FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2080395830> ?p ?o ?g. }

• W2080395830 endingPage "40353" @default.
• W2080395830 startingPage "40341" @default.
• W2080395830 abstract "The differentiation of preadipocytes to adipocytes is orchestrated by the expression of the “master adipogenic regulators,” CCAAT/enhancer-binding protein (C/EBP) β, peroxisome proliferator-activated receptor γ (PPARγ), and C/EBP α. In addition, activation of the cAMP-response element-binding protein (CREB) is necessary and sufficient to promote adipogenic conversion and prevent apoptosis of mature adipocytes. In this report we used small interfering RNAto deplete CREB and the closely related factor ATF1 to explore the ability of the master adipogenic regulators to promote adipogenesis in the absence of CREB and probe the function of CREB in late stages of adipogenesis. Loss of CREB/ATF1 blocked adipogenic conversion of 3T3-L1 cells in culture or 3T3-F442A cells implanted into athymic mice. Loss of CREB/ATF1 prevented the expression of PPARγ, C/EBP α, and adiponectin and inhibited the loss of Pref-1. Loss of CREB/ATF1 inhibited adipogenic conversion even in cells ectopically expressing C/EBP α, C/EBP β, or PPARγ2 individually. CREB/ATF1 depletion did not attenuate lipid accumulation in cells expressing both PPARγ2 and C/EBP α, but adiponectin expression was severely diminished. Conversely ectopic expression of constitutively active CREB overcame the blockade of adipogenesis due to depletion of C/EBP β but not due to loss of PPARγ2 or C/EBP α. Depletion of CREB/ATF1 did not suppress the expression of C/EBP β as we had previously observed using dominant negative forms of CREB. Finally results are presented showing that CREB promotes PPARγ2 gene transcription. The results indicate that CREB and ATF1 play a central role in adipogenesis because expression of individual master adipogenic regulators is unable to compensate for their loss. The data also indicate that CREB not only functions during the initiation of adipogenic conversion but also at later stages. The differentiation of preadipocytes to adipocytes is orchestrated by the expression of the “master adipogenic regulators,” CCAAT/enhancer-binding protein (C/EBP) β, peroxisome proliferator-activated receptor γ (PPARγ), and C/EBP α. In addition, activation of the cAMP-response element-binding protein (CREB) is necessary and sufficient to promote adipogenic conversion and prevent apoptosis of mature adipocytes. In this report we used small interfering RNAto deplete CREB and the closely related factor ATF1 to explore the ability of the master adipogenic regulators to promote adipogenesis in the absence of CREB and probe the function of CREB in late stages of adipogenesis. Loss of CREB/ATF1 blocked adipogenic conversion of 3T3-L1 cells in culture or 3T3-F442A cells implanted into athymic mice. Loss of CREB/ATF1 prevented the expression of PPARγ, C/EBP α, and adiponectin and inhibited the loss of Pref-1. Loss of CREB/ATF1 inhibited adipogenic conversion even in cells ectopically expressing C/EBP α, C/EBP β, or PPARγ2 individually. CREB/ATF1 depletion did not attenuate lipid accumulation in cells expressing both PPARγ2 and C/EBP α, but adiponectin expression was severely diminished. Conversely ectopic expression of constitutively active CREB overcame the blockade of adipogenesis due to depletion of C/EBP β but not due to loss of PPARγ2 or C/EBP α. Depletion of CREB/ATF1 did not suppress the expression of C/EBP β as we had previously observed using dominant negative forms of CREB. Finally results are presented showing that CREB promotes PPARγ2 gene transcription. The results indicate that CREB and ATF1 play a central role in adipogenesis because expression of individual master adipogenic regulators is unable to compensate for their loss. The data also indicate that CREB not only functions during the initiation of adipogenic conversion but also at later stages. Normal adipose tissue development and increases in adipose tissue mass associated with weight gain and obesity require the formation of mature adipocytes from preadipocytes or stromal progenitor cells (1Ailhaud G. Grimaldi P. Negrel R. Annu. Rev. Nutr. 1992; 12: 207-233Crossref PubMed Scopus (601) Google Scholar, 2Garaulet M. Hernandez-Morante J.J. Lujan J. Tebar F.J. Zamora S. Int. J. Obes. (Lond.). 