FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2080215841> ?p ?o ?g. }

• W2080215841 endingPage "27989" @default.
• W2080215841 startingPage "27981" @default.
• W2080215841 abstract "This paper presents a study of the role of positive charge in the Pi binding site of Escherichia coli ATP synthase, the enzyme responsible for ATP-driven proton extrusion and ATP synthesis by oxidative phosphorylation. Arginine residues are known to occur with high propensity in Pi binding sites of proteins generally and in the Pi binding site of the βE catalytic site of ATP synthase specifically. Removal of natural βArg-246 (βR246A mutant) abrogates Pi binding; restoration of Pi binding was achieved by mutagenesis of either residue βAsn-243 or αPhe-291 to Arg. Both residues are located in the Pi binding site close to βArg-246 in x-ray structures. Insertion of one extra Arg at β-243 or α-291 in presence of βArg-246 retained Pi binding, but insertion of two extra Arg, at both positions simultaneously, abrogated it. Transition state stabilization was measured using phosphate analogs fluoroaluminate and fluoroscandium. Removal of βArg-246 in βR246A caused almost complete loss of transition state stabilization, but partial rescue was achieved in βN243R/βR246A and αF291R/βR246A. βArg-243 or αArg-291 in presence of βArg-246 was less effective; the combination of αF291R/βN243R with natural βArg-246 was just as detrimental as βR246A. The data demonstrate that electrostatic interaction is an important component of initial Pi binding in catalytic site βE and later at the transition state complex. However, since none of the mutants showed significant function in growth tests, ATP-driven proton pumping, or ATPase activity assays, it is apparent that specific stereochemical interactions of catalytic site Arg residues are paramount. This paper presents a study of the role of positive charge in the Pi binding site of Escherichia coli ATP synthase, the enzyme responsible for ATP-driven proton extrusion and ATP synthesis by oxidative phosphorylation. Arginine residues are known to occur with high propensity in Pi binding sites of proteins generally and in the Pi binding site of the βE catalytic site of ATP synthase specifically. Removal of natural βArg-246 (βR246A mutant) abrogates Pi binding; restoration of Pi binding was achieved by mutagenesis of either residue βAsn-243 or αPhe-291 to Arg. Both residues are located in the Pi binding site close to βArg-246 in x-ray structures. Insertion of one extra Arg at β-243 or α-291 in presence of βArg-246 retained Pi binding, but insertion of two extra Arg, at both positions simultaneously, abrogated it. Transition state stabilization was measured using phosphate analogs fluoroaluminate and fluoroscandium. Removal of βArg-246 in βR246A caused almost complete loss of transition state stabilization, but partial rescue was achieved in βN243R/βR246A and αF291R/βR246A. βArg-243 or αArg-291 in presence of βArg-246 was less effective; the combination of αF291R/βN243R with natural βArg-246 was just as detrimental as βR246A. The data demonstrate that electrostatic interaction is an important component of initial Pi binding in catalytic site βE and later at the transition state complex. However, since none of the mutants showed significant function in growth tests, ATP-driven proton pumping, or ATPase activity assays, it is apparent that specific stereochemical interactions of catalytic site Arg residues are paramount. ATP synthase is the terminal enzyme of oxidative phosphorylation and photophosphorylation, which synthesizes ATP from ADP and phosphate (Pi). The energy for ATP synthesis comes from transmembrane movement of protons down an electrochemical gradient, generated by substrate oxidation or by light capture. Initially, as the protons move through the interface between a and c subunits in the membrane-bound F0-sector of the enzyme, the realized energy is transduced into mechanical rotation of a group of subunits (γϵc10-14), which comprise the “rotor”. A helical coiled coil domain of γ projects into the central space of the α3β3 hexagon, in the membrane-extrinsic F1-sector. α3β3 hexagon contains three catalytic sites at α/β interfaces. In a manner that is not yet understood, rotation of γ vis-à-vis the three α/β subunit pairs brings about ATP synthesis at the three catalytic