FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2080323034> ?p ?o ?g. }

• W2080323034 endingPage "2360" @default.
• W2080323034 startingPage "2355" @default.
• W2080323034 abstract "Cells that are sensitive to the channel-forming toxin aerolysin contain surface glycoproteins that bind the toxin with high affinity. Here we show that a common feature of aerolysin receptors is the presence of a glycosylphosphatidylinositol anchor, and we present evidence that the anchor itself is an essential part of the toxin binding determinant. The glycosylphosphatidylinositol (GPI)-anchored T-lymphocyte protein Thy-1 is an example of a protein that acts as an aerolysin receptor. This protein retained its ability to bind aerolysin when it was expressed in Chinese hamster ovary cells, but could not bind the toxin when expressed in Escherichia coli, where the GPI anchor is absent. An unrelated GPI-anchored protein, the variant surface glycoprotein of trypanosomes, was shown to bind aerolysin with similar affinity to Thy-1, and this binding ability was significantly reduced when the anchor was removed chemically. Cathepsin D, a protein with no affinity for aerolysin, was converted to an aerolysin binding form when it was expressed as a GPI-anchored hybrid in COS cells. Not all GPI-anchored proteins bind aerolysin. In some cases this may be due to differences in the structure of the anchor itself. Thus the GPI-anchored proteins procyclin ofTrypanosoma congolense and gp63 of Leishmania major did not bind aerolysin, but when gp63 was expressed with a mammalian GPI anchor in Chinese hamster ovary cells, it bound the toxin. Cells that are sensitive to the channel-forming toxin aerolysin contain surface glycoproteins that bind the toxin with high affinity. Here we show that a common feature of aerolysin receptors is the presence of a glycosylphosphatidylinositol anchor, and we present evidence that the anchor itself is an essential part of the toxin binding determinant. The glycosylphosphatidylinositol (GPI)-anchored T-lymphocyte protein Thy-1 is an example of a protein that acts as an aerolysin receptor. This protein retained its ability to bind aerolysin when it was expressed in Chinese hamster ovary cells, but could not bind the toxin when expressed in Escherichia coli, where the GPI anchor is absent. An unrelated GPI-anchored protein, the variant surface glycoprotein of trypanosomes, was shown to bind aerolysin with similar affinity to Thy-1, and this binding ability was significantly reduced when the anchor was removed chemically. Cathepsin D, a protein with no affinity for aerolysin, was converted to an aerolysin binding form when it was expressed as a GPI-anchored hybrid in COS cells. Not all GPI-anchored proteins bind aerolysin. In some cases this may be due to differences in the structure of the anchor itself. Thus the GPI-anchored proteins procyclin ofTrypanosoma congolense and gp63 of Leishmania major did not bind aerolysin, but when gp63 was expressed with a mammalian GPI anchor in Chinese hamster ovary cells, it bound the toxin. Glycosylphosphatidylinositol (GPI) 1The abbreviations used are: GPI, glycosylphosphatidylinositol; EAR, erythrocyte aerolysin receptor; VSG, variant surface glycoprotein; NCAM, neural cell adhesion molecule; CD, cathepsin D; CHO, Chinese hampster ovary; COS, African green monkey kidney cell line; PI-PLC, phosphatidylinositol-specific phospholipase C; PAGE, polyacrylamide gel electrophoresis; ELISA, enzyme-linked immunosorbent assay; HF, hydrofluoric acid.1The abbreviations used are: GPI, glycosylphosphatidylinositol; EAR, erythrocyte aerolysin receptor; VSG, variant surface glycoprotein; NCAM, neural cell adhesion molecule; CD, cathepsin D; CHO, Chinese hampster ovary; COS, African green monkey kidney cell line; PI-PLC, phosphatidylinositol-specific phospholipase C; PAGE, polyacrylamide gel electrophoresis; ELISA, enzyme-linked immunosorbent assay; HF, hydrofluoric acid.-anchored proteins are common components of the external surfaces of eucaryotic cells (1McConville M.J. Ferguson M.A.J. Biochem. J. 1993; 294: 305-324Crossref PubMed Scopus (793) Google Scholar, 2Englund P.T. Annu. Rev. Biochem. 1993; 62: 121-138Crossref PubMed Google Scholar, 3Hirose S. Knez J.J. Medof M.E. Methods Enzymol. 