PubMed Scopus (8) Google Scholar, 21Habermeier A. Wolf S. Martine U. Graf P. Closs E.I. J. Biol. Chem. 2003; 278: 19492-19499Abstract Full Text Full Text PDF PubMed Scopus (20) Google Scholar). The recent elucidation of atomic structures for several prokaryotic transporters has given key insights into the molecular dynamics of fundamental transport processes. Toward a similar increase in our understanding of amino acid transport, we describe here the identification and characterization, at the functional and structural levels, of the first example of a prokaryotic member of the LAT family: the orphan transporter YkbA (from here on referred to as SteT; see below) from Bacillus subtilis. SteT shows significant similarity to the light subunits of eukaryotic HATs not only in amino acid sequence and putative membrane topology, but also in the characteristic sequential mode of obligatory exchange. Structural analyses of SteT revealed a monomeric structure with a “donut-like shape” of 7 × 6 nm in diameters and a distinct central depression. SteT represents an excellent model for structural studies of the LAT family and of APC transporters in general. Identification and Sequence Analysis of SteT—Initial sequence analysis that led to the identification of prokaryotic homologs of LAT family transporters was performed by using the BLAST algorithm (default settings) (22Altschul S.F. Gish W. Miller W. Myers E.W. Lipman D.J. J. Mol. Biol. 1990; 215: 403-410Crossref PubMed Scopus (70758) Google Scholar) to compare all known members of the LAT family against a nonredundant protein sequence data base (nonredundant GenBank™ CDS translations + RefSeq proteins + Protein Data Bank + SwissProt + PIR + PRF). In order to study the phylogenetic relationship of SteT and PotE relative to the APC superfamily of transporters (23Chang A.B. Lin R. Keith Studley W. Tran C.V. Saier Jr., M.H. Mol. Membr. Biol. 2004; 21: 171-181Crossref PubMed Scopus (139) Google Scholar), we first constructed a multiple protein sequence alignment of all known APC members (listed on the World Wide Web at www.tcdb.org/tcdb/superfamily.php–>) with test sequences using ProbCons (24Do C.B. Mahabhashyam M.S. Brudno M. Batzoglou S. Genome Res. 2005; 15: 330-340Crossref PubMed Scopus (881) Google Scholar) in combination with manual refinements. All APC members that appeared to be too distant to provide information (i.e. that could not be properly aligned) were not further considered. The resulting alignment was further evaluated with G-BLOCKS (25Castresana J. Mol. Biol. Evol. 2000; 17: 540-552Crossref PubMed Scopus (7408) Google Scholar) in order to select the most conserved and hence most informative regions of the multiple alignment. The latter were subsequently processed with Clustal (26Chenna R. Sugawara H. Koike T. Lopez R. Gibson T.J. Higgins D.G. Thompson J.D. Nucleic Acids Res. 2003; 31: 3497-3500Crossref PubMed Scopus (4057) Google Scholar) to obtain a neighbor-joining phylogenetic tree (1000 bootstraps with 111 random seeds). Cloning of Prokaryotic APC Transporters—Genomic DNA from Escherichia coli strain DH5α and from B. subtilis strain 168t+ was prepared from cells collected after an overnight liquid culture. Cell pellets were incubated for 1 h at 50 °C in 10 mm Tris-HCl, pH 8, 0.1 m EDTA, 0.5% SDS with 0.1 mg/ml Proteinase K. Three extractions with the same volume of phenol were performed with centrifugations at 5,000 × g. Next, a chloroform/ethanol precipitation gave final pellets that were resuspended in 10 mm Tris-HCl, pH 8.0, and 1 mm EDTA. The following primers (5′-3′) were used to amplify open reading frames encoding the indicated proteins from genomic DNA by PCR: ATCTGAATTCTGATGCGCAAAGCACCCTGTT and CATTCTCGAGAGAAAGGGCGATCATTCAATC for PotE and ATCTGAATTCTCCTCCACATTACATAACATCA and CATTCTCGAGAGTCCACGGTGCTTTTATCAAT for YhfM from E. coli and ATCAGAATTCGAAGCTTCAACATCATAGGAG and CTATCTCGAGTCCTGTCAACTTTTATCTTCTG for SteT and ATGTGAATTCCAATATAATACAACAAGAACTGC and TCTACTCGAGTATCGCTTCATCTGTGTGTC for YfnA from B. subtilis. PCR products were digested with EcoRI and XhoI and