2006; 30: 899-905Crossref PubMed Scopus (155) Google Scholar, 3Marques B.G. Hausman D.B. Martin R.J. Am. J. Physiol. 1998; 275: R1891-R1908Google Scholar). The factors and processes that mediate the conversion of preadipocytes to mature adipocytes have been elucidated, at least in part, in immortalized preadipocyte cell lines like 3T3-L1, 3T3-F442A, and Ob1771 and in primary preadipocytes and stromal progenitor cells (1Ailhaud G. Grimaldi P. Negrel R. Annu. Rev. Nutr. 1992; 12: 207-233Crossref PubMed Scopus (601) Google Scholar, 5Cowherd R.M. Lyle R.E. McGehee Jr., R.E. Semin. Cell Dev. Biol. 1999; 10: 3-10Crossref PubMed Scopus (237) Google Scholar, 6MacDougald O.A. Mandrup S. Trends Endocrinol. Metab. 2002; 13: 5-11Abstract Full Text Full Text PDF PubMed Scopus (300) Google Scholar, 7Morrison R.F. Farmer S.R. J. Cell. Biochem. 1999; 75: 59-67Crossref Google Scholar, 8Rosen E.D. Spiegelman B.M. Annu. Rev. Cell Dev. Biol. 2000; 16: 145-171Crossref PubMed Scopus (1053) Google Scholar). Adipogenic conversion is initiated in culture via the addition of glucocorticoids and insulin or insulin-like growth factor-1 plus agents that elevate intracellular cAMP levels. Ligands of the nuclear hormone receptor, PPARγ, 2The abbreviations used are: PPARγ, peroxisome proliferator-activated receptorγ; CREB, cAMP-response element-binding protein; C/EBP, CCAAT/enhancer-binding protein; siRNA, small interfering RNA; CREM, cAMP-response element modulator; ERK, extracellular signal-regulated kinase; CRE, cAMP-response element; TUNEL, terminal deoxynucleotidyl transferase dUTP nick-end labeling; DMEM, Dulbecco's modified Eagle's medium; FCS, fetal calf serum; Bt2cAMP, dibutyryl cyclic AMP; PVDF, polyvinylidene difluoride; GFP, green fluorescent protein. like thiazolidinediones and prostaglandin, also increase the rate or extent of adipogenesis (9Farmer S.R. Int. J. Obes. (Lond.). 2005; 29: S13-S16Crossref PubMed Scopus (341) Google Scholar, 10Grimaldi P. Prog. Lipid Res. 2001; 40: 269-281Crossref PubMed Scopus (125) Google Scholar). The agents that govern adipogenic conversion in vivo are less well understood, but there is convincing evidence that free fatty acids, insulin and insulin-like growth factor-1, and glucocorticoids play important roles in the development of adipose tissue and the formation of new adipocytes. Exposure to differentiation-inducing agents initiates a well characterized cascade of gene expression events that lead to the mature adipocyte phenotype. The differentiation cascade begins with the expression of C/EBP β within hours of treatment with inducing agents (11Tang Q.Q. Otto T.C. Lane M.D. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 85-855Google Scholar). This factor then promotes the expression of PPARγ and C/EBP α (12Hamm J.K. Park B.H. Farmer S.R. J. Biol. Chem. 2001; 276: 18464-18471Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar, 13Wu Z. Bucher N.L.R. Farmer S.R. Mol. Cell. Biol. 1996; 16: 4128-4136Crossref PubMed Google Scholar). Both of these factors are necessary to promote the terminal or mature adipocyte phenotype including insulin-sensitive glucose uptake (14El Jack A.K. Hamm J.K. Pilch P.F. Farmer S.R. J. Biol. Chem. 1999; 274: 7946-7951Abstract Full Text Full Text PDF PubMed Scopus (170) Google Scholar). However, all of these “master adipogenic regulators” are expressed after the initiation of the differentiation program. This suggests that pre-existing regulatory factor(s) are required to initiate adipogenic conversion. In previous studies we demonstrated that the transcription factor CREB was expressed in 3T3-L1 preadipocytes before treatment with differentiation-inducing agents, in mature 3T3-L1 adipocytes, and throughout the adipogenic cascade (15Klemm D.J. Roesler W.J. Boras T. Colton L.A. Felder K. Reusch J.E.-B. J. Biol. Chem. 1998; 273: 917-923Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar, 16Reusch J.E.-B. Colton L.A. Klemm D.J. Mol. Cell. Biol. 2000; 20: 1008-1020Crossref PubMed Scopus (263) Google Scholar). In addition, we showed that CREB phosphorylation and transcriptional activity were activated by both cAMP mimetics via protein kinase A and by insulin through the ERK signaling pathway. Subsequently we demonstrated that ectopic expression of constitutively active forms of CREB was sufficient to drive adipogenic conversion of 3T3-L1 cells, whereas dominant negative forms of CREB inhibited this process (16Reusch J.E.