sites using a sequential reaction scheme (1Senior A.E. Weber J. Nat. Struct. Mol. Biol. 2004; 11: 110-112Crossref PubMed Scopus (25) Google Scholar). “Stator” subunits b2 and δ are present to prevent co-rotation of α3β3 with the rotor. Detailed reviews of ATP synthase mechanism may be found in Refs. 2Weber J. Senior A.E. FEBS Lett. 2003; 545: 61-70Crossref PubMed Scopus (235) Google Scholar, 3Senior A.E. Nadanaciva S. Weber J. Biochim. Biophys. Acta. 2002; 1553: 188-211Crossref PubMed Scopus (331) Google Scholar, 4Noji H. Yoshida M. J. Biol. Chem. 2001; 276: 1665-1668Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar, 5Leslie A.G.W. Walker J.E. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2000; 355: 465-472Crossref PubMed Scopus (64) Google Scholar.Binding of Pi is an important step of the ATP synthase mechanism that has been extensively studied by biochemical approaches and may be directly coupled to rotation of subunits (3Senior A.E. Nadanaciva S. Weber J. Biochim. Biophys. Acta. 2002; 1553: 188-211Crossref PubMed Scopus (331) Google Scholar, 6Rosing J. Kayalar C. Boyer P.D. J. Biol. Chem. 1977; 252: 2478-2485Abstract Full Text PDF PubMed Google Scholar, 7Boyer P.D. FASEB J. 1989; 3: 2164-2178Crossref PubMed Scopus (207) Google Scholar, 8Al-Shawi M.K. Senior A.E. Biochemistry. 1992; 31: 886-891Crossref PubMed Scopus (30) Google Scholar, 9Al-Shawi M.K. Ketchum C.J. Nakamoto R.K. Biochemistry. 1997; 36: 12961-12969Crossref PubMed Scopus (64) Google Scholar, 10Masaike T. Muneyuki E. Noji H. Kinosita K. Yoshida M. J. Biol. Chem. 2002; 277: 21643-21649Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar, 11Ahmad Z. Senior A.E. J. Biol. Chem. 2004; 279: 31505-31513Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). Recent studies of the rotational mechanism have begun to illuminate which steps in the enzymic pathway of ATP synthesis and hydrolysis are likely coupled to the two substeps (80° and 40°) of subunit rotation and which steps occur in the intervening stationary dwells (12Yasuda R. Masaike T. Adachi K. Noji H. Itoh I. Kinosita K. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 9314-9318Crossref PubMed Scopus (85) Google Scholar, 13Shimabukuro K. Yasuda R. Muneyuki E. Hara K. Kinosita K. Yoshida M. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 14731-14736Crossref PubMed Scopus (214) Google Scholar, 14Nishizaka T. Oiwa K. Noji H. Kimura S. Muneyuki E. Yoshida M. Kinosita K. Nat. Struct. Mol. Biol. 2004; 11: 142-148Crossref PubMed Scopus (240) Google Scholar, 15Hirono-Hara Y. Ishizuka K. Kinosita K. Yoshida M. Noji H. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 4288-4293Crossref PubMed Scopus (90) Google Scholar). While it has not yet been possible to directly correlate the step of Pi binding/release with a specific mechanical event or an intervening dwell, it seems likely that this will soon be achieved. Thus we can foresee that it may be possible in the near future to correlate molecular features of Pi binding, derived from mutational and biochemical studies, with mechanical function in this nanomotor system.Studies of molecular aspects of Pi binding in ATP synthase have been held back by lack of a suitable system to which both mutagenesis and a Pi binding assay were applicable. Penefsky (16Penefsky H.S. J. Biol. Chem. 1977; 252: 2891-2899Abstract Full Text PDF PubMed Google Scholar, 17Kasahara M. Penefsky H.S. J. Biol. Chem. 1978; 253: 4180-4187Abstract Full Text PDF PubMed Google Scholar) reported that Pi binding to mitochondrial ATP synthase F1 could be assayed using the centrifuge column procedure with an estimated Kd(Pi) of 30 μm. However Al-Shawi and Senior (8Al-Shawi M.K. Senior A.E. Biochemistry. 1992; 31: 886-891Crossref PubMed Scopus (30) Google Scholar) found that in Escherichia coli F1, no Pi binding was detectable by this procedure. Further work by Weber and colleagues (18Weber J. Wilke-Mounts S. Lee R.S.F. Grell E. Senior A.E. J. Biol. Chem. 1993; 268: 20126-20133Abstract Full Text PDF PubMed Google Scholar, 19Löbau S. Weber J. Senior A.E. J. Biol. Chem. 1998; 37: 10846-10853Google Scholar, 20Weber J. Senior A.E. J. Biol. Chem. 1995; 270: 12653-12658Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar) was carried out to determine whether Pi binding could be assayed in E. coli F1 using competition assays with MgAMPPNP or ATP, but these attempts also proved negative. 