ligated into a pBlueScript vector (Stratagene). Another PCR with the following primers (5′-3′) was performed to subclone each transporter open reading frame into the EcoRI and PstI sites of a modified version of the vector pTTQ18 (27Xie H. Patching S.G. Gallagher M.P. Litherland G.J. Brough A.R. Venter H. Yao S.Y. Ng A.M. Young J.D. Herbert R.B. Henderson P.J. Baldwin S.A. Mol. Membr. Biol. 2004; 21: 323-336Crossref PubMed Scopus (38) Google Scholar), thereby placing its expression under the control of the tac promoter: TGATGAATTCGATGAGTCAGGCTAAATC and ACCGCCTGCAGAACCGTGTTTATTTTTCAGT for PotE, TGATGAATTCGATGACTGCAAACTCTCCCCTA and ACCGCCTGCAGACGACAAAGCGTTGAGCTGGC for YhfM, TGATGAATTCGATGCATACTGAAGACAACGG and ACCGCCTGCAGAGCTTGCTTTTCGTTTTTTCA for SteT, and CGATGAATTCGATGAGTTCATTATTTAGA and ACCGCCTGCAGATTTGTTTAATAAGCTGTGTT for YfnA. All DNA constructs were verified by sequencing. Expression of Prokaryotic APC Transporters in E. coli—Expression experiments were carried out with freshly transformed cultures of E. coli strain BL21(DE3). Initially, the expression of the four APC transporters (PotE, YhfM, SteT, and YfnA) was investigated in 50-ml samples cultured in LB medium containing 50 μg/ml ampicillin. When the A600 had reached 0.5, protein expression was induced by the addition of 0.5 mm isopropyl-β-d-thiogalactoside (Roche Applied Science). To estimate protein expression, cells were harvested after incubation for different time periods (1, 2, 3, and 4 h and overnight) at 30 or 37 °C. For biochemical or functional analyses of SteT and PotE, either 6 × 0.8 liters of medium in flasks or 10 liters of medium in a fermentor were inoculated with E. coli cultures harboring pTTQ18-His6-YkbA or pTTQ18-His6-PotE. Cells were induced with 0.5 mm isopropyl-β-d-thiogalactoside at an A600 of 0.5 and harvested after 3 h growth at 30 and 37 °C, respectively. In all cases, the cell pellet was resuspended in lysis buffer (20 mm Tris-HCl, pH 8, 0.5 mm EDTA) and stored frozen at –20 °C. Preparation of E. coli Membranes—Cell pellets were thawed and disrupted by passage through a French pressure cell (20,000 p.s.i., three times). Unbroken cells were removed by centrifugation (10 min at 10,000 × g and 4 °C). The supernatant was ultracentrifuged (1 h at 100,000 × g and 4 °C), and the pellet was resuspended and homogenized (30-ml glass homogenizer for 2 min) in lysis buffer and ultracentrifuged again. Peripheral membrane proteins were removed by homogenization in 20 mm Tris-HCl, pH 8, 300 mm NaCl, and ultracentrifugation. Finally, the membrane pellet was resuspended in 20 mm Tris-HCl, pH 8, 150 mm NaCl at a protein concentration between 13 and 25 mg/ml. Aliquots were frozen in liquid nitrogen and stored at –80 °C until use. Purification of APC Transporters—To estimate protein expression and functional reconstitution of SteT and PotE, frozen membranes were thawed and solubilized in 0.5% n-dodecyl-β-d-maltopyranoside (DDM; Anatrace), 20 mm Tris-HCl, pH 8, 20% glycerol, 50 mm NaCl on a roller shaker (1 h, 4 °C) at a protein concentration of ∼2 mg/ml. The supernatant after ultracentrifugation (1 h at 100,000 × g, 4 °C) was incubated for 2 h at 4 °C with equilibrated Ni2+-NTA Superflow beads (Qiagen) with washing buffer (20 mm Tris-HCl, pH 8, 20% glycerol, 200 mm NaCl, 0.05% DDM, 10 mm imidazole). The supernatant fraction (slurry) was removed by centrifugation (1 min at ∼160 × g). Protein-bound beads were washed three times with 10 ml of washing buffer and centrifuged as before. Then columns were packed with 5 ml of protein-bound beads each. Two more washes were performed with 15 ml of washing buffer before elution with 10 ml of elution buffer (washing buffer supplemented with 500 mm imidazole). The purified protein was concentrated by centrifugation in an Amicon Ultra (10,000 molecular weight cut-off; Millipore) at 3,220 × g down to a volume of 1 ml. Imidazole was removed by the addition of 10 ml of 20 mm Tris-HCl, pH 8, 20% glycerol, 200 mm NaCl, 0.05% DDM and reconcentration to the desired final volume. For negative stain transmission electron microscopy (TEM) studies, frozen SteT-containing membranes were thawed and solubilized for 1 h at 4°C in 1% n-decyl-β-d-maltopyranoside (DM; Anatrace), 20 mm Tris-HCl, pH 8, 300 mm NaCl, 10% glycerol, 0.01% NaN3. The protein concentration during solubilization was between 2 and 3 mg/ml. After ultracentrifugation (100,000 × g, 45 min at 4 °C), the supernatant was diluted 2-fold with 20 mm Tris-HCl, pH 8, 300 mm NaCl, 0.3% DM, 3 mm histidine, 10% glycerol, 0.01% NaN3 (washing buffer) and bound for 2 h at 4°C to Ni2+-NTA Superflow beads (Qiagen). The beads were then loaded onto a spin column (Promega), washed with washing buffer, and eluted with the same buffer containing 200 mm histidine. Reconstitution into Proteoliposomes—E. coli polar lipid extract (Avanti Polar Lipids) solubilized in chloroform (50 mg/ml) was dried under a stream of nitrogen to remove the solvent and to obtain a thin layer of dry lipids in a glass tube. The dried lipids were resuspended in dialysis buffer (120 mm KPi, pH 7.4, 0.5 mm EDTA, 1 mm MgSO4, 5 mm TrisSO4, 1% glycerol, and a 4 mm concentration of the desired amino acid, unless otherwise indicated) to yield a final lipid concentration of 40 mg/ml. After four 30-s sonication and vortexing cycles, the liposomes were extruded in a LiposoFast-Pneumatic Actuator (Avestin) through a 400-nm polycarbonate filter (Avestin) to obtain unilamellar vesicles of homogeneous size. Liposomes were mixed with purified protein at a 1:100 (occasionally 1:40) protein/lipid ratio (w/w). To destabilize the liposomes, 1.25% β-d-octyl glucoside (Roche Applied Science) was added and incubated in ice with occasional agitation for 5 min. DDM and β-d-octyl glucoside were removed by dialysis for 40 h at 4 °C against 100 volumes of dialysis buffer. Finally, proteoliposomes were ultracentrifuged (100,000 × g, 1 h at 4 °C), and the pellet was resuspended in one-third of the initial volume of dialysis buffer without amino acids. Transport Measurements—Influx measurements in proteoliposomes were made as described (16Reig N. Chillaron J. Bartoccioni P. Fernandez E. Bendahan A. Zorzano A. Kanner B. Palacin M. Bertran J. EMBO J. 2002; 21: 4906-4914Crossref PubMed Scopus (91) Google Scholar) with minor changes. Cold proteoliposomes (10 μl) were mixed with 180 μl of transport buffer (150 mm choline chloride, 10 mm Tris-HEPES, pH 7.4, 1 mm MgCl2, 1 mm CaCl2, 0.5 μCi of radiolabeled l-amino acid, and unlabeled amino acid to the desired final concentration) and incubated at room temperature for different periods of time. To test the effect of an imposed membrane potential, 2.8 μm valinomycin (Sigma) was added to the transport buffer. Reactions were stopped by the addition of 850 μl of ice-cold stop buffer (150 mm choline chloride, 10 mm Tris-HEPES, and 5 mm l-serine or putrescine for SteT- and PotE-containing proteoliposomes, respectively) and filtration through membrane filters (Sartorius; 0.45-μm pore size). Filters were then washed three times with 2 ml of stop buffer and dried, and the trapped radioactivity was counted. All experimental values were corrected by subtracting zero time values obtained by adding the stop solution before the proteoliposomes into the transport buffer. The following radiolabeled compounds (American Radiolabeled Chemicals) were used in this study: l-[3H]serine, [3H]putrescine, l-[3H]ornithine, l-[3H]arginine, l-[3H]lysine, [3H]glycine, l-[3H]proline, l-[3H]leucine, l-[3H]isoleucine, l-[3H]methionine, l-[3H]glutamate, and l-[3H]alanine. For efflux measurements, proteoliposomes (400 μl) were mixed with 200 μl of 3-fold concentrated transport buffer (450 mm choline chloride, 30 mm Tris-HEPES, pH 7.4, 3 mm MgCl2, 3 mm CaCl2, 35 μCi of l-[3H]serine at a final concentration of 10 μm) and incubated at room temperature for 2 h. Then the proteoliposome suspensions were divided into two halves (295 μl each), and these were diluted 13-fold with transport buffer (without l-[3H]serine) with or without 7 mm l-serine. At the indicated times, aliquots (195 μl) were mixed with ice-cold stop buffer (850 μl), vortexed, and filtered (0.45-μm pore