FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2080521229> ?p ?o ?g. }

• W2080521229 endingPage "27049" @default.
• W2080521229 startingPage "27039" @default.
• W2080521229 abstract "U2 small nuclear ribonucleoprotein auxiliary factor small subunit (U2AF35) is encoded by a conserved gene designated U2AF1. Here we provide evidence for the existence of alternative vertebrate transcripts encoding different U2AF35 isoforms. Three mRNA isoforms (termed U2AF35a–c) were produced by alternative splicing of the human U2AF1 gene. U2AF35c contains a premature stop codon that targets the resulting mRNA to nonsense-mediated mRNA decay. U2AF35b differs from the previously described U2AF35a isoform in 7 amino acids located at the atypical RNA Recognition Motif involved in dimerization with U2AF65. Biochemical experiments indicate that isoform U2AF35b, which has been highly conserved from fish to man, maintains the ability to interact with U2AF65, stimulates U2AF65 binding to a pre-mRNA, and promotes U2AF splicing activity in vitro. Real time, quantitative PCR analysis indicates that U2AF35a is the most abundant isoform expressed in murine tissues, although the ratio between U2AF35a and U2AF35b varies from 10-fold in the brain to 20-fold in skeletal muscle. We propose that post-transcriptional regulation of U2AF1 gene expression may provide a mechanism by which the relative cellular concentration and availability of U2AF35 protein isoforms are modulated, thus contributing to the finely tuned control of splicing events in different tissues. U2 small nuclear ribonucleoprotein auxiliary factor small subunit (U2AF35) is encoded by a conserved gene designated U2AF1. Here we provide evidence for the existence of alternative vertebrate transcripts encoding different U2AF35 isoforms. Three mRNA isoforms (termed U2AF35a–c) were produced by alternative splicing of the human U2AF1 gene. U2AF35c contains a premature stop codon that targets the resulting mRNA to nonsense-mediated mRNA decay. U2AF35b differs from the previously described U2AF35a isoform in 7 amino acids located at the atypical RNA Recognition Motif involved in dimerization with U2AF65. Biochemical experiments indicate that isoform U2AF35b, which has been highly conserved from fish to man, maintains the ability to interact with U2AF65, stimulates U2AF65 binding to a pre-mRNA, and promotes U2AF splicing activity in vitro. Real time, quantitative PCR analysis indicates that U2AF35a is the most abundant isoform expressed in murine tissues, although the ratio between U2AF35a and U2AF35b varies from 10-fold in the brain to 20-fold in skeletal muscle. We propose that post-transcriptional regulation of U2AF1 gene expression may provide a mechanism by which the relative cellular concentration and availability of U2AF35 protein isoforms are modulated, thus contributing to the finely tuned control of splicing events in different tissues. In higher eukaryotes, most protein-coding genes contain sequences that are spliced from the nascent transcripts (pre-mRNAs) in the nucleus. Intron excision is carried out by an assembly of small nuclear RNAs and proteins that are collectively recruited to pre-mRNAs forming the spliceosome (reviewed in Ref. 1Jurica M.S. Moore M.J. Mol. Cell. 2003; 12: 5-14Abstract Full Text Full Text PDF PubMed Scopus (783) Google Scholar). Although introns are excised with a high degree of precision, for many pre-mRNAs there is flexibility in the choice of alternative splice sites, often in response to tissue-specific, physiologically or developmentally regulated states. Alternative splicing produces multiple mRNAs encoding distinct proteins, thus expanding the coding capacity of genes and contributing to the proteomic complexity of higher organisms (2Maniatis T. Tasic B. Nature. 2002; 418: 236-243Crossref PubMed Scopus (593) Google Scholar, 3Brett D. Pospisil H. Valcarcel J. Reich J. Bork P. Nat. Genet. 