7-Chloro-4-nitrobenzo-2-oxa-1,3-diazole (NBD-Cl) 1The abbreviations used are: NBD-Cl, 7-chloro-4-nitrobenzo-2-oxa-1,3-diazole; DTT, dithiothreitol; TES, 2-{[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]amino}ethanesulfonic acid. 1The abbreviations used are: NBD-Cl, 7-chloro-4-nitrobenzo-2-oxa-1,3-diazole; DTT, dithiothreitol; TES, 2-{[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]amino}ethanesulfonic acid. is a potent inhibitor of ATPase activity that covalently reacts at stoichiometry of 1 mol/mol ATP synthase, specifically with residue βTyr-297, 2E. coli residue numbers are used throughout. 2E. coli residue numbers are used throughout. situated at the end of the Pi binding pocket (21Ferguson S.J. Lloyd W.J. Lyons M.H. Radda G.K. Eur. J. Biochem. 1975; 54: 117-126Crossref PubMed Scopus (164) Google Scholar, 22Ferguson S.J. Lloyd W.J. Radda G.K. Eur. J. Biochem. 1975; 54: 127-133Crossref PubMed Scopus (112) Google Scholar, 23Orriss G.L. Leslie A.G.W. Braig K. Walker J.E. Structure (Lond.). 1998; 6: 831-837Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). Following the terminology of Walker, Leslie, and colleagues (23Orriss G.L. Leslie A.G.W. Braig K. Walker J.E. Structure (Lond.). 1998; 6: 831-837Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar), the three catalytic sites are conventionally referred to as βE, βDP, and βTP. NBD-Cl was found to react in the βE (empty) site. Perez et al. (24Perez J.A. Greenfield A.J. Sutton R. Ferguson S.J. FEBS Lett. 1986; 198: 113-118Crossref PubMed Scopus (24) Google Scholar) reported that Pi protects against NBD-Cl inhibition of ATPase activity of ATP synthase in mitochondrial membrane preparations, potentially providing a tool to assay Pi binding in βE catalytic site. From their work, a Kd(Pi) of 0.2 mm was calculated. In recent work we confirmed that this assay was applicable, both with membrane-bound enzyme and with purified F1 from E. coli (11Ahmad Z. Senior A.E. J. Biol. Chem. 2004; 279: 31505-31513Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). Concentration dependence of Pi protection against NBD-Cl inactivation in E. coli enzyme was similar to that found by Perez et al. (24Perez J.A. Greenfield A.J. Sutton R. Ferguson S.J. FEBS Lett. 1986; 198: 113-118Crossref PubMed Scopus (24) Google Scholar) in mitochondrial enzyme. Studies of NBD-Cl inactivation kinetics and of MgADP protection characteristics confirmed that reaction occurred in the βE site in E. coli enzyme (11Ahmad Z. Senior A.E. J. Biol. Chem. 2004; 279: 31505-31513Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). Subsequently using mutagenesis we found this assay to be successful in assessing the functional roles of various catalytic site residues in Pi binding (11Ahmad Z. Senior A.E. J. Biol. Chem. 2004; 279: 31505-31513Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar, 25Ahmad Z. Senior A.E. J. Biol. Chem. 2004; 279: 46057-46064Abstract Full Text Full Text PDF PubMed Scopus (30) Google Scholar, 26Ahmad Z. Senior A.E. FEBS Lett. 2005; 579: 523-528Crossref PubMed Scopus (34) Google Scholar). X-ray crystal structures of catalytic sites containing the Pi analogs AlF3 (27Braig K. Menz R.I. Montgomery M.G. Leslie A.G.W. Walker J.E. Structure (Lond.). 2000; 8: 567-573Abstract Full Text Full Text PDF PubMed Scopus (151) Google Scholar) and SO42− (28Menz R.I. Walker J.E. Leslie A.G.W. Cell. 2001; 106: 331-341Abstract Full Text Full Text PDF PubMed Scopus (395) Google Scholar) were valuable in suggesting residues within the Pi binding pocket that were suitable targets for mutagenesis. Finally it may be noted that Penefsky (29Penefsky H.S. FEBS Lett. 2005; 579: 2250-2252Crossref PubMed Scopus (12) Google Scholar) has recently confirmed, using purified [32P]Pi, that Pi binding to E. coli F1 is not detectable by the centrifuge column procedure but that a pressure ultrafiltration method did detect Pi binding, with a Kd(Pi) in the range of 0.1 mm, consistent with data obtained from the NBD-Cl inactivation assay. It is apparent that Pi dissociates more rapidly from E. coli F1 than it does from mitochondrial F1, unfortunately rendering the convenient centrifuge assay inapplicable with the E. coli enzyme.In proteins, arginine residues show the highest propensity for occurrence and functional interaction