size; Sartorius). Filters were then washed three times with 2 ml of stop buffer and dried, and the trapped radioactivity was counted. Simulation of SteT Exchange Activity—Simulation of the time course of transport of radiolabeled l-serine into proteoliposomes containing purified SteT (SteT-PLs) was performed using a model based on the following premises: (i) the induced amino acid transport activity is an obligatory exchange process with a 1:1 stoichiometry; (ii) an additional diffusive, protein-independent flux is necessary to explain transport observed in the absence of transporter (i.e. in proteoliposomes containing no SteT) or in the absence of exchangeable amino acids (SteT-PLs containing l-arginine instead of l-serine). The computer program, previously designed to simulate transport in oocytes (28Chillaron J. Estevez R. Mora C. Wagner C.A. Suessbrich H. Lang F. Gelpi J.L. Testar X. Busch A.E. Zorzano A. Palacin M. J. Biol. Chem. 1996; 271: 17761-17770Abstract Full Text Full Text PDF PubMed Scopus (163) Google Scholar) and membrane vesicles (15Torras-Llort M. Torrents D. Soriano-Garcia J.F. Gelpi J.L. Estevez R. Ferrer R. Palacin M. Moreto M. J. Membr. Biol. 2001; 180: 213-220Crossref PubMed Scopus (39) Google Scholar), was adapted to model amino acid exchange and simulated the experimental influx and efflux rates governed by a concerted (i.e. sequential) mechanism of exchange, as described in a previous study for system b0,+ (15Torras-Llort M. Torrents D. Soriano-Garcia J.F. Gelpi J.L. Estevez R. Ferrer R. Palacin M. Moreto M. J. Membr. Biol. 2001; 180: 213-220Crossref PubMed Scopus (39) Google Scholar). Different types of mechanisms (e.g. ping-pong), however, would produce similar results (data not shown). The computer program is available upon request. The simulations were set up using the following rules. (i) Characteristics of the simulated system were as follows. The experimental setup was reproduced as two separate compartments. The outside compartment volume was set to 86 μl (taking 1 μg of protein as a reference). The inside volume, 62 nl, together with the Fick parameter, was deduced from extrapolation to infinity of nonspecific influx measurements (SteT-PLs containing l-arginine), fitted to the Fick law by standard nonlinear regression. (ii) Kinetic parameters were as follows. Experimental parameters were used when available. Best values for the unknown parameters and transporter concentration were determined after a systematic search of the appropriate range of values. (iii) The simulation procedure was as follows. Transport rates were evaluated from the relative concentrations of transporter complexes. Transport rates were estimated on the assumption that the limiting step is the translocation of the transporter bound to the substrate, as described for system y+L (29Eleno N. Deves R. Boyd C.A. J. Physiol. (Lond.). 1994; 479: 291-300Crossref Scopus (70) Google Scholar), and therefore all binding steps were considered as being at equilibrium. Possible inactivation of the transporter was included as an exponential first order law with the appropriate parameters. During simulation, amino acid concentrations were calculated by numerical integration of the transport rates. Integration was performed with a constant time step of 0.02 min during the desired period. Freeze-Fracture and Electron Microscopy of Proteoliposomes—A freeze-fracture electron microscopy study was performed as described (30Lopez O. de la Maza A. Coderch L. Lopez-Iglesias C. Wehrli E. Parra J.L. FEBS Lett. 1998; 426: 314-318Crossref PubMed Scopus (151) Google Scholar). The suspension was sandwiched between two copper platelets using a 400-mesh gold grid as spacer. The samples were frozen by liquid propane immersion, at –189 °C and fractured at –150 °C and 10–8 millibars in a BAL-TEC BAF 060 freeze-etching system (BAL-TEC). The replicas were obtained by unidirectional shadowing at 45° with 2 nm of Pt/C and at 90° with 20 nm of C and subsequently floated on distilled water for 5 min. Electron micrographs (at ×50,000) were recorded in a Jeol 1010 