1995; 250: 582-614Crossref PubMed Scopus (21) Google Scholar). The first described was the variant surface glycoprotein (VSG) fromTrypanosoma brucei brucei, which protects the surface of the bloodstream form of the parasite (4Ferguson M.A.J. Low M.G. Cross G.A.M. J. Biol. Chem. 1985; 260: 14547-14555Abstract Full Text PDF PubMed Google Scholar). Since then a great many mammalian proteins have been shown to be anchored to the cell surface in the same way as VSG (3Hirose S. Knez J.J. Medof M.E. Methods Enzymol. 1995; 250: 582-614Crossref PubMed Scopus (21) Google Scholar). Some of these proteins are enzymes, such as placental alkaline phosphatase (5Low M.G. Futerman A.H. Ackerman K.E. Sherman W.R. Silman I. Biochem. J. 1987; 241: 615-619Crossref PubMed Scopus (41) Google Scholar) and erythrocyte acetylcholinesterase (6Roberts W.L. Kim B.H. Rosenberry T.L. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 7817-7821Crossref PubMed Scopus (96) Google Scholar), whereas others appear to be involved in cell adhesion, complement regulation, or even in transport (1McConville M.J. Ferguson M.A.J. Biochem. J. 1993; 294: 305-324Crossref PubMed Scopus (793) Google Scholar). Still others are thought to play roles in communication between cells (7Pu M. Ma L. Ohkusu K. Isobe K. Taguchi R. Ikezawa H. Hamaguchi M. Nakashima I. FEBS Lett. 1995; 361: 295-298Crossref PubMed Scopus (12) Google Scholar, 8Solomon K.R. Rudd C.E. Finberg R.W. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6053-6058Crossref PubMed Scopus (100) Google Scholar, 9Stefanova I. Corcoran M.L. Horak E.M. Wahl L.M. Bolen J.B. Horak I.D. J. Biol. Chem. 1993; 268: 20725-20728Abstract Full Text PDF PubMed Google Scholar, 10Lund-Johansen F. Olweus J. Symington F.W. Arli A. Thompson J.S. Vilella R. Skubitz K. Horejsi V. Eur. J. Immunol. 1993; 23: 2782-2791Crossref PubMed Scopus (85) Google Scholar, 11Stefanova I. Horejsi V. Ansotegui I.J. Knapp W. Stokinger H. Science. 1991; 254: 1016-1018Crossref PubMed Scopus (761) Google Scholar), and there is accumulating evidence that clustering of some GPI-anchored proteins may represent a new mechanism of signal transduction. Thus macrophages and neutrophils are activated by antibody cross-linking of CD14 (lipopolysaccharide receptor) and CD16 (Fc-γRIIIB), which leads to cytokine expression and oxidative burst (12Lee J.D. Kravchenko V. Kirkland T.N. Han J. Mackman N. Moriarty A. Leturcq D. Tobias P.S. Ulevitch R.J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 9930-9934Crossref PubMed Scopus (170) Google Scholar, 13Tobias P.S. Ulevitch R.J. Immunobiology. 1993; 187: 227-232Crossref PubMed Scopus (150) Google Scholar, 14Ulevitch R.J. Tobias P.S. Annu. Rev. Immunol. 1995; 13: 437-457Crossref PubMed Scopus (1312) Google Scholar), and cross-linking of several T-lymphocyte GPI-anchored proteins produces profound regulatory signals (15Gunter K.G. Malek T.R. Shevach E.M. J. Exp. Med. 1984; 159: 716-730Crossref PubMed Scopus (255) Google Scholar, 16Kroczek R.A. Gunter K.C. Seligmann B. Shevach E.M. J. Immunol. 1986; 136: 4379-4384PubMed Google Scholar, 17Hueber A. Raposo G. Pierres M. He H. J. Exp. Med. 1994; 179: 785-796Crossref PubMed Scopus (77) Google Scholar, 18Fujita N. Naito M. Lee S. Hanaoka K. Tsuruo T. Cell Growth Differ. 1995; 6: 355-362PubMed Google Scholar). So far the structures of the GPI anchors of only a few proteins have been determined. All of the anchors contain a core of ethanolamine-HPO4-6Manα1–2Manα1–6Manα1–4GlcNα1–6-myo-inositol-1HPO4-diacylglycerol (or alkylacylglycerol or ceramide; Ref. 1McConville M.J. Ferguson M.A.J. Biochem. J. 1993; 294: 305-324Crossref PubMed Scopus (793) Google Scholar). Other sugars may be added to the glycan core. For example the metazoan anchors contain one or two ethanolamine phosphates attached to the mannoses in the core (1McConville M.J. Ferguson M.A.J. Biochem. J. 1993; 294: 305-324Crossref PubMed Scopus (793) Google Scholar). The inositol can be substituted with an additional fatty acid; this is a feature of human erythrocyte GPI-anchored proteins such as acetylcholinesterase but not of bovine acetylcholinesterase (6Roberts W.L. Kim B.H. Rosenberry T.L. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 7817-7821Crossref PubMed Scopus (96) Google Scholar), an indication that within cell types anchors may have some degree of species-specific structure. Within species, there appear to be variations in anchor structure between cell types (19Brewis I.A. Ferguson M.A.J. Mehlert A. Turner A.J. Hooper N.M. J. Biol. Chem. 1995; 270: 22946-22956Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar), and some of these variations may affect the affinity of ligand binding as has been reported for the folate receptor (20Wang X. Jansen G. Fan J. Kohler W.J. Ross J.F. Schornagel J. Ratnam M. Biochemistry. 1996; 35: 16305-16312Crossref PubMed Scopus (23) Google Scholar). Proaerolysin is a 52-kDa protein secreted by Aeromonas sp., which has been shown to be required for the virulence ofAeromonas hydrophila (reviewed in Ref. 21Parker M.W. van der Goot F.G. Buckley J.T. Mol. Microbiol. 1996; 19: 205-212Crossref PubMed Scopus (94) Google Scholar). Once released, the protoxin is activated by proteolytic nicking. Aerolysin binds to sensitive cells and oligomerizes, inserting into the membrane and forming discrete channels that breach the permeability barrier. We have shown that sensitive cells contain receptors that bind both proaerolysin and aerolysin with high affinity (K d approximately 10−9m; Ref. 22Howard S.P. Buckley J.T. Biochemistry. 1982; 21: 1662-1667Crossref PubMed Scopus (104) Google Scholar). In the case of mammalian erythrocytes, the receptor is a 47-kDa glycoprotein that has N-terminal sequence homology to a group of recently characterized proteins that are involved in ADP-ribosylation reactions (23Cowell S. Aschauer W. Gruber M.J. Nelson K.L. Buckley J.T. Mol. Microbiol. 1997; 25: 343-350Crossref PubMed Scopus (52) Google Scholar). We have also shown that the major surface glycoprotein Thy-1 is a receptor for aerolysin in mouse T-lymphocytes (24Nelson K.L. Raja S.M. Buckley J.T. J. Biol. Chem. 1997; 272: 12170-12174Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar). The erythrocyte aerolysin receptor (EAR) and Thy-1 are apparently unrelated to each other in primary structure and in function. Although both proteins are N-glycosylated, we have found that theN-linked sugars are not required for toxin binding. However, Thy-1 and EAR do share one remarkable feature, both are attached to the cell surface with GPI anchors. This is also true of an 80-kDa aerolysin-binding protein in baby hamster kidney cells. 2L. Abrami, M. Fivaz, R. G. Parton, and F. G. van der Goot, submitted for publication.2L. Abrami, M. Fivaz, R. G. Parton, and F. G. van der Goot, submitted for publication. In this paper we show that this is not a coincidence, and we provide evidence that the anchor itself is required for aerolysin binding. Escherichia coli strains JM109 and BL21(DE3)/pLysS (Novagen) were used as hosts for plasmid amplification and gene expression, respectively. Both strains were grown in LB medium at 37 °C and 300 rpm using a rotary shaker. Where appropriate, ampicillin, chloramphenicol, and kanamycin were added at concentrations of 100, 34, and 40 μg/ml, respectively. The Chinese hamster ovary cell line (CHO-K1) and the monkey kidney cell line (COS) were purchased from the American Type Culture Collection. Murine lymphocyte cell lines AKR1 (Thy-1+) and AKR1 (Thy-1− d; a class d mutant; Ref 26Evans G.A. Hyman R. Lewis K. Immunogenetics. 1987; 25: 28-34Crossref PubMed Scopus (18) Google Scholar), as well as EL4 (Thy-1+) and EL4 (Thy-1− f; a class f mutant) were generously provided by Dr. R. Hyman (Salk Institute). CHO-K1 cells were grown in F-12 nutrient mixture medium (Life Technologies, Inc.), whereas AKR1, EL4, and COS cells were grown in Dulbecco's modified Eagle's high glucose medium. Both media were supplemented with bovine fetal clone I serum (10%, v/v), streptomycin (100 μg/ml), and penicillin (100 units/ml). All cell lines were grown in 5% CO2 at 37 °C. The PCR primers GGGAATTCCATATGCAGAAGGTGACCAGCC and CCGGAATTCAACACTTGACCAGTTTGTCTC were used to isolate the DNA sequence encoding the mature peptide of Thy-1 from the mouse cDNA clone pTZ18U.TM8.5 (Ref. 27Hedrick S.M. Cohen D.I. Nielsen E.A. Davis M.M. Nature. 