at Pi binding sites (30Copley R.R. Barton G.J. J. Mol. Biol. 1994; 242: 321-329PubMed Google Scholar). Our earlier work established that natural Arg residues at positions α-376, β-182, and β-246 were important for Pi binding in the βE catalytic site of ATP synthase, with the latter playing a key role (11Ahmad Z. Senior A.E. J. Biol. Chem. 2004; 279: 31505-31513Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar, 26Ahmad Z. Senior A.E. FEBS Lett. 2005; 579: 523-528Crossref PubMed Scopus (34) Google Scholar). Mutagenesis of βArg-246 to Ala, Gln, or Lys abolished Pi binding (11Ahmad Z. Senior A.E. J. Biol. Chem. 2004; 279: 31505-31513Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). Residue βAsn-243, although totally conserved and located very close to bound Pi, was found to be not directly involved in interacting with Pi. Rather it was found to be necessary for correct organization of the transition state complex (25Ahmad Z. Senior A.E. J. Biol. Chem. 2004; 279: 46057-46064Abstract Full Text Full Text PDF PubMed Scopus (30) Google Scholar). However, if Asp was introduced at this position it prevented Pi binding, presumably because it nullified the positive charge of the neighboring βArg-246 (25Ahmad Z. Senior A.E. J. Biol. Chem. 2004; 279: 46057-46064Abstract Full Text Full Text PDF PubMed Scopus (30) Google Scholar). Therefore balance of charge in the Pi binding pocket also appeared important.After binding, Pi must be condensed with MgADP via a chemical transition state, for which a molecular mechanism has been proposed in (3Senior A.E. Nadanaciva S. Weber J. Biochim. Biophys. Acta. 2002; 1553: 188-211Crossref PubMed Scopus (331) Google Scholar). The transition state analog MgADP- AIF4− trapped in catalytic sites has been visualized by x-ray crystallography (28Menz R.I. Walker J.E. Leslie A.G.W. Cell. 2001; 106: 331-341Abstract Full Text Full Text PDF PubMed Scopus (395) Google Scholar), and it is clear that the fluoroaluminate group occupies the position of phosphate in the transition state complex. Contribution of different residues to stabilization of the transition state complex can be compared by assay of inhibition of ATPase activity by MgADP-fluoroaluminate (or MgADP-fluoroscandium) in mutant and wild-type enzymes (11Ahmad Z. Senior A.E. J. Biol. Chem. 2004; 279: 31505-31513Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar, 25Ahmad Z. Senior A.E. J. Biol. Chem. 2004; 279: 46057-46064Abstract Full Text Full Text PDF PubMed Scopus (30) Google Scholar). By comparing effects on Pi binding and transition state stabilization one can further infer roles of each potential Pi residue at early and later steps of the catalytic pathway.In this paper we modulated charge within the Pi binding site by introduction of extra Arg at residues β-243 and α-291, both in presence of the natural βArg-246 and in its absence (βR246A mutant). We also combined βArg-243 and αArg-291 with the natural βArg-246 to test effects of excess positive charge. Pi binding and transition state stabilization were assessed in each of the new mutants.MATERIALS AND METHODSPreparation of E. coli Membranes; Measurement of Growth Yield in Limiting Glucose Medium; Assay of ATPase Activity of Membranes; Measurement of Proton Pumping in Membrane Vesicles; SDS-gel Electrophoresis; Immnunoblotting—E. coli membranes were prepared as described previously (31Senior A.E. Langman L. Cox G.B. Gibson F. Biochem. J. 1983; 210: 395-403Crossref PubMed Scopus (42) Google Scholar). It should be noted that this procedure involves three washes of the initial membrane pellets, once in buffer containing 50 mm TES, pH 7.0, 15% glycerol, 40 mm 6-aminohexanoic acid, 5 mmp-aminobenzamidine, then twice in buffer containing 5 mm TES, pH 7.0, 15% glycerol, 40 mm 6-aminohexanoic acid, 5 mmp-aminobenzamidine, 0.5 mm DTT, 0.5 mm EDTA. Prior to the experiments, membranes were washed twice more by resuspension and ultracentrifugation in 50 mm Tris/SO4, pH 8.0, 2.5 mm MgSO4. Growth yield in limiting glucose was measured as described previously (32Senior A.E. Latchney L.R. Ferguson A.M. Wise J.G. Arch. Biochem. Biophys. 