-B. Colton L.A. Klemm D.J. Mol. Cell. Biol. 2000; 20: 1008-1020Crossref PubMed Scopus (263) Google Scholar). The central role of CREB in adipogenesis is exemplified by the ability of constitutively active forms of CREB to overcome inhibition of adipogenic conversion due to blockade of Ras/ERK signaling (17Klemm D.J. Leitner J.W. Watson P. Nesterova A. Reusch J.E.B. Goalstone M.L. Draznin B. J. Biol. Chem. 2001; 276: 28430-28435Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar). In addition, diminished CREB activity in mature adipocytes induces apoptosis, in part, through decreased Akt expression (18Reusch J.E.B. Klemm D.J. J. Biol. Chem. 2001; 277: 1426-1432Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). More recently, in collaboration with Lane and co-workers (19Zhang J.W. Klemm D.J. Vinson C. Lane M.D. J. Biol. Chem. 2004; 279: 4471-4478Abstract Full Text Full Text PDF PubMed Scopus (211) Google Scholar), we have reported evidence that CREB promotes expression of C/EBP β, which in turn may drive the remaining steps in adipogenesis. These studies highlight the importance of CREB in the development and survival of adipocytes. However, the relative importance of CREB versus the master adipogenic regulators C/EBP β, C/EBP α, and PPARγ and the role of CREB in later stages of adipogenesis are unknown. In this report we used siRNA to knock down CREB and the closely related factor ATF1 to explore the ability of the master adipogenic regulators to promote adipogenesis in the absence of CREB and probe the function of CREB in late stages of adipocyte differentiation. We found that loss of CREB/ATF1 effectively blocked adipogenic conversion of 3T3-L1 cells in culture or 3T3-F442A cells implanted into athymic mice. Depletion of other CRE-binding proteins, ATF2, c-Jun, or CREM, had no affect on adipogenesis. Depletion of CREB/ATF1 prevented the expression of PPARγ, C/EBP α, and adiponectin in cells treated with differentiation-inducing agents and inhibited the loss of Pref-1. Conversely ectopic expression of constitutively active CREB overcame the blockade of adipogenesis due to depletion of C/EBP β but not due to loss of PPARγ2 or C/EBP α. Unexpectedly depletion of CREB/ATF1 did not suppress the expression of C/EBP β as we had previously observed using dominant negative forms of CREB. Individual depletion of CREM, c-Jun, or ATF2 also did not diminish hormone-induced C/EBP β expression, but combined knockdown of these factors together with CREB/ATF1 resulted in loss of C/EBP β expression. Interestingly loss of CREB/ATF1 inhibited adipogenic conversion even in cells ectopically expressing C/EBP α, C/EBP β, or PPARγ2. Finally results are presented showing that CREB, at least in part, promotes PPARγ2 gene transcription. The results indicate that CREB and ATF1 play a central role in adipogenesis because expression of individual master adipogenic regulators is unable to compensate for their loss. The data also indicate that CREB not only functions during the initiation of adipogenic conversion but at later stages as well. Materials—Cell culture media and supplies were from Invitrogen, Gemini Bioproducts (Gaithersburg, MD), and Specialty Media, Inc. (Lavallette, NJ). 3T3-L1 preadipocytes were purchased from American Type Culture Collection (Manassas, VA), and 3T3-F442A cells were provided by Dr. Stephen Farmer (Boston University, Boston, MA). Expression vectors for the dominant negative CREB inhibitor protein KCREB (pRSV-KCREB) and the constitutively active CREB isoform CREB-DIEDML (pRSV-CREB-DIEDML) were provided by Dr. Richard Goodman (Oregon Health Sciences University, Portland, OR). A vector containing the proximal C/EBP β gene promoter from -121 to +16 (pLAPPRO 8) or a promoter in which the two CRE sites were ablated (pLAPPRO 8 I + II) (20Niehof M. Manns M.P. Trautwein C. Mol. Cell. Biol. 1997; 17: 3600-3613Crossref PubMed Google Scholar) were obtained from Dr. Christian Trautwein (Medizinische Hochschule Hannover, Hannover, Germany). Plasmids for stable expression of PPARγ2 (pTS13-PPARγ2) and C/EBP α (pLXSN-C/EBP α) were provided by Dr. Mitch Lazar (University of Pennsylvania, Philadelphia, PA). Plasmids for stable expression of C/EBP β (pWZL-C/EBP β) and LacZ (pWZL-LacZ) were provided by Dr. Robert Lewis (University of Nebraska, Omaha, NE). Plasmids for stable siRNA expression, pSilencer 4.1-CMVneo and pSilencer 4.1-CMVpuro, were purchased from Ambion, Inc. (Austin, TX). The