FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2080301850> ?p ?o ?g. }

• W2080301850 endingPage "37101" @default.
• W2080301850 startingPage "37093" @default.
• W2080301850 abstract "V(D)J recombination is instigated by the recombination-activating proteins RAG1 and RAG2, which catalyze site-specific DNA cleavage at the border of the recombination signal sequence (RSS). Although both proteins are required for activity, core RAG1 (the catalytically active region containing residues 384–1008 of 1040) alone displays binding specificity for the conserved heptamer and nonamer sequences of the RSS. The nonamer-binding region lies near the N terminus of core RAG1, whereas the heptamer-binding region has not been identified. Here, potential domains within core RAG1 were identified using limited proteolysis studies. An iterative procedure of DNA cloning, protein expression, and characterization revealed the presence of two topologically independent domains within core RAG1, referred to as the central domain (residues 528–760) and the C-terminal domain (residues 761–980). The domains do not include the nonamer-binding region but rather largely span the remaining relatively uncharacterized region of core RAG1. Characterization of macromolecular interactions revealed that the central domain bound to the RSS with specificity for the heptamer and contained the predominant binding site for RAG2. The C-terminal domain bound DNA cooperatively but did not show specificity for either conserved RSS element. This domain was also found to self-associate, implicating it as a dimerization domain within RAG1. V(D)J recombination is instigated by the recombination-activating proteins RAG1 and RAG2, which catalyze site-specific DNA cleavage at the border of the recombination signal sequence (RSS). Although both proteins are required for activity, core RAG1 (the catalytically active region containing residues 384–1008 of 1040) alone displays binding specificity for the conserved heptamer and nonamer sequences of the RSS. The nonamer-binding region lies near the N terminus of core RAG1, whereas the heptamer-binding region has not been identified. Here, potential domains within core RAG1 were identified using limited proteolysis studies. An iterative procedure of DNA cloning, protein expression, and characterization revealed the presence of two topologically independent domains within core RAG1, referred to as the central domain (residues 528–760) and the C-terminal domain (residues 761–980). The domains do not include the nonamer-binding region but rather largely span the remaining relatively uncharacterized region of core RAG1. Characterization of macromolecular interactions revealed that the central domain bound to the RSS with specificity for the heptamer and contained the predominant binding site for RAG2. The C-terminal domain bound DNA cooperatively but did not show specificity for either conserved RSS element. This domain was also found to self-associate, implicating it as a dimerization domain within RAG1. recombination signal sequence RSS containing a 12- or 23-base pair spacer, respectively maltose-binding protein polyacrylamide gel electrophoresis glutathioneS-transferase matrix-assisted laser desorption ionization-time-of-flight wild type mutant heptamer The immune system displays remarkable specificity and diversity in its ability to recognize and eliminate foreign antigens. The basis for this immense diversity in many species is a complex rearrangement of the V (variable), D (diversity), and J (joining) gene segments that together encode the variable regions of T cell receptors and immunoglobulins (see Ref. 1Fugmann S.D. Lee A.I. Shockett P.E. Villey I.J. Schatz D.G. Annu. Rev. Immunol. 2000; 18: 495-527Crossref PubMed Scopus (496) Google Scholar for review). This process, known as V(D)J recombination, requires the activity of a wide array of enzymes and is initiated by the lymphoid-specific recombination-activating proteins RAG1 and RAG2. The RAG proteins guide recombination events to conserved recombination signal sequences (RSSs)1 that flank the genomic regions to be rearranged. Each RSS consists of a conserved heptamer and nonamer sequence separated by a 12- or 23-base pair spacer, the sequence of which is poorly conserved. Efficient recombination occurs generally between an RSS containing a 12-base pair spacer (12RSS) and one containing a 23-base pair