1984; 308: 149-153Crossref PubMed Scopus (875) Google Scholar; also a gift from Dr. R. Hyman). The primers were designed so that the cloned gene began with an added methionine codon (ATG) to initiate translation and ended with an added stop codon (TGA). The PCR product was ligated into the prokaryotic expression vector pET29a (Novagen), to obtain plasmid pM42 which was amplified in JM109, isolated, and retransformed into BL21(DE3)/pLysS. Expression of the cloned gene was performed according to the protocol provided by Novagen. Three hours after induction with 1 mm isopropyl-1-thio-β-d-galactopyranoside, cells were collected by centrifugation, and aliquots of resuspended cell pellets were used for the sandwich Western blotting procedure described below. BL21(DE3)/pLysS containing pET29a served as a control. For expression of human Thy-1 in tissue cell lines, the cDNA encoding human Thy-1 (pThy-1H, a gift from Dr. R. Kay, University of British Columbia) was amplified by PCR using primers AAGCTTGCTGCAGCAGCGGAAGAC and TCTAGAGGATCCCACCAGTCACAGGGAC and then subcloned into the eucaryotic expression vector pRcCMV (Invitrogen) to obtain pRc-Thy-1. The plasmid construct of the chimeric GPI-anchored form of human cathepsin D (CD; a gift from Dr. E. Ogier-Denis, Faculté de Médecine de Xavier Bichat, Paris) has been reported earlier (28Ogier-Denis E. Bauvy C. Couvineau A. De Stefanis D. Isidoro C. Codogno P. Biochem. Biophys. Res. Commun. 1995; 221: 935-942Crossref Scopus (2) Google Scholar). It contains the human CD cDNA (29Horst M. Hasilik A. Biochem. J. 1991; 273: 355-361Crossref PubMed Scopus (24) Google Scholar) fused with the GPI anchor signal sequence of human 5′-nucleotidase (30Misumi Y. Ogata S. Ohkubo K. Hirose S. Ikehare Y. Eur. J. Biochem. 1990; 191: 563-569Crossref PubMed Scopus (117) Google Scholar). Plasmids were transfected into CHO-K1 cells for stable expression using a CaCl2 precipitation method (31Kingston R.E. Ausbel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. Greene Publishing Associates and Wiley-Interscience, 1988: 9.1.4-9.2.5Google Scholar) or into COS cells for transient expression using a DEAE-dextran and chloroquine method (32Cullen B.R. Lomedico P.T. Ju G. Nature. 1984; 307: 241-245Crossref PubMed Scopus (214) Google Scholar). To select CHO-K1 transfectants, 500 μg/ml Geneticin (G418; Life Technologies, Inc.) was added to the growth medium. Transfected cells were collected 3 days after transfection and washed once with 4.3 mm Na2HPO4, 1.4 mmKH2PO4, pH 7.3, containing 137 mmNaCl and 2.7 mm KCl. Aliquots of resuspended cell pellets were then used to detect proaerolysin-binding proteins by sandwich Western blotting as described below. The entire insert sequence in pRc-Thy-1 and pM42 was confirmed by DNA sequencing using the chain termination method and the Sequenase kit from U. S. Biochemical Corp. Sandwich Western blotting was used to detect proaerolysin-binding proteins as described previously (24Nelson K.L. Raja S.M. Buckley J.T. J. Biol. Chem. 1997; 272: 12170-12174Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar). Briefly, cell or protein samples were separated by SDS-PAGE and blotted onto nitrocellulose. The blots were probed with proaerolysin, followed by polyclonal anti-aerolysin antibody and anti-rabbit horseradish peroxidase. The surface protein gp63 expressed in CHO cells and in Leishmania major samples was detected with a monoclonal anti-gp63 antibody and anti-mouse horseradish peroxidase. The gp63 samples and the antibody were generously provided by Dr. R. McMaster (University of British Columbia). Their preparation has been described previously (33Morrison C.J. McMaster W.R. Piret J.M. Biotechnol. Bioeng. 1997; 53: 594-600Crossref PubMed Scopus (12) Google Scholar). Blots were developed by enhanced chemiluminescence (Amersham Corp.). For the aerolysin sensitivity assay, 1 ml of 5 × 105 cells/ml were treated with 200 milliunits of PI-PLC (Boehringer Mannheim) for 2 h at 37 °C rotating end over end. Cells were then pelleted by brief centrifugation, the supernatant was removed, and cells were resuspended in 1 ml of growth medium. Aerolysin was added to a final concentration of 0.5 nm, and corresponding control samples were incubated without aerolysin for 1 h at 37 °C in 5% CO2. Following incubation, samples were diluted 1:2 in 0.1% trypan blue in phosphate-buffered saline (10 mmNaH2PO4, 150 mm NaCl, pH 7.4) containing 0.1 mm phenylmethylsulfonyl fluoride and 1 mm EDTA, and live/dead cell counts were performed using a hemocytometer. COS transfectants expressing the GPI form of CD were harvested and washed once with phosphate-buffered saline. The washed cells were treated with 350 milliunits of PI-PLC in 150 μl of the same buffer for 2 h at 37 °C, with