double-stranded siRNA oligonucleotides listed in Table 1 were purchased from Dharmacon, Inc. (Lafayette, CO), and the double-stranded oligonucleotides used to make stable siRNA expression plasmids were purchased from Integrated DNA Technologies, Inc. (Coralville, IA). Rabbit polyclonal antibodies for CREB and C/EBP β were purchased from Cell Signaling Technology (Danvers, MA), and a polyclonal antibody to Pref-1 was obtained from Alpha Diagnostics International (San Antonio, TX). Polyclonal antibodies to CREM, ATF1, ATF2, c-Jun, and C/EBP α and a monoclonal antibody to PPARγ2 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Luciferase assay reagents and the plasmid pRL-TK, containing the enhancerless thymidine kinase gene promoter driving a Renilla luciferase reporter gene, were obtained from Promega Corp. (Madison, WI). SuperSignal West Pico chemiluminescent substrate was from Pierce. Horseradish peroxidase-conjugated secondary antibodies were obtained from Vector Laboratories (Burlingame, CA). Oligofectamine, Lipofectamine, and PLUS reagent were obtained from Invitrogen. ApoAlert DNA fragmentation (TUNEL) kits were obtained from BD Biosciences. Low growth factor Matrigel was obtained from BD Biosciences.TABLE 1OligonucleotidesTargetPlasmidSense strand sequencesiRNA oligonucleotidesLuciferase (control)153CGTACGCGGAATACTTCGA172CREBOligo A, 284GATTCACAGGAGTCTGTGG303Oligo B, 528TACAGCTGGCTAACAATGG547Oligo C, 670CCAAGTTGTTGTTCAAGCT689ATF2Oligo A, 36CGCCAACAAGATTCCTAAATT55Oligo B, 1051ACAGCTTCTTCTGGCTCATTT1070c-JunOligo A, 359CTGCATAGCCAGAACACGCTT378Oligo B, 781GCGCATGAGGAACCGCATTTT800CREMOligo A, 245CTTTCCTCTGATGTGCCTG264Oligo B, 1079AGACATTTGCTCTCCCAAA1098Oligonucleotides for stable siRNA expressionLuciferase (control)pSilencer 4.1-CMVneo5′-AGC TTC ACG TAC GCG GAA TAC TTC GAT CTC TTG AAT CGA AGT ATT CCG CGT ACG G-3′CREBpSilencer 4.1-CMVneo5′-AGC TTA ATA CAG CTG GCT AAC AAT GGT CTC TTG AAC CAT TGT TAG CCA GCT GTA G-3′pSilencer 4.1-CMVpuro5′-AGC TTA ACC AAG TTG TTG TTC AAG CTT CTC TTG AAA GCT TGA ACA ACA ACT TGG G-3′ Open table in a new tab Cell Culture and Adipocyte Differentiation in Vitro—3T3-L1 and 3T3-F442A preadipocytes were passaged in low glucose Dulbecco's modified Eagle's medium (DMEM) plus 10% fetal calf serum (FCS), and 1 mm l-glutamine. 3T3-L1 fibroblasts were differentiated into adipocytes after siRNA and/or plasmid transfection upon reaching confluency by the addition of high glucose DMEM containing 10% FCS, 1 mm l-glutamine, and 300 μm isobutylmethylxanthine or Bt2cAMP, 1 μm dexamethasone, and 1 μg/ml insulin (MDI). After 2 days, the 3T3-L1 cells were transferred to high glucose DMEM plus 10% FCS, 1 mm l-glutamine, and 1 μg/ml insulin and refed every 2 days. Differentiation of preadipocytes to mature adipocytes was confirmed by Oil Red O staining of lipid vesicles. Western Blotting—Whole cell lysates were prepared in 20 mm Tris-HCl containing 10% glycerol, 0.3% Nonidet P-40, 300 mm NaCl, 1.5 mm Mg2Cl, 1 mm EDTA, 1 mm dithiothreitol, and protease inhibitors (Complete mini protease inhibitor tablets, Roche Applied Science). After correcting for protein concentrations, cell lysates were mixed with an equal volume of Laemmli SDS loading buffer, and equal amounts of lysate protein were resolved on 10% polyacrylamide-SDS gels and transferred to PVDF membranes. The blots were blocked with phosphatebuffered saline containing 5% dry milk and 0.1% Tween 20 and then treated with antibodies that recognize the target proteins indicated in each figure overnight at 4 °C. The blots were washed and subsequently treated with appropriate secondary antibodies conjugated to horseradish peroxidase. After the blots were washed, specific immune complexes were visualized with SuperSignal West Pico chemiluminescent substrates. siRNA and Plasmid Transfection and Luciferase Assays—For siRNA transfection, 3T3-L1 cells were plated at 30-50% confluency on 6-well plates in complete medium. Twenty-four hours later the cells were transferred to Opti-MEM for transfection. Double-stranded siRNA oligonucleotides or the control luciferase-specific siRNA was complexed with Oligofectamine reagent and applied to the cells according to the manufacturer's recommendations at a final concentration of 200 nm. Where more than one siRNA oligonucleotide is specified in Table 1, equimolar amounts of the individual oligonucleotides were combined before use. After 3 