spacer (23RSS), a requirement referred to as the 12/23 rule. The recombination process is often divided into two phases, the first phase of which consists of two distinct enzymatic steps catalyzed by the RAG proteins. The first step involves the binding of a RAG1-RAG2 complex to an RSS and the subsequent generation of a nick between the heptamer and its adjacent coding strand. The resulting 3′-OH group then performs a nucleophilic attack on the phosphodiester bond of the opposite strand. The primary products of this transesterification reaction are a covalently sealed hairpin, referred to as the coding end, and a blunt-ended 5′ phosphorylated RSS, referred to as the signal end (2McBlane J.F. van Gent D.C. Ramsden D.A. Romeo C. Cuomo C.A. Gellert M. Oettinger M.A. Cell. 1995; 83: 387-395Abstract Full Text PDF PubMed Scopus (583) Google Scholar, 3van Gent D.C. Mizuuchi K. Gellert M. Science. 1996; 271: 1592-1594Crossref PubMed Scopus (240) Google Scholar). In the physiological reaction, coupled cleavage likely occurs on a 12- and 23RSS held in a precleavage complex by the RAG proteins. The hairpin formation step, in particular, seems to be highly restricted to the synaptic complex (4Eastman Q.M. Schatz D.G. Nucleic Acids Res. 1997; 25: 4370-4378Crossref PubMed Scopus (34) Google Scholar, 5West R.B. Lieber M.R. Mol. Cell. Biol. 1998; 18: 6408-6415Crossref PubMed Scopus (64) Google Scholar, 6Yu K. Lieber M.R. Mol. Cell. Biol. 2000; 20: 7914-7921Crossref PubMed Scopus (58) Google Scholar). The second phase of the reaction is governed by an array of enzymes that catalyze the opening and processing of the coding-end hairpins (1Fugmann S.D. Lee A.I. Shockett P.E. Villey I.J. Schatz D.G. Annu. Rev. Immunol. 2000; 18: 495-527Crossref PubMed Scopus (496) Google Scholar). Processed coding ends are then joined, most likely by DNA ligase IV with XRCC4, resulting in the ligation of two formerly distant regions of the genome (7Grawunder U. Zimmer D. Fugmann S. Schwarz K. Lieber M.R. Mol. Cell. 1998; 2: 477-484Abstract Full Text Full Text PDF PubMed Scopus (280) Google Scholar, 8Grawunder U. Zimmer D. Kulesza P. Lieber M.R. J. Biol. Chem. 1998; 273: 24708-24714Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar). The signal ends are also joined to form a precise heptamer/heptamer junction. Less is understood about the precise role played by the RAG proteins in the second phase of V(D)J recombination. Studies have shown that the RAG proteins remain bound to the signal and coding ends in a post-cleavage complex, possibly to stabilize and direct the appropriate joining of cleaved ends (9Agrawal A. Schatz D.G. Cell. 1997; 89: 43-53Abstract Full Text Full Text PDF PubMed Scopus (251) Google Scholar, 10Hiom K. Gellert M. Mol. Cell. 1998; 1: 1011-1019Abstract Full Text Full Text PDF PubMed Scopus (205) Google Scholar). In in vitro studies, the RAG proteins have also been shown to open hairpins (11Besmer E. Mansilla-Soto J. Cassard S. Sawchuk D.J. Brown G. Sadofsky M. Lewis S.M. Nussenzweig M.C. Cortes P. Mol. Cell. 1998; 2: 817-828Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar, 12Shockett P.E. Schatz D.G. Mol. Cell. Biol. 1999; 19: 4159-4166Crossref PubMed Google Scholar) and remove 3′ overhangs (13Santagata S. Besmer E. Villa A. Bozzi F. Allingham J.S. Sobacchi C. Haniford D.B. Vezzoni P. Nussenzweig M.C. Pan Z.-Q. Cortes P. Mol. Cell. 1999; 4: 935-947Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar), but the contributions of these catalytic activities to V(D)J recombination in vivo have not been established. Proteins that function in double-strand DNA-break repair through the nonhomologous end-joining pathway (e.g. Ku70, Ku80, DNA-dependent protein kinase catalytic subunit, and the recently identified protein Artemis (14Moshous D. Callebaut I. de Chasseval R. Corneo B. Cavazzana-Calvo M. Le Deist F. Tezcan I. Sanal O. Bertrand Y. Philippe N. Fischer A. de Villartay J.-P. Cell. 2001; 105: 177-186Abstract Full Text Full Text PDF PubMed Scopus (702) Google Scholar)) are also essential for the processing and joining reactions (reviewed in Ref. 15Grawunder U. Harfst E. Curr. Opin. Immunol. 