end-over-end rotation. Control samples were incubated without enzyme. Cells were pelleted at 90,000 rpm for 30 min at 4 °C in a Beckman Airfuge. Aliquots of cells and supernatants were used for the Western blotting procedure. Mouse brain homogenate, prepared as described previously (24Nelson K.L. Raja S.M. Buckley J.T. J. Biol. Chem. 1997; 272: 12170-12174Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar), was treated with PI-PLC and centrifuged. A 10-μl sample of the supernatant was mixed with an equal volume ofN-glycosidase incubation buffer (40 mmNaH2PO4, 100 mm EDTA, 1% sodium dodecyl sulfate, 10% β-mercaptoethanol, pH 7.5), and the mixture was boiled for 2 min. After the mixture was cooled to room temperature, 3.3 μl of a protease inhibitor mixture (0.6 mmphenylmethanesulfonyl fluoride, 60 μg/ml aprotinin, 120 μm leupeptin, and 12 μm pepstatin A) was added, followed by 2.5 μl of 10% octylglucopyranoside and 7.5 μl of peptide N-glycosidase F (Oxford Glycosystems), containing 1.5 units of the enzyme. A control incubation was also carried out in which 7.5 μl of buffer was added in place of the enzyme. After 18 h at 37 °C, sample buffer was added, and aliquots were separated by SDS-PAGE and sandwich Western-blotted. Thy-1 was purified from deoxycholate extracts of pig brain using a modification of the procedure of Letarte-Muirheadet al. (34Letarte-Muirhead M. Barclay A.N. Williams A.F. Biochem. J. 1975; 151: 685-697Crossref PubMed Scopus (107) Google Scholar) and incorporated into carboxyfluorescein-entrapped liposomes as reported earlier (24Nelson K.L. Raja S.M. Buckley J.T. J. Biol. Chem. 1997; 272: 12170-12174Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar). Pronase was added to 500 μl of the liposomes (0.35 μmol of lipid) to a final concentration of 500 μg/ml, and the mixture was incubated for 1 h at room temperature. Liposomes incubated under the same conditions without Pronase were used as a control. The liposomes were separated from free carboxyfluorescein as well as from the fragmented protein and the Pronase by passing them over a Sephacryl S-300 column. Aerolysin-induced channel formation was monitored by measuring carboxyfluorescein release spectrofluorimetrically, as described before (24Nelson K.L. Raja S.M. Buckley J.T. J. Biol. Chem. 1997; 272: 12170-12174Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar). The GPI anchor of purified VSG was chemically cleaved from the protein by treatment with aqueous HF, following the procedure of Ferguson et al. (35Ferguson M.A.J. Homans S.W. Dwek R.A. Rademacher T.W. Science. 1988; 239: 753-759Crossref PubMed Scopus (551) Google Scholar). The VSG was a kind gift from Dr. Terry Pearson (University of Victoria). The glycoprotein (150 μg) was incubated with 100 μl of 50% aqueous HF at 0 °C for 48 h. A control sample was incubated with water under the same conditions. The HF was neutralized by adding the sample to frozen saturated lithium hydroxide, and the precipitate of lithium fluoride was removed by centrifugation. The pellet was washed twice with 50 μl of distilled water, and the aqueous portions were combined and desalted over a PD-10 (G-25) column equilibrated in 20 mm HEPES , pH 7.4, containing 150 mm NaCl. Proaerolysin binding was assessed following Western blotting, after SDS-PAGE of the void volume fraction. Anchor removal was confirmed using a commercial antibody that detects the presence of the GPI anchors (anti-cross-reacting determinant; Oxford Glycosystems, Ref. 36Zamze S.E. Ferguson M.A.J. Collins R. Dwek R.A. Eur. J. Biochem. 1988; 176: 527-534Crossref PubMed Scopus (129) Google Scholar). Proaerolysin binding was compared using an ELISA-based assay as we have described before (37Rossjohn J. Buckley J.T. Hazes B. Murzin A.G. Read R.J. Parker M.W. EMBO J. 1997; 16: 3426-3434Crossref PubMed Scopus (49) Google Scholar). Protein concentrations were measured according to Markwell et al.(38Markwell M.A. Haas S.M. Bieber L.L. Tolbert N.E. Anal. Biochem. 