h, an equal volume of DMEM containing 30% FCS was added to the wells. Cells were allowed to recover for 24 h before subsequent manipulations. For plasmid transfections, plates of 3T3-L1 or 3T3-F442A preadipocytes were grown to 70-80% confluency and transfected with the indicated plasmids with Lipofectamine PLUS reagents according to the manufacturer's recommendations. Cells transiently transfected with the C/EBP β gene promoterluciferase or PPARγ2 gene promoter-luciferase reporter plasmids were used within 48 h of transfection. Cells stably transfected with C/EBP β and LacZ expression vectors were selected in blasticidin (10 μg/ml), whereas cells transfected with the PPARγ2 expression plasmid were selected in hygromycin (100 μg/ml). Cells stably expressing C/EBP α were selected in G418 (1 mg/ml). Large, rapidly growing, well separated colonies were isolated 10-12 days after selection was begun with the antibiotics. Isolated clones were passaged in low glucose DMEM containing 10% FCS and 1 mm l-glutamine with half the concentration of selection antibiotic used during selection. Luciferase assays were conducted on lysates from cells transfected with plasmids containing the C/EBP β gene promoter or the PPARγ2 gene promoter (-611 to +32) linked to the firefly luciferase gene. Cells were co-transfected with the plasmid pRL-TK as an internal control. Cell lysates and luciferase reactions were performed with the Dual-Luciferase reporter assay system on a Turner Designs 20/20n luminometer (Turner Designs, Sunnyvale, CA). Microscopy—Microscopy was performed on a Nikon TE2000-U inverted epifluorescence microscope. Phase-contrast, bright field images were captured to a personal computer with a Spot Insight color camera (Diagnostic Imaging, Sterling Heights, MI). Images were analyzed and processed with Meta-Morph 6.1 Software (Molecular Devices, Sunnyvale, CA). Apoptosis Assays—TUNEL staining was performed using ApoAlert DNA fragmentation assay kits according to the manufacturer's directions. Stable Expression of Control and CREB siRNAs—Stable expression of siRNAs specific for luciferase or CREB was achieved by ligating the double-stranded DNA oligonucleotides specified in Table 1 into pSilencer 4.1 vectors. The luciferase oligonucleotide was inserted into pSilencer 4.1-CMVneo. A double-stranded oligonucleotide corresponding to CREB siRNA oligo B was inserted into pSilencer 4.1-CMVneo, and another corresponding to CREB siRNA oligo C was inserted into pSilencer 4.1-CMVpuro. The plasmids were transfected into 3T3-F442A cells as described above. Cells for stable depletion of CREB were transfected sequentially with both CREB siRNA expression plasmids and selected in both G418 (1 mg/ml) and puromycin (2 μg/ml). Cells transfected with the luciferase siRNA expression plasmid were selected in G418 alone. Large, rapidly growing colonies were isolated and pooled for implantation into athymic mice as described below. In Vivo Adipogenesis in Matrigel—3T3-F442A preadipocytes were stably transfected with plasmids for the constitutive expression of siRNA for luciferase (control) or CREB as described above. Cells were selected in appropriate antibiotic until large, rapidly growing colonies were present. Colonies were mixed and grown to 50-70% confluence on 10-cm plates. The cells were then infected with an adenovirus expressing green fluorescent protein (GFP) at a multiplicity of infection of 100. The next day, cells were trypsinized and recovered by centrifugation. The pellets (∼2 × 106 cells) were gently resuspended in 200 μl of low growth factor Matrigel at 4 °C. Female athymic mice were lightly anesthetized with Halothane, and the Matrigel/cell suspensions were injected subcutaneously into the abdomen anterior of the thigh. Fresh food, water, and clean cages with fresh bedding were provided every other day for a period of 2 or 4 weeks. Light was maintained on a 12-h cycle, and humidity was 40-45% with a temperature of 25-27 °C. The animals were monitored daily, and weight was checked once a week. The mice were then anesthetized with Halothane and euthanized by exsanguinations. The solid Matrigel plugs and adjacent skin and subcutaneous muscle were removed. The plugs were fixed overnight in 4% paraformaldehyde and then sliced in half with a razor blade. The halves were oriented in paraffin blocks with the cut surfaces up for sectioning. Five-micrometer sections were