2001; 13: 186-194Crossref PubMed Scopus (48) Google Scholar). Although the first phase of V(D)J recombination has been well defined mechanistically, many questions remain concerning the RAG proteins and the nature of the protein-protein and protein-DNA complexes responsible for the DNA cleavage reaction. The investigation of these proteins was facilitated by the identification of the catalytically active regions of the RAG proteins, termed the core regions, which include residues 384–1008 (of 1040 total residues) in murine RAG1 and residues 1–387 (of 527 total residues) in murine RAG2 (1Fugmann S.D. Lee A.I. Shockett P.E. Villey I.J. Schatz D.G. Annu. Rev. Immunol. 2000; 18: 495-527Crossref PubMed Scopus (496) Google Scholar). These core regions, capable of achieving effective recombination when expressed together, are more soluble than their parent full-length proteins and therefore have been the focal points for the majority of subsequent research. A multisubunit complex consisting of both RAG1 and RAG2 is required for cleavage of the RSS to yield first nicks and then hairpinned coding ends. Recognition and binding to the RSS seems to be largely mediated by RAG1. For instance, the RSS nonamer-binding site is localized to the N terminus of core RAG1 (residues 384–460) (16Spanopoulou E. Zaitseva F. Wang F.-H. Santagata S. Baltimore D. Panayotou G. Cell. 1996; 87: 263-276Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar, 17Difilippantonio M.J. McMahan C.J. Eastman Q.M. Spanopoulou E. Schatz D.G. Cell. 1996; 87: 253-262Abstract Full Text Full Text PDF PubMed Scopus (175) Google Scholar). In addition, protein-DNA crosslinking studies showed that core RAG1 formed specific contacts with the RSS heptamer in the presence of RAG2 (18Swanson P.C. Desiderio S. Immunity. 1998; 9: 115-125Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar, 19Eastman Q.M. Villey I.J. Schatz D.G. Mol. Cell. Biol. 1999; 19: 3788-3797Crossref PubMed Scopus (70) Google Scholar, 20Mo X. Bailin T. Sadofsky M.J. J. Biol. Chem. 1999; 274: 7025-7031Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). Furthermore, electrophoretic mobility shift assays have demonstrated that core RAG1 bound to an isolated RSS in the absence of RAG2 and that this binding was specific for both the heptamer and the nonamer (21Rodgers K.K. Villey I.J. Ptaszek L. Corbett E. Schatz D.G. Coleman J.E. Nucleic Acids Res. 1999; 27: 2938-2946Crossref PubMed Scopus (60) Google Scholar,22Aidinis V. Bonaldi T. Beltrame M. Santagata S. Bianchi M.E. Spanopoulou E. Mol. Cell. Biol. 1999; 19: 6532-6542Crossref PubMed Scopus (110) Google Scholar). Although the region of RAG1 responsible for RSS nonamer recognition has been identified and shown to be homologous to the DNA-binding domain of Hin recombinase (16Spanopoulou E. Zaitseva F. Wang F.-H. Santagata S. Baltimore D. Panayotou G. Cell. 1996; 87: 263-276Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar), the region of core RAG1 responsible for heptamer recognition has not yet been identified. In addition to its ability to recognize an isolated RSS, RAG1 has been shown recently to possess a triad of acidic residues (Asp-600, Asp-708, and Glu-962, known as the DDE motif) that are essential for the endonucleolytic activities catalyzed by the RAG proteins (23Kim D.R. Dai Y. Mundy C.L. Yang W. Oettinger M.A. Genes Dev. 1999; 13: 3070-3080Crossref PubMed Scopus (169) Google Scholar, 24Fugmann S.D. Villey I.J. Ptaszek L.M. Schatz D.G. Mol. Cell. 2000; 5: 97-107Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar, 25Landree M.A. Wibbenmeyer J.A. Roth D.B. Genes Dev. 1999; 13: 3059-3069Crossref PubMed Scopus (171) Google Scholar). These residues are believed to coordinate 1–2 divalent metal cations, as is characteristic of other enzymes containing the DDE motif (26Rice P.A. Baker T.A. Nat. Struct. Biol. 2001; 8: 302-307Crossref Scopus (170) Google Scholar). Interaction between RAG1 and RAG2 has been shown to occur in the absence of DNA, suggesting that the two proteins bind to the RSS as a preformed complex (27Santagata S. Aidinis V. Spanopoulou E. J. Biol. Chem. 1998; 273: 16325-16331Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar). Thus, regions within core RAG1 mediate protein-protein and protein-DNA interactions that are essential for the V(D)J recombination reaction. We propose that individual domains in the core region contribute each RAG1 binding activity and that these domains, as isolated modules, may retain their ability to form macromolecular interactions. To determine this possibility, we used limited proteolysis studies to identify and then characterize structural, or topologically independent, domains