1984; 228: 49-53Crossref PubMed Scopus (54) Google Scholar). ATPase activity was measured in 1 ml of assay buffer containing 10 mm NaATP, 4 mm MgCl2, 50 mm Tris/SO4, pH 8.5 at 37 °C. Reactions were started by addition of membranes and stopped by addition of SDS to 3.3% final concentration. Pi released was assayed as described previously (33Taussky H.H. Shorr E. J. Biol. Chem. 1953; 202: 675-685Abstract Full Text PDF PubMed Google Scholar). For wild-type membranes (5-10 μg of protein), reaction times were 2-10 min. For mutant membranes (20-100 μg of protein), reaction times were 30-120 min. All reactions were shown to be linear with time and protein concentration. ATP-driven proton pumping was measured by following the quench of acridine orange fluorescence as described previously (34Perlin D.S. Cox D.N. Senior A.E. J. Biol. Chem. 1983; 258: 9793-9800Abstract Full Text PDF PubMed Google Scholar). SDS-gel electrophoresis on 10% acrylamide gels was as described previously (35Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (205936) Google Scholar). Immunoblotting with rabbit polyclonal anti-F1-α and anti-F1-β antibodies was as described previously (36Rao R. Perlin D.S. Senior A.E. Arch. Biochem. Biophys. 1987; 255: 309-315Crossref PubMed Scopus (18) Google Scholar). Densitometry of immunoblots was performed using software from Scion Corp. (Scion Image Release Beta 4.02, www.scioncorp.com/).E. coli Strains—The wild-type strain was pBWU13.4/DK8 (37Ketchum C.J. Al-Shawi M.K. Nakamoto R.K. Biochem. J. 1998; 330: 707-712Crossref PubMed Scopus (75) Google Scholar). Mutant strain βR246A/DK8 was as described previously (11Ahmad Z. Senior A.E. J. Biol. Chem. 2004; 279: 31505-31513Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). New mutant strains were constructed as below.Construction of Mutant Strains of E. coli—Mutagenesis was by the method of Vandeyar et al. (38Vandeyar M. Weiner M. Hutton C. Batt C. Gene (Amst.). 1988; 65: 129-133Crossref PubMed Scopus (226) Google Scholar). For βN243R/βR246A and βN243R mutants, the template for oligonucleotide-directed mutagenesis was M13mp18 containing the HindIII-XbaI fragment from pSN6. pSN6 is a plasmid containing the βY331W mutation from plasmid pSWM4 (18Weber J. Wilke-Mounts S. Lee R.S.F. Grell E. Senior A.E. J. Biol. Chem. 1993; 268: 20126-20133Abstract Full Text PDF PubMed Google Scholar) introduced on a SacI-EagI fragment into pBWU13.4 (37Ketchum C.J. Al-Shawi M.K. Nakamoto R.K. Biochem. J. 1998; 330: 707-712Crossref PubMed Scopus (75) Google Scholar), which expresses all the ATP synthase genes. Mutagenic oligonucleotides were as follows: βN243R/βR246A, GCTGTTCGTTGACCGCATCTATGCATACACCCTGGCCG (where the underlined bases introduce the mutation and a new Nsi1 restriction site); βN243R, GTGTTCGTCGACCGCATCTATCGTTAC (where the underlined bases introduce the mutation and a new SalI restriction site). DNA sequencing was performed to confirm the presence of mutations and absence of undesired changes in sequence, and the mutations were transferred to pSN6 on SacI-EagI fragments, generating the new plasmids pZA8 (βN243R/βR246A/βY331W) and pZA15 (βN243R/βY331W). Each plasmid was transformed into strain DK8 (39Klionsky D.J. Brusilow W.S.A. Simoni R.D. J. Bacteriol. 1984; 160: 1055-1060Crossref PubMed Google Scholar) containing a deletion of ATP synthase genes for expression of the mutant enzymes. For αF291R, αF291R/βR246A, and αF291R/βN243R mutants, the template for oligonucleotide-directed mutagenesis was M13mp18 containing the SphI-SalI fragment from pSN6. The mutagenic oligonucleotide for αF291R was: CGGGCGACGTCCGCTACCTCCACTCTCG (where the underlined bases introduce the mutation and a new Aat2 restriction site). DNA sequencing was performed to confirm the presence of mutations and absence of undesired changes in sequence. The mutation was transferred to pSN6 on a XhoI-PmlI fragemt generating the new plasmid pZA10 (αF291R/βY331W). For new plasmid pZA9 (αF291R/βR246A/βY331W) a XhoI-PmlI fragment was transferred to pZA7 (11Ahmad Z. Senior A.E. J. Biol. Chem. 2004; 279: 31505-31513Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). For new plasmid pZA16 (αF291R/βN243R/βY331W) a SacI-EagI fragment was transferred from plasmid pZA15 to plasmid pZA10. Each plasmid was transformed into strain DK8 (39Klionsky D.J. Brusilow W.S.A. Simoni R.D. J. Bacteriol. 