deparaffinized in HemoD and rehydrated in graded ethanol series. The sections were stained with hematoxylin and eosin for histological examination. Alternately deparaffinized sections were mounted with Permount for visualization of GFP. Chromatin Immunoprecipitation for CREB Promoter Binding—Chromatin immunoprecipitation assays for CREB binding to the PPARγ2 gene promoter were performed on 3T3-L1 cells treated with MDI for 48 h using kits from Upstate (Charlottesville, VA) according to their directions. The procedure was modified as described previously (19Zhang J.W. Klemm D.J. Vinson C. Lane M.D. J. Biol. Chem. 2004; 279: 4471-4478Abstract Full Text Full Text PDF PubMed Scopus (211) Google Scholar). Electrophoretic Mobility Shift Assays—Electrophoretic mobility shift assays and supershift assays were used to assess binding of CREB, ATF2, c-Jun, and CREM to the distal C/EBP β gene promoter CRE site. A double-stranded DNA oligonucleotide corresponding to the promoter from -117 to -96 with respect to the transcription start was used in the reactions, which were performed as described previously (19Zhang J.W. Klemm D.J. Vinson C. Lane M.D. J. Biol. Chem. 2004; 279: 4471-4478Abstract Full Text Full Text PDF PubMed Scopus (211) Google Scholar). Depletion of CREB/ATF1 Blocks 3T3-L1 Cell Adipogenesis in Culture—We previously reported that ectopic expression of constitutively active forms of CREB alone is sufficient to drive adipogenesis. Alternately ectopic expression of dominant negative forms of CREB blocked adipogenic conversion of 3T3-L1 cells treated with differentiation-inducing agents. To further explore the impact of CREB on adipocyte differentiation, we used specific siRNA as a means of depleting CREB in 3T3-L1 cells. We found that CREB-specific siRNA reduced CREB levels in 3T3-L1 preadipocytes to almost undetectable levels within 72 h of transfection (Fig. 1A). Although CREB levels began to increase 6 days after siRNA transfection, they never achieved levels measured in untreated cells or cells treated with control siRNA. CREB-specific siRNA also reduced levels of the related transcription factor ATF1 to undetectable levels over the same time course. CREB-specific siRNA did not affect the expression of other CRE-binding factors including ATF2, CREM (Fig. 1A), or c-Jun (data not shown). Cells transfected with control or CREB-specific siRNA were then treated with the differentiation-inducing mixture, MDI, to evaluate the loss of CREB and ATF1 on adipogenesis. PPARγ2 and C/EBP α expression were detected in control siRNAtreated cells beginning on day 3 after MDI exposure (Fig. 1A). PPARγ2 levels continued to increase over the 9-day differentiation period, whereas levels of C/EBP α peaked at day 6 and then declined slightly at day 9. The expression of these factors was delayed and the levels were much lower in CREB siRNA-treated cells. Levels of Pref-1, an inhibitor of adipogenesis, declined rapidly in cells transfected with control siRNA and treated with MDI. Pref-1 levels were elevated in CREB siRNA-treated cells before MDI exposure and remained elevated for at least 72 h after addition of these agents. Thereafter Pref-1 levels declined but were still detectable 6 days after MDI exposure. Unexpectedly loss of CREB/ATF1 had little impact on C/EBP β liver enriched activator protein or liver enriched inhibitory protein expression. The ability of CREB siRNA to inhibit adipogenic conversion was also apparent in Oil Red O-stained cell preparations. Although control siRNA-treated cells accumulated substantial levels of triglyceride, only minute lipid droplets were present in a small percentage of cells transfected with CREB siRNA (Fig. 1B). These data indicate that CREB and/or ATF1 is required for MDI-induced adipogenesis in culture. The expression of other CRE-binding proteins like ATF2 and c-Jun or their activation by extracellular signals is increased during the early stages of adipogenesis (21Lee M.Y. Kong H.J. Cheong J. Biochem. Biophys. Res. Commun. 2001; 281: 1241-1247Crossref PubMed Scopus (21) Google Scholar, 22MacDougald O.A. Lane M.D. Annu. Rev. Biochem. 