within core RAG1. The results from this study demonstrate that core RAG1 consists of multiple domains, each of which functions individually in one or more of the essential macromolecular interactions formed by the intact core protein. Fragments of the murineRAG1 gene were amplified by polymerase chain reaction using primers that introduced a BamHI site at the 5′ end of the product and two stop codons and a SalI site at the 3′ end of the product. A gene encoding for an MBP fusion protein was created by inserting the appropriate RAG1 fragment into theBamHI and SalI sites of the multiple cloning site of pMAL-c2 (New England Biolabs). Fusion proteins of residues 714–1008, 528–1008, 528–760, 761–1008, and 761–980 to MBP were encoded by plasmids pRS1, pRS2, pRS3, pRS4, and pJLA1, respectively. The fusion proteins listed above as well as MBP fused to core RAG1 were expressed inEscherichia coli and released by sonication as described previously (21Rodgers K.K. Villey I.J. Ptaszek L. Corbett E. Schatz D.G. Coleman J.E. Nucleic Acids Res. 1999; 27: 2938-2946Crossref PubMed Scopus (60) Google Scholar). The proteins were bound to an amylose column in purification buffer (20 mm Tris-HCl, pH 8.0, 50 μm ZnCl2, 10% glycerol, and 5 mmβ-mercaptoethanol) plus 500 mm NaCl, the column was washed with purification buffer plus 1.5 m NaCl, and the fusion proteins were eluted from the column in purification buffer plus 500 mm NaCl and 10 mm maltose. In some applications, the proteins were purified further through a Q-Sepharose fast flow column, eluting with a NaCl gradient of 0.1–0.6m in purification buffer. In the last purification step the fusion proteins were chromatographed through a Superdex 200 gel filtration column (Amersham Pharmacia Biotech) using purification buffer plus 500 mm NaCl. Fractions containing the fusion protein were pooled, concentrated, and stored either at −80 °C or in 50% glycerol at −20 °C. Each protein was judged to be >95% pure by Coomassie Blue staining of SDS-PAGE gels. GST-core RAG2, expressed by transfection in 293T cells, was purified as described previously (16Spanopoulou E. Zaitseva F. Wang F.-H. Santagata S. Baltimore D. Panayotou G. Cell. 1996; 87: 263-276Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar). A 5–10-μg sample of purified MBP-core RAG1 was incubated with increasing concentrations of porcine pancreatic trypsin (Sigma) ranging from 0.05 to 1.00 μg at 4 °C for 2 h in 10 mm Tris, pH 8.0, 250 mm NaCl, 50% glycerol, 25 μmZnCl2, and 2.5 mm β-mercaptoethanol. The reactions then were resolved on a 12% polyacrylamide gel by SDS-PAGE, transferred to a polyvinylidene difluoride membrane (Immobilon-P, Millipore Corp.), and analyzed by N-terminal sequencing at the University of Oklahoma Health Sciences Center Molecular Biology Resource Facility. The lengths of the degradation products (generated during the purification of MBP fusion proteins with RAG1 fragments 500–1008 and 760–1008) were determined by MALDI-TOF mass spectrometry. Each purified fusion protein was dialyzed into 20 mm Tris-HCl, pH 8.0, 50 mm NaCl, 5 mm β-mercaptoethanol, and 10 μmZnCl2 and analyzed at the National Science Foundation Experimental Program to Stimulate Competitive Research Oklahoma Laser Mass Spectrometry facility. The fusion proteins were combined with sinapinic acid, spotted onto a grid, and analyzed by the Voyager Elite MALDI-TOF mass spectrometer (Applied Biosystems, Framingham, MA). Glutathione-Sepharose 4B resin (Amersham Pharmacia Biotech) was blocked with 1 mg/ml bovine serum albumin in interaction buffer (20 mm Tris-HCl, pH 8.0, 0.2 m NaCl, 10% glycerol, 10 μmZnCl2, and 5 mm β-mercaptoethanol) for 30 min at 4 °C. The resin was washed three times with interaction buffer, and 200 ng of the appropriate MBP fusion plus 200 ng of GST-core RAG2 or GST in interaction buffer were added to the resin. The samples were incubated on the resin for 30 min at 4 °C. After three interaction buffer washes with interaction buffer, the bound protein was eluted from the resin with SDS loading buffer. The proteins were then resolved by SDS-PAGE (10% polyacrylamide gel) and electrotransferred to a polyvinylidene difluoride membrane. Two gels were run in parallel to enable Western analysis of both MBP and GST proteins. After transfer, the membrane was blocked for 2 h in 1% (w/v) bovine serum albumin in TTBS (10 mm Tris-HCl, pH 7.5, 150 mm NaCl, and 0.1% Tween 