1984; 160: 1055-1060Crossref PubMed Google Scholar) containing a deletion of ATP synthase genes for expression of the mutant enzymes. It may be noted that all of the new mutant strains contained the βY331W mutation, which is valuable for measurement of nucleotide binding parameters (18Weber J. Wilke-Mounts S. Lee R.S.F. Grell E. Senior A.E. J. Biol. Chem. 1993; 268: 20126-20133Abstract Full Text PDF PubMed Google Scholar) and does not affect function significantly. While it was not utilized in this work, the Trp mutation was included for possible future use.Inhibition of ATPase Activity by NBD-Cl and Protection by MgADP or Pi—NBD-Cl was prepared as a stock solution in dimethyl sulfoxide and protected from light. Membranes (0.2-2.0 mg/ml) were reacted with NBD-Cl for 60 min in the dark, at room temperature, in 50 mm Tris/SO4, pH 8.0, 2.5 mm MgSO4, then 50-μl aliquots were transferred to 1 ml of ATPase assay buffer to determine ATPase activity. Where protection from NBD-Cl inhibition by ADP or Pi was determined, membranes were preincubated 60 min with protecting agent at room temperature before addition of NBD-Cl. MgSO4 was present, equimolar with ADP or Pi. Control samples containing the ligand without added NBD-Cl were included. Neither Pi (up to 50 mm) nor MgADP (up to 10 mm) had any inhibitory effect alone. Where reversal of NBD-Cl inhibition by DTT was measured, membranes were first reacted with NBD-Cl (150 μm) for 1 h at room temperature, then DTT (final = 4 mm) was added and incubation continued for 1 h at room temperature before ATPase assay. Control samples without NBD-Cl and/or DTT were incubated for the same times.Inhibition of ATPase Activity by Fluoroaluminate or Fluoroscandium—Membranes were incubated for 60 min at room temperature in 50 mm Tris/SO4, 2.5 mm MgSO4, 1 mm NaADP, and 10 mm NaF at a protein concentration of 0.2-1.0 mg/ml in the presence of AlCl3 or ScCl3 added at varied concentration (see “Results”). 50-μl aliquots were then added to 1 ml of ATPase assay buffer and activity measured as above. It was confirmed in control experiments that no inhibition was seen if MgSO4, NaADP, or NaF was omitted.RESULTSGrowth Properties of New Mutants of E. coli ATP Synthase—A series of mutants was generated to modulate charge in the proximity of residue βArg-246, which was shown earlier to be a key residue for binding of Pi into the catalytic sites on the F1-sector of ATP synthase (11Ahmad Z. Senior A.E. J. Biol. Chem. 2004; 279: 31505-31513Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). Mutation of βArg-246 to Ala abrogates Pi binding (11Ahmad Z. Senior A.E. J. Biol. Chem. 2004; 279: 31505-31513Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). We introduced Arg at two residues located close to βArg-246, namely βAsn-243 and αPhe-291, to generate the new mutants βN243R, βN243R/βR246A, αF291R, and αF291R/βR246A. These mutants are designed to test the effects of introducing one extra Arg close to βArg-246 and to find out whether loss of βArg-246 can be compensated by introduction of another Arg close by. Mutant αF291R/βN243R tests the effect of having Arg at all three locations: αPhe-291, βAsn-243, and the natural βArg-246.Growth yields on limiting glucose medium and growth on succinate plates are shown in Table I. It was evident that introduction of a new Arg residue at α-291 or β-243 was debilitating either in combination with or in absence of the β246A mutation, although it may be noted that the βR246A mutation alone consistently displayed even lower growth. Similar results were seen in αF291R/βN243R. Therefore oxidative phosphorylation is defective in each of the mutants containing Arg at α-291 or β-243 or both.Table IEffects of mutations on cell growthMutationaWild type, pBWU13.4/DK8; null, pUC118/DK8. All mutants were expressed with the βY331W mutation also present, which does not significantly affect growth. Data are means of four to six experiments each.Growth on succinatebGrowth on succinate plates after 3 days estimated by eye. ++++, heavy growth; −, no growth; +, light growth.Growth yield in limiting glucose%Wild-type++++100Null−46βR246A−50βN243R+55βN243R/βR246A+57αF291R+59αF291R/βR246A+57αF291R/βN243R+56a Wild type, pBWU13.4/DK8; null, pUC118/DK8. All mutants were expressed with the βY331W mutation also present, which does not significantly affect growth. Data are means of four to six experiments each.b Growth on succinate plates after 3 days estimated by eye. ++++, heavy growth; −, no growth; +, light growth. Open table in a new tab SDS-gel Electrophoresis and Immunoblotting