1978; 87: 206-210Crossref PubMed Scopus (5279) Google Scholar). Total lipid phosphorus was determined following the procedure of Ames and Dubin (39Ames B.N. Dubin D.T. J. Biol. Chem. 1960; 235: 769-775Abstract Full Text PDF PubMed Google Scholar). We have shown that Thy-1 binds aerolysin with high affinity and that liposomes containing incorporated Thy-1 are much more sensitive to the toxin (24Nelson K.L. Raja S.M. Buckley J.T. J. Biol. Chem. 1997; 272: 12170-12174Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar). We have also found that EL4 cell lines that cannot add GPI anchors to membrane proteins resist aerolysin's action, and we had assumed that this was because they lacked Thy-1 (24Nelson K.L. Raja S.M. Buckley J.T. J. Biol. Chem. 1997; 272: 12170-12174Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar). We were therefore surprised to discover that the mouse mutant T-lymphocyte cell line AKR1 (Thy-1− d), which does not express Thy-1 (26Evans G.A. Hyman R. Lewis K. Immunogenetics. 1987; 25: 28-34Crossref PubMed Scopus (18) Google Scholar), was almost as sensitive to aerolysin as was the parent strain (Fig.1). This led us to consider the possibility that aerolysin may bind to more than one GPI-anchored protein in T-lymphocytes. The sensitivity of the AKR1 (Thy-1− d) cell line to the toxin could then be attributed to the presence of other GPI-anchored receptors, all of which would be missing from the mutant EL4 cells we studied earlier. This explanation was supported by the results of treating cells with phosphatidylinositol-specific phospholipase C, which selectively removes GPI-anchored proteins from their surfaces. It may be seen in Fig. 1 that both AKR1 cell lines became less sensitive to aerolysin after treatment with the enzyme. Sandwich Western blotting of mouse brain homogenate revealed that in addition to Thy-1, there is a 110-kDa membrane-associated protein that binds proaerolysin (lane 3, Fig. 2). Like Thy-1, this protein was solubilized by treating the homogenate with PI-PLC, indicating that it too is GPI-anchored (lanes 1 and 6). A literature search for known GPI-anchored proteins of comparable size suggested that the brain protein might be either neural cell adhesion molecule (NCAM; Ref. 40Mukasa R. Umeda M. Endo T. Kobata A. Inoue K. Arch. Biochem. Biophys. 1995; 318: 182-190Crossref PubMed Scopus (28) Google Scholar) or contactin (41Peles E. Nativ M. Campbell P.L. Sakurai T. Martinez R. Lev S. Clary D.D. Schilling J. Barnea G. Plowman G.D. Grumet M. Schlessinger J. Cell. 1995; 82: 251-260Abstract Full Text PDF PubMed Scopus (367) Google Scholar). There was only a small decrease in the size of this protein when it was treated withN-glycosidase (lane 2, Fig. 2). Two bands corresponding to much smaller proteins are also visible in lane 2 after N-glycosidase treatment. The lower corresponds to completely de-N-glycosylated Thy-1, and the upper may represent partially deglycosylated Thy-1 as we have discussed previously (24Nelson K.L. Raja S.M. Buckley J.T. J. Biol. Chem. 1997; 272: 12170-12174Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar), or it may represent another GPI-anchored protein. The 110-kDa aerolysin-binding protein was unambiguously identified as contactin by determining its N-terminal sequence after purifying the protein, which had been liberated from the membrane by treatment with PI-PLC. 3K. L. Nelson and J. T. Buckley, manuscript in preparation. The observation that T-cells contain at least one GPI-anchored protein in addition to Thy-1 that binds proaerolysin, and that the erythrocyte aerolysin receptor (23Cowell S. Aschauer W. Gruber M.J. Nelson K.L. Buckley J.T. Mol. Microbiol. 1997; 25: 343-350Crossref PubMed Scopus (52) Google Scholar) and contactin are also GPI-anchored proteins, pointed to the remarkable possibility that the anchors themselves may be involved in proaerolysin binding. The VSG ofT. brucei brucei was the first GPI-anchored protein to be characterized (35Ferguson M.A.J. Homans S.W. Dwek R.A. Rademacher T.W. Science. 1988; 239: 753-759Crossref PubMed Scopus (551) Google Scholar). Aside from its anchor, it seems to be unrelated to either Thy-1 or contactin, and it is unlikely to have any sequence homology with EAR, which appears to be a member of a small family of ADP-ribosyltransferases (23Cowell S. Aschauer W. Gruber M.J. Nelson K.L. Buckley J.T. Mol. Microbiol. 