20). Next, the membranes were incubated with the respective primary antibody for 1 h (MBP, rabbit polyclonal anti-MBP, Santa Cruz Biotechnology; GST, mouse monoclonal anti-GST, Berkeley Antibody Co.) followed by a biotinylated secondary antibody for 1 h and avidin-conjugated horseradish peroxidase for 45 min. Detection was done using enhanced chemiluminescence (ECL, Amersham Pharmacia Biotech) by exposure to Kodak X-OMAT film. The various 12RSS substrates used were prepared by annealing complementary oligonucleotides. The sequence of the top strand of the WT12RSS is d(GATATGGCTCGTCTTACACAGTGATATAGACCTTAACAAAAACCTCCAATCGAGCGGAG). The MH12RSS oligonucleotide sequence is identical to that of the WT12RSS except that the heptamer sequence (CACAGTG) has been replaced by the sequence GAGAAGC. Similarly, the mutated nonamer 12RSS contains the sequence AGGCTCTGA in place of the WT nonamer sequence (ACAAAAACC). Substrates were labeled with [γ-32P]ATP, where indicated, using T4 polynucleotide kinase. Fusion proteins of each core RAG1 domain with MBP were incubated with32P-labeled WT12RSS and resolved on a 6% nondenaturing polyacrylamide gel as described (21Rodgers K.K. Villey I.J. Ptaszek L. Corbett E. Schatz D.G. Coleman J.E. Nucleic Acids Res. 1999; 27: 2938-2946Crossref PubMed Scopus (60) Google Scholar). The binding buffer contained 10 mm Tris, pH 8.0, 5 mm MgCl2, 2 mm dithiothreitol, 6% glycerol, and 100 mmNaCl. Each reaction contained 0.5 μm of a 24-base single-stranded nonspecific competitor, d(TACGATGAAGGATCCGTCCGGGAA). Protein-DNA specificity assays, also referred to here as competition assays, were performed in the same binding buffer described above. The two domains were added to reactions containing 1 nm 32P-labeled WT12RSS and 0–50 nm of the indicated unlabeled competitor. Each reaction contains either 1.0 μm central domain or 0.5 μm C-terminal domain, as indicated. The bands on the autoradiograms from different exposures were quantitated using a Molecular Dynamics SI densitometer and ImageQuaNT software. To identify domain boundaries within core RAG1, a fusion protein between MBP and core RAG1 (MBP-core RAG1) was digested with increasing concentrations of trypsin under limiting conditions (Fig. 1A). By limiting the reaction conditions the initial cleavage events occur primarily at the more accessible regions of the protein. The initial products generated by tryptic cleavage are core RAG1 and MBP, consistent with the presence of the long flexible linker (including 10 consecutive asparagine residues) connecting the two tethered proteins. ProductsA–D are the result of further digestion of core RAG1, because this band is diminished with increasing amounts of trypsin, whereas the intensity of the MBP band remains relatively constant. N-terminal sequencing of these products indicated that cleavage had occurred primarily C-terminal to residues Arg-529, Arg-713, and Lys-777 (Fig. 1B). (All RAG1 residue numbers referred to in this study are from the full-length murine RAG1 sequence.) The molecular mass (and length) of each product was estimated by comparison of molecular mass standards with SDS-PAGE. With this combined information, the order of progression of the digestion of core RAG1 can be inferred from Fig. 1A. For instance, productsA and B are formed readily at lower concentrations of trypsin. Product A appears to become further proteolyzed to product D, whereas productB does not appear to significantly degrade further with increasing concentrations of trypsin. Finally, product Conly appears at the highest concentrations of trypsin, apparently as intact core RAG1 is further proteolyzed. Limited proteolysis of MBP-core RAG1 was also performed with thermolysin, yielding similar results to those shown in Fig. 1 (data not shown). This confirms that cleavage at the basic residues listed above is caused by increased accessibility in those regions of the protein and not strictly by enzyme specificity. It is important to note that the tryptic fragments generated above may or may not represent topologically independent domains. Although the limited proteolytic reaction would restrict cleavage to the most accessible regions of the protein, the protease may also cleave at exposed loops in the protein that do not represent domain boundaries. To establish valid domain boundaries within core RAG1, we performed the following iterative procedure. First, regions of the