1995; 64: 345-373Crossref PubMed Scopus (942) Google Scholar). Likewise CREM, another CREB family member, is expressed in preadipocytes (19Zhang J.W. Klemm D.J. Vinson C. Lane M.D. J. Biol. Chem. 2004; 279: 4471-4478Abstract Full Text Full Text PDF PubMed Scopus (211) Google Scholar). To determine whether these factors were required for adipogenic conversion, they were individually depleted via siRNA. Depletion of ATF2, c-Jun, and CREM was verified by Western blot assay (Fig. 2A). We found that loss of these factors had no significant effect on the conversion of preadipocytes to mature, lipid-filled adipocytes (Fig. 2B). Depletion of CREB/ATF1 Blocks 3T3-F442A Cell Adipogenesis in Vivo—Although the role of CREB in adipocyte differentiation and survival has been examined in cultured cells, its role in in vivo adipogenesis has not been explored. To begin to address this issue, we generated stably transfected 3T3-F442A preadipocytes constitutively expressing either control or CREB-specific siRNAs. These cells were implanted subcutaneously into athymic mice in low growth factor Matrigel plugs for a period of 2 or 4 weeks. During this time the plugs become vascularized such that proadipogenic factors produced by the recipient mice promote adipogenic conversion of the implanted cells. Twenty-four hours before their implantation, the cells were infected with an adenovirus from which GFP was constitutively expressed to follow their fate. As shown in Fig. 3A, cells expressing control siRNA formed substantial numbers of unilocular and multilocular adipocytes within the Matrigel plug 2 weeks after implantation. The number of adipocytes and the size of the lipid droplets increased slightly at the 4-week time point. That these adipocytes arose from the implanted cells is evident by their GFP fluorescence (Fig. 3B). However, cells expressing CREB siRNA failed to form adipocytes at either time point (Fig. 3A). No significant differences in cell survival were detected by TUNEL staining of the plug sections (data not shown). These results indicate that the role of CREB in adipogenesis extends to the in vivo formation of adipocytes. Depletion of CREB/ATF1 Blocks Adipogenesis of 3T3-L1 Cells Expressing C/EBP α, C/EBP β, or PPARγ—Ectopic overexpression of C/EBP α or β or PPARγ alone is sufficient to promote adipogenic conversion and increase or accelerate adipogenesis in cells treated with MDI (8Rosen E.D. Spiegelman B.M. Annu. Rev. Cell Dev. Biol. 2000; 16: 145-171Crossref PubMed Scopus (1053) Google Scholar). The goal of subsequent experiments was to determine whether loss of CREB/ATF1 could block the proadipogenic activities of these master regulators. We generated stably transfected 3T3-L1 cells constitutively expressing C/EBP β, C/EBP α, or PPARγ2. These cells were then transfected with control or CREB-specific siRNA and then left untreated or treated with MDI. Adipogenic conversion of these cells was measured by the appearance of Oil Red-staining lipid droplets and by the appearance of adipocyte markers. As shown previously, CREB siRNA blocked MDI-induced lipid accumulation and prevented the modest lipid accumulation detected in control siRNA-transfected cells in the absence of MDI (Fig. 4A). In cells expressing C/EBP α or β or PPARγ and transfected with control siRNA, a small percentage of cells exhibited substantial lipid accumulation even in the absence of MDI. With MDI, these cells showed normal or slightly higher than normal levels of lipid content. Cells expressing both PPARγ2 and C/EBP α and treated with control siRNA exhibited substantial lipid accumulation regardless of MDI exposure. However, lipid droplets were greatly diminished in CREB/ATF1-depleted cells expressing C/EBP β or PPARγ2 with or without MDI. Loss of CREB/ATF1 also reduced uninduced or MDI-induced lip" @default.
• W2080395830 created "2016-06-24" @default.
• W2080395830 creator A5028112061 @default.
• W2080395830 creator A5033586424 @default.
• W2080395830 creator A5049391728 @default.
• W2080395830 creator A5061410522 @default.
• W2080395830 creator A5080485212 @default.
• W2080395830 creator A5090398738 @default.
• W2080395830 date "2006-12-01" @default.
• W2080395830 modified "2023-10-13" @default.
• W2080395830 title "Depletion of cAMP-response Element-binding Protein/ATF1 Inhibits Adipogenic Conversion of 3T3-L1 Cells Ectopically Expressing CCAAT/Enhancer-binding Protein (C/EBP) α, C/EBP β, or PPARγ2" @default.
• W2080395830 cites W1510986852 @default.
• W2080395830 cites W1813044481 @default.
• W2080395830 cites W1965722126 @default.
• W2080395830 cites W1973882490 @default.
• W2080395830 cites W1980508602 @default.
• W2080395830 cites W1984900499 @default.