2002; 30: 29-30Crossref PubMed Scopus (391) Google Scholar, 4Black D.L. Annu. Rev. Biochem. 2003; 72: 291-336Crossref PubMed Scopus (1935) Google Scholar). Moreover, alternative splicing may contribute to regulate protein expression by generating premature termination codons that target the transcript to nonsense-mediated mRNA decay (5Lewis B.P. Green R.E. Brenner S.E. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 189-192Crossref PubMed Scopus (742) Google Scholar). In metazoans, pre-mRNA sequences implicated in splicing are only weakly conserved. Multiple, relatively weak protein-protein and protein-RNA interactions involving these sequences and additional regulatory sequence elements, which can positively or negatively affect spliceosome assembly at nearby splice sites, constitute the basis to control alternative splicing (for recent reviews see Refs. 4Black D.L. Annu. Rev. Biochem. 2003; 72: 291-336Crossref PubMed Scopus (1935) Google Scholar, 6Graveley B.R. Cell. 2002; 109: 409-412Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar, and 7Caceres J.F. Kornblihtt A.R. Trends Genet. 2002; 18: 186-193Abstract Full Text Full Text PDF PubMed Scopus (530) Google Scholar). Proteins that bind to pre-mRNA and affect splicing regulation include SR proteins, hnRNPs, 1The abbreviations used are: hnRNP, heterogeneous nuclear; snRNP, small nuclear ribonucleoprotein; RRM, RNA recognition motif; NMD, nonsense-mediated mRNA decay; UTR, untranslated region; NTA, nitrilotriacetic acid; GST, glutathione S-transferase; siRNA, small interfering RNA; GFP, green fluorescent protein; AdML, adenovirus major late.1The abbreviations used are: hnRNP, heterogeneous nuclear; snRNP, small nuclear ribonucleoprotein; RRM, RNA recognition motif; NMD, nonsense-mediated mRNA decay; UTR, untranslated region; NTA, nitrilotriacetic acid; GST, glutathione S-transferase; siRNA, small interfering RNA; GFP, green fluorescent protein; AdML, adenovirus major late. and tissue- or developmental stage-specific factors. Individual SR proteins interact only weakly with enhancer elements, but their binding to pre-mRNA is highly cooperative and can lead to recognition of distinct RNA sequence motifs, thus contributing to the selection of regulated splice sites. A distinct role is played by hnRNP proteins, which in general antagonize the stimulatory activity of SR proteins, and cell type-specific proteins, which may either inhibit or promote splicing. Thus, control of alternative splicing is achieved through the combinatorial interplay of both regulatory sequence signals and trans-acting protein factors (4Black D.L. Annu. Rev. Biochem. 2003; 72: 291-336Crossref PubMed Scopus (1935) Google Scholar, 8Smith C.W. Valcarcel J. Trends Biochem. Sci. 2000; 25: 381-388Abstract Full Text Full Text PDF PubMed Scopus (747) Google Scholar, 9Roberts G.C. Smith C.W. Curr. Opin. Chem. Biol. 2002; 6: 375-383Crossref PubMed Scopus (110) Google Scholar). The spliceosome is a multicomponent RNA-protein machine containing five uracil-rich small nuclear ribonucleoproteins (U snRNPs) and many non-snRNP protein splicing factors. In the late 1990s ∼100 splicing factors were identified (10Burge C.B. Tuschl T.H. Sharp P.A. Gesteland R.F. Cech T.R. Atkins J.F. The RNA World. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1999: 525-560Google Scholar), and since then the number has nearly doubled (1Jurica M.S. Moore M.J. Mol. Cell. 2003; 12: 5-14Abstract Full Text Full Text PDF PubMed Scopus (783) Google Scholar). Initiation of spliceosome recruitment to a pre-mRNA involves recognition of the 5′ splice site by the U1 snRNP, whereas the U2 snRNP associates with the 3′ region of the intron. The establishment of a stable interaction between U2 snRNP and pre-mRNA requires an auxiliary factor, U2AF (11Ruskin B. Zamore P.D. Green M.R. Cell. 1988; 52: 207-219Abstract Full Text PDF PubMed Scopus (338) Google Scholar). The U2 snRNP auxiliary factor (U2AF) consists of two subunits, U2AF65 and U2AF35, that interact to form a stable heterodimer (12Zamore P.D. Green M.R. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 9243-9247Crossref PubMed Scopus (276) Google Scholar). U2AF65 binds directly to the polypyrimidine tract of pre-mRNA and is essential for splicing (13Zamore P.D. Patton J.G. Green M.R. Nature. 1992; 355: 609-614Crossref PubMed Scopus (457) Google Scholar). U2AF35 recognizes the conserved 3′ splice site dinucleotide AG (14Merendino L. Guth S. Bilbao D. Martinez C. Valcarcel J. Nature. 1999; 402: 838-841Crossref PubMed Scopus (219) Google Scholar, 15Zorio D.A. Blumenthal T. Nature. 1999; 402: 835-838Crossref PubMed Scopus (190) Google Scholar, 16Wu S. Romfo C.M. Nilsen T.W. Green M.R. Nature. 1999; 402: 832-835Crossref PubMed Scopus (239) Google Scholar) and is required for splicing of a subset of primary transcripts, the so-called AG-dependent pre-mRNAs (17Guth S. Martinez C. Gaur R.K. Valcarcel J. Mol. Cell. Biol. 1999; 19: 8263-8271Crossref PubMed Scopus (72) Google Scholar). Human U2AF35 is 240 residues long, with an atypical RNA recognition motif (RRM) involved in dimerization with U2AF65 (18Kielkopf C.L. Rodionova N.A. Green M.R. Burley S.K. Cell. 2001; 106: 595-605Abstract Full Text Full Text PDF PubMed Scopus (165) Google Scholar). Additionally, the protein contains a C-terminal arginine/serine (RS)-rich domain interrupted by glycines (19Zhang M. Zamore P.D. Carmo-Fonseca M. Lamond A.I. Green M.R. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 8769-8773Crossref PubMed Scopus (163) Google Scholar). The RS region of U2AF35 has been shown to establish protein-protein interactions with splicing factors of the SR family, and it was proposed that SR proteins bound to purine-rich exonic splicing enhancers facilitate recruitment of U2AF65 to the polypyrimidine tract via bridging interactions mediated by U2AF35 (20Blencowe B.J. Trends Biochem. Sci. 2000; 25: 106-110Abstract Full Text Full Text PDF PubMed Scopus (530) Google Scholar, 21Graveley B.R. RNA (New York). 2000; 6: 1197-1211Crossref PubMed Scopus (871) Google Scholar, 22Graveley B.R. Hertel K.J. Maniatis T. RNA (New York). 2001; 7: 806-818Crossref PubMed Scopus (101) Google Scholar). Other results, however, argue that the RS domain-mediated interactions with SR proteins bound to the exonic splicing enhancers is dispensable for the function of U2AF35 in AG-dependent pre-mRNA splicing (23Guth S. Tange T.O. Kellenberger E. Valcarcel J. Mol. Cell. Biol. 2001; 21: 7673-7681Crossref PubMed Scopus (55) Google Scholar). Although interaction of U2AF35 with the 3′ splice site AG can stabilize U2AF65 binding, not all the activities of U2AF35 correlate with increased cross-linking of U2AF65 to the polypyrimidine tract, suggesting an additional, yet unknown function for U2AF35 in pre-mRNA splicing (23Guth S. Tange T.O. Kellenberger E. Valcarcel J. Mol. Cell. Biol. 2001; 21: 7673-7681Crossref PubMed Scopus (55) Google Scholar). In this work we show that primary transcripts encoding U2AF35 splicing factor in higher vertebrates can be alternatively spliced and polyadenylated. Alternative splicing of U2AF35 pre-mRNAs may either introduce a premature stop codon that targets the resulting mRNA to nonsense-mediated mRNA decay (NMD) or alter 7 amino acid residues within the RRM domain. This alteration gives rise to a protein isoform that maintains the ability to bind U2AF65 and stimulates splicing activity in vitro. Most interestingly, the two U2AF35 protein isoforms have been under high selective pressure during evolution, suggesting that they play specific functions in vertebrate organisms. Our results further show that the relative abundance of mRNAs encoding each U2AF35 isoform differs between cell