core RAG1 gene were cloned based on the tryptic cleavage results. Second, the corresponding regions of the core RAG1 protein were expressed and purified as outlined under “Experimental Procedures.” Finally, whether the purified fragments of RAG1 represented structural and functional domains of the intact core protein was assessed. For clarity here, structural and functional domains represent regions that fold autonomously and perform functions similar to those characterized previously for the intact core RAG1 protein. The assignment of structural, or topologically independent, domains was based on the ability of the protein fragments to form discrete species (monomeric or dimeric) as determined by size-exclusion chromatography. The benchmark for assessing whether the protein regions represented functional domains of core RAG1 was based on the ability of the protein fragments to achieve one or more of the macromolecular interactions attributed to RAG1 in the V(D)J recombination reaction. As outlined in detail below, the purification of core RAG1 fragments fused to MBP twice resulted in proteolysis from endogenous E. coliproteases, which appeared to occur during cell lysis (data not shown). This proved to be advantageous in both instances, because the resulting products had an increased ability to form distinct monomeric or dimeric species (see following text). Although cleavage at the N terminus of each of the fusion proteins was possible in these cases, such cleavage would have removed significant portions of the MBP required to bind substrate (and the amylose column), because an N-terminal loop including residues 1–20 contains important contacts to the substrate in the binding pocket (28Spurlino J.C. Lu G.Y. Quiocho F.A. J. Biol. Chem. 1991; 266: 5202-5219Abstract Full Text PDF PubMed Google Scholar). Had cleavage occurred at the N terminus of the fusion protein, the cleaved protein would not have been recovered from the purification protocol used in these studies. The degradation products were identified as described in the following section, and the procedure outlined above was repeated. Based on the identified tryptic cleavage sites, two fragments of RAG1 (residues 528–1008 and 714–1008) were cloned as fusions to MBP. Purification of the MBP fusion with RAG1 residues 528–1008 (N528a) resulted in a degradation product that was topologically independent based on its elution from size-exclusion chromatography as a distinct single species. In contrast, the full-length protein (N528a) eluted entirely in the void volume indicative of misfolded and/or nonspecifically aggregated protein, perhaps resulting from solvent-exposed hydrophobic regions that are typically buried in the intact core protein. Analysis by MALDI-TOF mass spectrometry indicated that the degradation product was ∼250 residues smaller than N528a (Fig. 2A), corresponding to truncation of the fusion protein at RAG1 residue 760. A fusion protein of MBP with RAG1 residues 528–760 (N528b) was then produced and, based on its ability to form a discrete species, appears to exist as a topologically independent domain. With the identification of a structural domain that spans residues 528–760, we subsequently cloned the region encoding residues 761–1008 into the pMAL-c2 plasmid. In purifying the fusion protein of MBP to RAG1 residues 761–1008 (N761a) the full-length fusion protein was mostly misfolded and aggregated. However, as seen in the purification of N528a, proteolysis had occurred at the C terminus of the fusion protein, producing cleavage products that formed autonomously folded modules based on size-exclusion chromatography. MALDI-TOF mass spectrometry of these products (Fig. 2B) indicated that cleavage had occurred at the residues indicated. To be conservative in the establishment of our domain boundary, we chose the largest of the products to further characterize. Purification of a fusion protein of residues 761–980 (N761b) resulted in a proteolytically resistant, topologically independent domain capable of forming distinct monomeric and dimeric species (see the following text and Fig. 3). The fragment consisting of RAG1 residues 714–1008 was cloned as a fusion to MBP, purified, and characterized as outlined above. The fusion protein was entirely aggregated with the formation of no obvious degradation products. Although these observations do not preclude Arg-713 as a valid domain boundary, we chose not to pursue this site as an N-terminal domain boundary. Although tryptic cleavage at residue 530 suggested the presence of an N-terminal domain between residues 384 and 529 of RAG1, no protease-resistant fragments in this region of the core remained after limited tryptic digestion. As a result, we were unable to establish the boundaries of an N-terminal domain. The N-terminal region of the core contains a putative helix-loop-helix motif that has been shown to form specific interactions with the RSS nonamer (16Spanopoulou E. Zaitseva F. Wang F.