• W2080395830 cites W1987341521 @default.
• W2080395830 cites W1997490378 @default.
• W2080395830 cites W2003311380 @default.
• W2080395830 cites W2013376255 @default.
• W2080395830 cites W2018136707 @default.
• W2080395830 cites W2019434204 @default.
• W2080395830 cites W2029094183 @default.
• W2080395830 cites W2043129312 @default.
• W2080395830 cites W2054910860 @default.
• W2080395830 cites W2055094070 @default.
• W2080395830 cites W2065667627 @default.
• W2080395830 cites W2073998126 @default.
• W2080395830 cites W2075152260 @default.
• W2080395830 cites W2077427931 @default.
• W2080395830 cites W2083161103 @default.
• W2080395830 cites W2085101134 @default.
• W2080395830 cites W2085952650 @default.
• W2080395830 cites W2092383168 @default.
• W2080395830 cites W2097899015 @default.
• W2080395830 cites W2111966501 @default.
• W2080395830 cites W2129138669 @default.
• W2080395830 cites W2148244700 @default.
• W2080395830 cites W2149628530 @default.
• W2080395830 cites W2165426462 @default.
• W2080395830 cites W2176176727 @default.
• W2080395830 cites W4237207968 @default.
• W2080395830 doi "https://doi.org/10.1074/jbc.m605077200" @default.
• W2080395830 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17071615" @default.
• W2080395830 hasPublicationYear "2006" @default.
• W2080395830 type Work @default.
• W2080395830 sameAs 2080395830 @default.
• W2080395830 citedByCount "101" @default.
• W2080395830 countsByYear W20803958302012 @default.
• W2080395830 countsByYear W20803958302013 @default.
• W2080395830 countsByYear W20803958302014 @default.
• W2080395830 countsByYear W20803958302015 @default.
• W2080395830 countsByYear W20803958302016 @default.
• W2080395830 countsByYear W20803958302017 @default.
• W2080395830 countsByYear W20803958302018 @default.
• W2080395830 countsByYear W20803958302019 @default.
• W2080395830 countsByYear W20803958302020 @default.
• W2080395830 countsByYear W20803958302021 @default.
• W2080395830 countsByYear W20803958302022 @default.
• W2080395830 countsByYear W20803958302023 @default.
• W2080395830 crossrefType "journal-article" @default.
• W2080395830 hasAuthorship W2080395830A5028112061 @default.
• W2080395830 hasAuthorship W2080395830A5033586424 @default.
• W2080395830 hasAuthorship W2080395830A5049391728 @default.
• W2080395830 hasAuthorship W2080395830A5061410522 @default.
• W2080395830 hasAuthorship W2080395830A5080485212 @default.
• W2080395830 hasAuthorship W2080395830A5090398738 @default.
• W2080395830 hasBestOaLocation W20803958301 @default.
• W2080395830 hasConcept C104317684 @default.
• W2080395830 hasConcept C111936080 @default.
• W2080395830 hasConcept C122927707 @default.
• W2080395830 hasConcept C142536801 @default.
• W2080395830 hasConcept C149240914 @default.
• W2080395830 hasConcept C153911025 @default.
• W2080395830 hasConcept C185592680 @default.
• W2080395830 hasConcept C202751555 @default.
• W2080395830 hasConcept C29512474 @default.
• W2080395830 hasConcept C55493867 @default.
• W2080395830 hasConcept C86339819 @default.
• W2080395830 hasConcept C86803240 @default.
• W2080395830 hasConcept C95444343 @default.
• W2080395830 hasConceptScore W2080395830C104317684 @default.
• W2080395830 hasConceptScore W2080395830C111936080 @default.
• W2080395830 hasConceptScore W2080395830C122927707 @default.
• W2080395830 hasConceptScore W2080395830C142536801 @default.
• W2080395830 hasConceptScore W2080395830C149240914 @default.
• W2080395830 hasConceptScore W2080395830C153911025 @default.
• W2080395830 hasConceptScore W2080395830C185592680 @default.
• W2080395830 hasConceptScore W2080395830C202751555 @default.
• W2080395830 hasConceptScore W2080395830C29512474 @default.
• W2080395830 hasConceptScore W2080395830C55493867 @default.
• W2080395830 hasConceptScore W2080395830C86339819 @default.
• W2080395830 hasConceptScore W2080395830C86803240 @default.
• W2080395830 hasConceptScore W2080395830C95444343 @default.
• W2080395830 hasIssue "52" @default.
• W2080395830 hasLocation W20803958301 @default.
• W2080395830 hasOpenAccess W2080395830 @default.

• next