electron microscope operated at 80 kV. Measurement of Freeze-Fracture Particles—Particle diameters were measured from scanned electron micrographs using AnalySIS software. The diameter was obtained by measuring the width of the particle edge-to-edge in a direction perpendicular to the direction of the shadow. Duplicate measurements of individual particles of SteT and PotE revealed a ±0.2-nm error of measurement. The accuracy of the diameter measurements was tested by measuring the diameter of 10-nm gold particles (Chemicon) placed directly on Formvar-coated copper grids (9.94 ± 0.04 nm; n = 125). All values are reported as means ± S.E. of the mean. Negative Stain TEM—DM-solubilized SteT protein as eluted from the Ni2+-NTA column was adsorbed for 10 s to parlodion carbon-coated copper grids rendered hydrophilic by glow discharge at low pressure in air. Grids were washed with four drops of double-distilled water and stained with 2 drops of 0.75% uranyl formate. This washing step is to effectively remove the buffer solution and not adsorbed protein. The former, if not removed, can lead to precipitation of the uranyl salts with buffer components. Electron micrographs were recorded at a magnification of ×50,000 and an underfocus of ∼400 nm on Eastman Kodak Co. S0-163 sheet films with a Hitachi H-7000 electron microscope operated at 100 kV. Blue Native Gel Electrophoresis—Linear 5–12% gradient gels for blue native polyacrylamide gel electrophoresis (BN-PAGE) were prepared and run as previously described (31Schagger H. Aquila H. von Jagow G. Anal. Biochem. 1988; 173: 201-205Crossref PubMed Scopus (144) Google Scholar). Thyroglobulin (669 kDa), ferritin (440 kDa), catalase (232 kDa), lactate dehydrogenase (140 kDa), and bovine serum albumin (66 kDa) were used as standard proteins. Screening for an Appropriate Prokaryotic Homolog Candidate of LAT Transporters—In order to identify appropriate prokaryotic homolog candidates for studying the structure-function relationships of the light subunits of HATs, an exhaustive search was made on several available protein sequence data bases. Among the most significant matches, four candidates were selected for further investigation: PotE and YhfM from E. coli and YkbA (SteT) and YfnA from B. subtilis. These proteins had amino acid sequence identities to the light subunits of HATs ranging from 17 to 29%. All of these candidates were hypothetical proteins (32Kunst F. Ogasawara N. Moszer I. Albertini A.M. Alloni G. Azevedo V. Bertero M.G. Bessieres P. Bolotin A. Borchert S. Borriss R. Boursier L. Brans A. Braun M. Brignell S.C. Bron S. Brouillet S. Bruschi C.V. Caldwell B. Capuano V. Carter N.M. Choi S.-K. Codani J.-J. Connerton I.F. Cummings N.J. Daniel R.A. Denizot F. Devine K.M. Düsterhöft A. Ehrlich S.D. Emmerson P.T. Entian K.D. Errington J. Nature. 1997; 390: 249-256Crossref PubMed Scopus (3127) Google Scholar, 33Riley M. Abe T. Arnaud M.B. Berlyn M.K. Blattner F.R. Chaudhuri R.R. Glasner J.D. Horiuchi T. Keseler I.M. Kosuge T. Mori H. Perna N.T. Plunkett III, G. Rudd K.E. Serres M.H. Thomas G.H. Thomson N.R. Wishart D. Wanner B.L. Nucleic Acids Res. 2006; 34: 1-9Crossref PubMed Scopus (425) Google Scholar) with the exception of PotE, the putrescine/ornithine exchanger (34Kashiwagi K" @default.
• W2079842211 created "2016-06-24" @default.
• W2079842211 creator A5007934360 @default.
• W2079842211 creator A5021120268 @default.
• W2079842211 creator A5023251665 @default.
• W2079842211 creator A5032060997 @default.
• W2079842211 creator A5034487444 @default.
• W2079842211 creator A5055099992 @default.
• W2079842211 creator A5059581003 @default.
• W2079842211 creator A5063831611 @default.
• W2079842211 creator A5066644040 @default.
• W2079842211 creator A5075717555 @default.
• W2079842211 creator A5086109236 @default.
• W2079842211 creator A5088134705 @default.
• W2079842211 date "2007-05-01" @default.
• W2079842211 modified "2023-10-18" @default.
• W2079842211 title "Functional and Structural Characterization of the First Prokaryotic Member of the L-Amino Acid Transporter (LAT) Family" @default.