-H. Santagata S. Baltimore D. Panayotou G. Cell. 1996; 87: 263-276Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar, 17Difilippantonio M.J. McMahan C.J. Eastman Q.M. Spanopoulou E. Schatz D.G. Cell. 1996; 87: 253-262Abstract Full Text Full Text PDF PubMed Scopus (175) Google Scholar). It is possible that in the absence of DNA this region may be relatively unstructured and thus more susceptible to tryptic cleavage. Nevertheless, an isolated fragment of core RAG1 containing the nonamer-binding region has been shown previously to bind specifically to the RSS nonamer (16Spanopoulou E. Zaitseva F. Wang F.-H. Santagata S. Baltimore D. Panayotou G. Cell. 1996; 87: 263-276Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar), indicating that an N-terminal domain does exist in core RAG1, although its boundaries are not yet well defined. However, because the function of this region of core RAG1 has been characterized fairly well, we chose to focus our studies on N528b and N761b, hereafter referred to as the central and C-terminal domains, respectively (Fig. 2C). It should be noted that these two domains correspond fairly well with the trypsin-generated fragments B and C in Fig.1. In our domain model the central domain contains a zinc finger motif, referred to as ZFB, as well as the two aspartate catalytic active site residues (Asp-600 and Asp-708) of the DDE triad. The third active site residue (Glu-962) is located in the C-terminal domain. This domain model is supported further by the ability of each domain to form macromolecular complexes essential to V(D)J recombination (see the following figures). In the experiments performed in these studies, both domains were expressed as fusion proteins to MBP. It was shown previously that MBP-core RAG1 is predominantly dimeric in solution (21Rodgers K.K. Villey I.J. Ptaszek L. Corbett E. Schatz D.G. Coleman J.E. Nucleic Acids Res. 1999; 27: 2938-2946Crossref PubMed Scopus (60) Google Scholar). To assess the self-association properties of the individual core RAG1 domains, each purified domain (fused to MBP) was analyzed using size-exclusion chromatography (Fig. 3). By comparing the elution profiles of each independent domain to those of known molecular mass standards, the molecular mass of each eluted species was determined. The elution profile of the central domain resulted in one major peak. The molecular mass of this eluted species indicated that this domain persists predominantly as a monomer (Fig. 3A). In contrast, the elution profile of the C-terminal domain indicated the presence of two distinct species (Fig. 3B). When compared with the elution profiles of known standards, it is clear that the first of the two peaks represents a dimer, and the second represents a monomer. The C-terminal domain therefore represents a dimerization domain that most likely contributes to the self-association properties of core" @default.
• W2080301850 created "2016-06-24" @default.
• W2080301850 creator A5047602445 @default.
• W2080301850 creator A5049239487 @default.
• W2080301850 creator A5069509011 @default.
• W2080301850 creator A5075844486 @default.
• W2080301850 creator A5080114704 @default.
• W2080301850 date "2001-10-01" @default.
• W2080301850 modified "2023-10-13" @default.
• W2080301850 title "Identification of Two Topologically Independent Domains in RAG1 and Their Role in Macromolecular Interactions Relevant to V(D)J Recombination" @default.
• W2080301850 cites W1561302429 @default.
• W2080301850 cites W1563552185 @default.
• W2080301850 cites W1580095468 @default.
• W2080301850 cites W1966374643 @default.
• W2080301850 cites W1967167923 @default.
• W2080301850 cites W1967727152 @default.
• W2080301850 cites W1972313386 @default.
• W2080301850 cites W1984676925 @default.
• W2080301850 cites W1996303741 @default.
• W2080301850 cites W2007605657 @default.