of Membrane Preparations—Previous work (11Ahmad Z. Senior A.E. J. Biol. Chem. 2004; 279: 31505-31513Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar) had established that Pi binding by mutant and wild-type ATP synthase can be assayed using either membrane preparations or purified F1. For a series of mutants, as studied here, it was more efficient to use membrane preparations. However, the possibility existed that the mutations may have compromised assembly and/or oligomeric stability, leading to membrane preparations with low ATP synthase content. This could account for the low growth yields in Table I. We therefore performed SDS-gel electrophoresis and immunoblotting experiments.Coomassie Blue-stained SDS-gels of mutant and wild-type membranes (with purified wild-type F1 as reference) established that all the mutant membrane preparations had bands running at the position of F1-α and F1-β subunits, with similar intensities to the α and β bands seen in wild-type membranes (data not shown). Immunoblotting and densitometry was performed with anti-α subunit and anti-β subunit antibodies (36Rao R. Perlin D.S. Senior A.E. Arch. Biochem. Biophys. 1987; 255: 309-315Crossref PubMed Scopus (18) Google Scholar). Preliminary experiments using purified wild-type F1 revealed that the response was linear in the range 0.1-0.4 μg of protein, and further tests showed that 4 μg of wild-type or mutant membrane preparations gave a response that fell within this range. An immunoblot using anti-F1-α subunit is shown in Fig. 1A. Purified F1 (0.1-0.4 μg) is run in lanes 1-3 for reference. Membranes (4 μg) from null mutant strains DK8 and pUC118/DK8 are run in lanes 4 and 5, respectively, and show no α subunit, as expected. Lane 6 shows wild-type membranes, and lanes 7-12 show the mutant membranes. A densitometric scan of each lane is presented in Fig. 1B, using the same numbering system. Wild-type membranes (lane 6) are set arbitrarily at 100 (area under the curve), and the density in other membrane preparations (null, lanes 4 and 5; mutants, lanes 7-12) are presented relative to wild type. Three different experiments gave similar results. It is evident that the mutant membranes were similar in ATP synthase content to wild type. Immunoblotting using anti-F1-β antibody (data not shown) confirmed this conclusion.ATPase Activity and Proton Pumping Activities of Mutant ATP Synthase Enzymes in Membranes—Table II shows the ATPase and proton pumping activities of the mutant ATP synthase enzymes in membranes compared with wild type and with two different null controls. It may be noted that the membrane preparations were washed extensively before assay. Data from the null controls showed that this removed virtually all contaminating ATPase activity. The following conclusions are evident. First, insertion of one or two new Arg residues close to the Pi binding site (αF291R, βN243R, αF291R/βN243R) in otherwise wild-type background (i.e. with βArg-246) reduced membrane ATPase activity to a very low level. ATPase activities were far too low to support ATP-driven proton pumping. Second, insertion of βArg-243 in presence of βAla-246 (βN243R/βR246A) did not restore ATPase activity. Third, insertion of αArg-291 in presence of βAla-246 (αF291R/βR246A) did significantly restore ATPase activity (by 10-fold over βR246A alone), and in this case there was detectable, although low, ATP-driven proton pumping. It is apparent that the effects seen on ATPase and proton pumping are consistent with growth characteristics described in Table I; in the case of αF291R/βR246A the partial “rescue” of βR246A was apparently not substantial enough to translate into significant growth.Table IIATPase activity and proton pumping in mutant membranesMutationATPase activityaMeasured at 37 °C" @default.
• W2080215841 created "2016-06-24" @default.
• W2080215841 creator A5051122218 @default.
• W2080215841 creator A5060832624 @default.
• W2080215841 date "2005-07-01" @default.
• W2080215841 modified "2023-10-06" @default.
• W2080215841 title "Modulation of Charge in the Phosphate Binding Site of Escherichia coli ATP Synthase" @default.
• W2080215841 cites W1548097551 @default.
• W2080215841 cites W1562012269 @default.
• W2080215841 cites W1570910952 @default.
• W2080215841 cites W1604233325 @default.
• W2080215841 cites W1665555949 @default.