1997; 25: 343-350Crossref PubMed Scopus (52) Google Scholar). However, VSG has a similar, though not identical GPI anchor to Thy-1, so we felt it possible that it too could bind proaerolysin if the anchor is a binding determinant. Using samples of purified VSG and an ELISA-based assay, we compared proaerolysin binding to VSG with binding to purified Thy-1. The results in Fig.3 show that the toxin also bound the trypanosomal protein. We were easily able to detect VSG by sandwich Western blotting (not shown) in amounts comparable with the amounts of Thy-1 we have detected previously (24Nelson K.L. Raja S.M. Buckley J.T. J. Biol. Chem. 1997; 272: 12170-12174Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar). To obtain more direct evidence that the GPI anchor itself was involved in proaerolysin binding, we took two approaches. In the first, we compared protoxin binding to Thy-1 expressed in E. coli, which is not capable of adding GPI anchors, with binding to Thy-1 expressed in CHO cells, where we would expect processing to be normal (28Ogier-Denis E. Bauvy C. Couvineau A. De Stefanis D. Isidoro C. Codogno P. Biochem. Biophys. Res. Commun. 1995; 221: 935-942Crossref Scopus (2) Google Scholar). The results in Fig. 4 show that proaerolysin could easily detect Thy-1 expressed in the eucaryotic cell, whereas there was no evidence of specific binding to Thy-1 expressed in the bacteria, even though, as was clear from a comparison of Coomassie-stained samples, far more Thy-1 was present in theE. coli samples we used. It is worth emphasizing that the far Western blotting procedure we used can detect less than 1 ng of native Thy-1 (24Nelson K.L. Raja S.M. Buckley J.T. J. Biol. Chem. 1997; 272: 12170-12174Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar). Of course as well as lacking the anchor, the Thy-1 expressed in the bacteria would lack the N-linked carbohydrate that is normally present in the eucaryote. However this could not account for the difference in binding we observed, since as noted above, we have shown that the N-linked sugars apparently are not required for proaerolysin binding (24Nelson K.L. Raja S.M. Buckley J.T. J. Biol. Chem. 1997; 272: 12170-12174Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar). In the second approach, we took advantage of the fact that HF can selectively remove nearly the entire GPI anchor from proteins without destroying the polypeptide chain (35Ferguson M.A.J. Homans S.W. Dwek R.A. Rademacher T.W. Science. 1988; 239: 753-759Crossref PubMed Scopus (551) Google Scholar). The results in Fig.5 show that treatment of VSG with HF led to a very large reduction in proaerolysin binding measured using sandwich Western blotting or the ELISA assay. The results also show that binding of a commercial antibody directed against the GPI determinant, which we used as a positive control of anchor removal, was also reduced. A number of groups have successfully produced hybrid proteins by fusing the DNA encoding the anchor signal for a GPI-anchored protein such as decay-accelerating factor or Thy-1 to the DNA encoding a protein that is normally not anchored in this way (27Hedrick S.M. Cohen D.I. Nielsen E.A. Davis M.M. Nature. 1984; 308: 149-153Crossref PubMed Scopus (875) Google Scholar,42Clissold P.M. Biochem. J. 1992; 281: 129-136Crossref PubMed Scopus (9) Google Scholar, 43Lublin D.M. Coyne K.E. J. Exp. Med. 1991; 174: 35-44Crossref PubMed Scopus (98) Google Scholar). Many of these hybrid proteins appear to behave like normal GPI-anchored proteins, finding their way to the exterior surface of the cell's plasma membrane. An example is CD, which was converted from a soluble to a surface exposed GPI-anchored protein by Ogier-Deniset al. (28Ogier-Denis E. Bauvy C. Couvineau A. De Stefanis D. Isidoro C. Codogno P. Biochem. Biophys. Res. Commun. 1995; 221: 935-942Crossref Scopus (2) Google Scholar). The results in Fig. 3 show that proaerolysin has no affinity for the normal water soluble form of human CD (obtained from Sigma), nor could the soluble form of the protein be detected by sandwich Western blotting (not shown). How" @default.
• W2080323034 created "2016-06-24" @default.
• W2080323034 creator A5012206402 @default.
• W2080323034 creator A5013808998 @default.
• W2080323034 creator A5025515726 @default.
• W2080323034 creator A5044545777 @default.
• W2080323034 creator A5091233106 @default.
• W2080323034 date "1998-01-01" @default.
• W2080323034 modified "2023-10-13" @default.
• W2080323034 title "Glycosylphosphatidylinositol Anchors of Membrane Glycoproteins Are Binding Determinants for the Channel-forming Toxin Aerolysin" @default.
• W2080323034 cites W1487279029 @default.