• W2080301850 cites W2008624950 @default.
• W2080301850 cites W2010085857 @default.
• W2080301850 cites W2011392023 @default.
• W2080301850 cites W2015090136 @default.
• W2080301850 cites W2020246363 @default.
• W2080301850 cites W2027121633 @default.
• W2080301850 cites W2034779212 @default.
• W2080301850 cites W2045057008 @default.
• W2080301850 cites W2060824554 @default.
• W2080301850 cites W2061212261 @default.
• W2080301850 cites W2067022774 @default.
• W2080301850 cites W2069716031 @default.
• W2080301850 cites W2075932264 @default.
• W2080301850 cites W2080686406 @default.
• W2080301850 cites W2083256697 @default.
• W2080301850 cites W2084354924 @default.
• W2080301850 cites W2103425962 @default.
• W2080301850 cites W2104617999 @default.
• W2080301850 cites W2111435081 @default.
• W2080301850 cites W2111532495 @default.
• W2080301850 cites W2113422570 @default.
• W2080301850 cites W2120608812 @default.
• W2080301850 cites W2131554214 @default.
• W2080301850 cites W2131694075 @default.
• W2080301850 cites W2133596876 @default.
• W2080301850 cites W2134759974 @default.
• W2080301850 cites W2139059965 @default.
• W2080301850 cites W2140336226 @default.
• W2080301850 cites W2145260507 @default.
• W2080301850 cites W2152343731 @default.
• W2080301850 cites W2155375991 @default.
• W2080301850 cites W2155439940 @default.
• W2080301850 cites W2155923279 @default.
• W2080301850 cites W2156628449 @default.
• W2080301850 cites W4251838592 @default.
• W2080301850 cites W2003324251 @default.
• W2080301850 doi "https://doi.org/10.1074/jbc.m105988200" @default.
• W2080301850 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11479318" @default.
• W2080301850 hasPublicationYear "2001" @default.
• W2080301850 type Work @default.
• W2080301850 sameAs 2080301850 @default.
• W2080301850 citedByCount "51" @default.
• W2080301850 countsByYear W20803018502012 @default.
• W2080301850 countsByYear W20803018502013 @default.
• W2080301850 countsByYear W20803018502014 @default.
• W2080301850 countsByYear W20803018502015 @default.
• W2080301850 countsByYear W20803018502016 @default.
• W2080301850 countsByYear W20803018502017 @default.
• W2080301850 countsByYear W20803018502019 @default.
• W2080301850 countsByYear W20803018502020 @default.
• W2080301850 countsByYear W20803018502022 @default.
• W2080301850 countsByYear W20803018502023 @default.
• W2080301850 crossrefType "journal-article" @default.
• W2080301850 hasAuthorship W2080301850A5047602445 @default.
• W2080301850 hasAuthorship W2080301850A5049239487 @default.
• W2080301850 hasAuthorship W2080301850A5069509011 @default.
• W2080301850 hasAuthorship W2080301850A5075844486 @default.
• W2080301850 hasAuthorship W2080301850A5080114704 @default.
• W2080301850 hasBestOaLocation W20803018501 @default.
• W2080301850 hasConcept C104317684 @default.
• W2080301850 hasConcept C113646796 @default.
• W2080301850 hasConcept C116834253 @default.
• W2080301850 hasConcept C156695909 @default.
• W2080301850 hasConcept C204389451 @default.
• W2080301850 hasConcept C2781376893 @default.
• W2080301850 hasConcept C54355233 @default.
• W2080301850 hasConcept C59822182 @default.
• W2080301850 hasConcept C86803240 @default.
• W2080301850 hasConceptScore W2080301850C104317684 @default.
• W2080301850 hasConceptScore W2080301850C113646796 @default.
• W2080301850 hasConceptScore W2080301850C116834253 @default.
• W2080301850 hasConceptScore W2080301850C156695909 @default.
• W2080301850 hasConceptScore W2080301850C204389451 @default.
• W2080301850 hasConceptScore W2080301850C2781376893 @default.
• W2080301850 hasConceptScore W2080301850C54355233 @default.
• W2080301850 hasConceptScore W2080301850C59822182 @default.
• W2080301850 hasConceptScore W2080301850C86803240 @default.
• W2080301850 hasIssue "40" @default.

• next