• W2079842211 cites W1537499542 @default.
• W2079842211 cites W1540095279 @default.
• W2079842211 cites W1561921956 @default.
• W2079842211 cites W1601032788 @default.
• W2079842211 cites W185984331 @default.
• W2079842211 cites W1919659377 @default.
• W2079842211 cites W1963957860 @default.
• W2079842211 cites W1968390147 @default.
• W2079842211 cites W1969608063 @default.
• W2079842211 cites W1976678735 @default.
• W2079842211 cites W1976955003 @default.
• W2079842211 cites W1990036728 @default.
• W2079842211 cites W2000825098 @default.
• W2079842211 cites W2002054713 @default.
• W2079842211 cites W2003037559 @default.
• W2079842211 cites W2020817480 @default.
• W2079842211 cites W2035258850 @default.
• W2079842211 cites W2035323934 @default.
• W2079842211 cites W2044079355 @default.
• W2079842211 cites W2045622515 @default.
• W2079842211 cites W2052794591 @default.
• W2079842211 cites W2052939596 @default.
• W2079842211 cites W2055043387 @default.
• W2079842211 cites W2061491491 @default.
• W2079842211 cites W2070284483 @default.
• W2079842211 cites W2072620493 @default.
• W2079842211 cites W2078064634 @default.
• W2079842211 cites W2079162384 @default.
• W2079842211 cites W2081042705 @default.
• W2079842211 cites W2082748378 @default.
• W2079842211 cites W2095724872 @default.
• W2079842211 cites W2096987374 @default.
• W2079842211 cites W2097822945 @default.
• W2079842211 cites W2099384461 @default.
• W2079842211 cites W2100882223 @default.
• W2079842211 cites W2116429471 @default.
• W2079842211 cites W2129369040 @default.
• W2079842211 cites W2135874673 @default.
• W2079842211 cites W2140872496 @default.
• W2079842211 cites W2144325627 @default.
• W2079842211 cites W2159806870 @default.
• W2079842211 cites W2167426031 @default.
• W2079842211 cites W2167708455 @default.
• W2079842211 cites W2253798148 @default.
• W2079842211 doi "https://doi.org/10.1074/jbc.m610695200" @default.
• W2079842211 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17344220" @default.
• W2079842211 hasPublicationYear "2007" @default.
• W2079842211 type Work @default.
• W2079842211 sameAs 2079842211 @default.
• W2079842211 citedByCount "39" @default.
• W2079842211 countsByYear W20798422112012 @default.
• W2079842211 countsByYear W20798422112013 @default.
• W2079842211 countsByYear W20798422112014 @default.
• W2079842211 countsByYear W20798422112015 @default.
• W2079842211 countsByYear W20798422112016 @default.
• W2079842211 countsByYear W20798422112017 @default.
• W2079842211 countsByYear W20798422112019 @default.
• W2079842211 countsByYear W20798422112020 @default.
• W2079842211 countsByYear W20798422112022 @default.
• W2079842211 countsByYear W20798422112023 @default.
• W2079842211 crossrefType "journal-article" @default.
• W2079842211 hasAuthorship W2079842211A5007934360 @default.
• W2079842211 hasAuthorship W2079842211A5021120268 @default.
• W2079842211 hasAuthorship W2079842211A5023251665 @default.
• W2079842211 hasAuthorship W2079842211A5032060997 @default.
• W2079842211 hasAuthorship W2079842211A5034487444 @default.
• W2079842211 hasAuthorship W2079842211A5055099992 @default.
• W2079842211 hasAuthorship W2079842211A5059581003 @default.
• W2079842211 hasAuthorship W2079842211A5063831611 @default.
• W2079842211 hasAuthorship W2079842211A5066644040 @default.
• W2079842211 hasAuthorship W2079842211A5075717555 @default.
• W2079842211 hasAuthorship W2079842211A5086109236 @default.
• W2079842211 hasAuthorship W2079842211A5088134705 @default.
• W2079842211 hasBestOaLocation W20798422111 @default.
• W2079842211 hasConcept C104317684 @default.
• W2079842211 hasConcept C120665830 @default.
• W2079842211 hasConcept C121332964 @default.
• W2079842211 hasConcept C149011108 @default.
• W2079842211 hasConcept C185592680 @default.
• W2079842211 hasConcept C2780841128 @default.
• W2079842211 hasConcept C2992694208 @default.

• next