• W2080215841 cites W1795789692 @default.
• W2080215841 cites W1917221235 @default.
• W2080215841 cites W1964414141 @default.
• W2080215841 cites W1969381663 @default.
• W2080215841 cites W1980762570 @default.
• W2080215841 cites W1983983979 @default.
• W2080215841 cites W1987405238 @default.
• W2080215841 cites W1989750376 @default.
• W2080215841 cites W1993748366 @default.
• W2080215841 cites W2004748034 @default.
• W2080215841 cites W2024470778 @default.
• W2080215841 cites W2039461309 @default.
• W2080215841 cites W2042805323 @default.
• W2080215841 cites W2043196840 @default.
• W2080215841 cites W2043573823 @default.
• W2080215841 cites W2043808245 @default.
• W2080215841 cites W2044204709 @default.
• W2080215841 cites W2047445903 @default.
• W2080215841 cites W2053978613 @default.
• W2080215841 cites W2059240567 @default.
• W2080215841 cites W2095644929 @default.
• W2080215841 cites W2100257868 @default.
• W2080215841 cites W2100837269 @default.
• W2080215841 cites W2141944392 @default.
• W2080215841 cites W2143913664 @default.
• W2080215841 cites W2154229015 @default.
• W2080215841 cites W2154481111 @default.
• W2080215841 cites W2156435290 @default.
• W2080215841 cites W2171800663 @default.
• W2080215841 cites W282699287 @default.
• W2080215841 cites W2977999477 @default.
• W2080215841 cites W60130626 @default.
• W2080215841 doi "https://doi.org/10.1074/jbc.m503955200" @default.
• W2080215841 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15939739" @default.
• W2080215841 hasPublicationYear "2005" @default.
• W2080215841 type Work @default.
• W2080215841 sameAs 2080215841 @default.
• W2080215841 citedByCount "33" @default.
• W2080215841 countsByYear W20802158412012 @default.
• W2080215841 countsByYear W20802158412013 @default.
• W2080215841 countsByYear W20802158412014 @default.
• W2080215841 countsByYear W20802158412015 @default.
• W2080215841 countsByYear W20802158412016 @default.
• W2080215841 countsByYear W20802158412018 @default.
• W2080215841 countsByYear W20802158412019 @default.
• W2080215841 countsByYear W20802158412020 @default.
• W2080215841 countsByYear W20802158412022 @default.
• W2080215841 countsByYear W20802158412023 @default.
• W2080215841 crossrefType "journal-article" @default.
• W2080215841 hasAuthorship W2080215841A5051122218 @default.
• W2080215841 hasAuthorship W2080215841A5060832624 @default.
• W2080215841 hasBestOaLocation W20802158411 @default.
• W2080215841 hasConcept C104317684 @default.
• W2080215841 hasConcept C112243037 @default.
• W2080215841 hasConcept C181199279 @default.
• W2080215841 hasConcept C185592680 @default.
• W2080215841 hasConcept C547475151 @default.
• W2080215841 hasConcept C55493867 @default.
• W2080215841 hasConceptScore W2080215841C104317684 @default.
• W2080215841 hasConceptScore W2080215841C112243037 @default.
• W2080215841 hasConceptScore W2080215841C181199279 @default.
• W2080215841 hasConceptScore W2080215841C185592680 @default.
• W2080215841 hasConceptScore W2080215841C547475151 @default.
• W2080215841 hasConceptScore W2080215841C55493867 @default.
• W2080215841 hasIssue "30" @default.
• W2080215841 hasLocation W20802158411 @default.
• W2080215841 hasOpenAccess W2080215841 @default.
• W2080215841 hasPrimaryLocation W20802158411 @default.
• W2080215841 hasRelatedWork W1465188717 @default.
• W2080215841 hasRelatedWork W1807050487 @default.
• W2080215841 hasRelatedWork W1981082693 @default.
• W2080215841 hasRelatedWork W1995986374 @default.
• W2080215841 hasRelatedWork W2008404748 @default.
• W2080215841 hasRelatedWork W2028145638 @default.
• W2080215841 hasRelatedWork W2038624513 @default.
• W2080215841 hasRelatedWork W2110293199 @default.
• W2080215841 hasRelatedWork W2147433402 @default.
• W2080215841 hasRelatedWork W3207028980 @default.
• W2080215841 hasVolume "280" @default.
• W2080215841 isParatext "false" @default.
• W2080215841 isRetracted "false" @default.
• W2080215841 magId "2080215841" @default.
• W2080215841 workType "article" @default.