• W2080323034 cites W1519301821 @default.
• W2080323034 cites W1528089915 @default.
• W2080323034 cites W1635858559 @default.
• W2080323034 cites W1826062614 @default.
• W2080323034 cites W1882641792 @default.
• W2080323034 cites W1944304173 @default.
• W2080323034 cites W1971942838 @default.
• W2080323034 cites W1981322072 @default.
• W2080323034 cites W1992740312 @default.
• W2080323034 cites W1992844531 @default.
• W2080323034 cites W1994772282 @default.
• W2080323034 cites W2021549033 @default.
• W2080323034 cites W2021611191 @default.
• W2080323034 cites W2022479530 @default.
• W2080323034 cites W2023178515 @default.
• W2080323034 cites W2023235169 @default.
• W2080323034 cites W2024753337 @default.
• W2080323034 cites W2027706156 @default.
• W2080323034 cites W2031423487 @default.
• W2080323034 cites W2037309942 @default.
• W2080323034 cites W2043049122 @default.
• W2080323034 cites W2043147088 @default.
• W2080323034 cites W2044149109 @default.
• W2080323034 cites W2055071063 @default.
• W2080323034 cites W2059759975 @default.
• W2080323034 cites W2061624786 @default.
• W2080323034 cites W2063397347 @default.
• W2080323034 cites W2072538271 @default.
• W2080323034 cites W2075307129 @default.
• W2080323034 cites W2076042161 @default.
• W2080323034 cites W2082858209 @default.
• W2080323034 cites W2084214971 @default.
• W2080323034 cites W2110008350 @default.
• W2080323034 cites W2113828544 @default.
• W2080323034 cites W2114283841 @default.
• W2080323034 cites W2115405004 @default.
• W2080323034 cites W2126565617 @default.
• W2080323034 cites W2144077307 @default.
• W2080323034 cites W2151915336 @default.
• W2080323034 cites W2158249297 @default.
• W2080323034 cites W2175428614 @default.
• W2080323034 cites W2243407002 @default.
• W2080323034 cites W2399880260 @default.
• W2080323034 cites W2401878947 @default.
• W2080323034 doi "https://doi.org/10.1074/jbc.273.4.2355" @default.
• W2080323034 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9442081" @default.
• W2080323034 hasPublicationYear "1998" @default.
• W2080323034 type Work @default.
• W2080323034 sameAs 2080323034 @default.
• W2080323034 citedByCount "176" @default.
• W2080323034 countsByYear W20803230342012 @default.
• W2080323034 countsByYear W20803230342013 @default.
• W2080323034 countsByYear W20803230342014 @default.
• W2080323034 countsByYear W20803230342015 @default.
• W2080323034 countsByYear W20803230342016 @default.
• W2080323034 countsByYear W20803230342017 @default.
• W2080323034 countsByYear W20803230342018 @default.
• W2080323034 countsByYear W20803230342019 @default.
• W2080323034 countsByYear W20803230342020 @default.
• W2080323034 countsByYear W20803230342021 @default.
• W2080323034 countsByYear W20803230342022 @default.
• W2080323034 countsByYear W20803230342023 @default.
• W2080323034 crossrefType "journal-article" @default.
• W2080323034 hasAuthorship W2080323034A5012206402 @default.
• W2080323034 hasAuthorship W2080323034A5013808998 @default.
• W2080323034 hasAuthorship W2080323034A5025515726 @default.
• W2080323034 hasAuthorship W2080323034A5044545777 @default.
• W2080323034 hasAuthorship W2080323034A5091233106 @default.
• W2080323034 hasBestOaLocation W20803230341 @default.
• W2080323034 hasConcept C104317684 @default.
• W2080323034 hasConcept C108625454 @default.
• W2080323034 hasConcept C12554922 @default.
• W2080323034 hasConcept C144647389 @default.
• W2080323034 hasConcept C174319367 @default.
• W2080323034 hasConcept C185592680 @default.
• W2080323034 hasConcept C2777367657 @default.
• W2080323034 hasConcept C2777459641 @default.
• W2080323034 hasConcept C41625074 @default.
• W2080323034 hasConcept C55493867 @default.
• W2080323034 hasConcept C60987743 @default.
• W2080323034 hasConcept C86803240 @default.
• W2080323034 hasConcept C95444343 @default.
• W2080323034 hasConceptScore W2080323034C104317684 @default.
• W2080323034 hasConceptScore W2080323034C108625454 @default.
• W2080323034 hasConceptScore W2080323034C12554922 @default.
• W2080323034 hasConceptScore W2080323034C144647389 @default.
• W2080323034 hasConceptScore W2080323034C174319367 @default.

• next