types, arguing that expression of the U2AF1 gene is controlled in a tissue-specific manner. Isolation and Characterization of Chicken U2AF1 cDNA— Degenerate oligonucleotides were designed to regions of U2AF35 cDNA conserved among Homo sapiens, Drosophila melanogaster, and Schizosaccharomyces pombe. The forward PCR primer (5′-AAGATHGGIGCITGYCGICAYGC-3′) was designed from amino acids 23 to 30 of human U2AF35. The reverse PCR primer (5′-TCRTAYTGICGRCAIGCYTC-3′) was designed to be complementary to the region encoding from amino acids 152 to 160. PCR was carried out with a pool of random chicken embryo cDNA molecules as template. A Biometra® UNO II thermocycler (Germany) was used, and the conditions for amplification were as follows: 94 °C for 5 min, followed by 40 cycles of denaturation at 94 °C for 30 s, annealing at 54 °C for 2 min, and extension at 72 °C for 1 min, with a time increment of 1 s per cycle, and finally 72 °C for 30 min. The PCR product was gel-purified using QIAEX II Gel Extraction Kit (Qiagen) and subcloned into pBluescript II KS (+/–) by “TA cloning” (24Marchuk D. Drumm M. Saulino A. Collins F.S. Nucleic Acids Res. 1991; 19: 1154Crossref PubMed Scopus (1125) Google Scholar). This 392-bp chicken U2AF35 cDNA fragment (PCR35) was random prime-labeled with [α-32P]dCTP using the Prime-it® II Random Primer Labeling kit (Stratagene®) and used to screen a chicken embryo cDNA library constructed in λZAP II (Stratagene®). Approximately 1.5 × 106 plaques were screened, and five positive plaques were isolated. cDNA inserts in pBluescript II KS phagemid were excised in vivo using the ExAssist/SOLR System (Stratagene®), purified, analyzed by restriction digest, and completely sequenced. Cloning of Chicken U2AF1 Gene—The chicken U2AF35 cDNA fragment PCR35 was random prime labeled and used to screen a DT40 cell line genomic library constructed in LambdaGEM®-11 (Promega), using standard procedures (25Kaiser K. Murray N.E. Whittaker P.A. Glover D.M. Hames B.D. DNA Cloning: A Practical Approach. I. IRL Press at Oxford University Press, Oxford1995: 37-82Google Scholar). From 1.2 × 106 plaques, six positive clones were isolated. Phage DNAs were purified and analyzed by restriction endonuclease mapping and Southern blotting (26Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989: 7.39, 9.31-7.52, 9.59Google Scholar). Genomic fragments were subcloned into pBluescript II KS, and an 18-kb region covering the entire chicken U2AF1 gene was sequenced. Sequencing—Cycle sequencing of plasmid DNA was performed with the AmpliTaqFS Dye Primer Core kit (Applied Biosystems), using 1 μg of plasmid DNA and 3 pmol of each standard forward and reverse primers labeled with fluorescein isothiocyanate or CY5. An MJ Research (Waltham, MA) PT-200 cycler was used for 35 cycles (97 °C, 15 s; 55 °C, 30 s; 68 °C, 30 s). Reactions were loaded “off-gel” on 72-clone porous-membrane combs, applied to 60-cm long polyacrylamide gels (4.5% Hydrolink Long Ranger gel solution, FMC BioProducts), and analyzed on the ARAKIS sequencing system with array detectors, developed at EMBL (27Erfle H. Ventzki R. Voss H. Rechmann S. Benes V. Stegemann J. Ansorge W. Nucleic Acids Res. 1997; 25: 2229-2230Crossref PubMed Scopus (20) Google Scholar). Raw sequencing data were evaluated and analyzed, and the consensus sequence was assembled by using the software packages (Lane Tracker and Gene Skipper) developed at EMBL. Remaining sequencing gaps were covered by primer walking (28Voss H. Wiemann S. Grothues D. Sensen C. Zimmermann J. Schwager C. Stegemann J. Erfle H. Rupp T. Ansorge W. BioTechniques. 1993; 15: 714-721PubMed Google Scholar). Cell Culture—DT40 cells (ATCC CRL-2111) were grown in Dulbecco's modified Eagle's medium (Invitrogen) supplemented as recommended by the American Type Culture Collection. HeLa cells (ECACC 93021013) were grown in minimum essential medium with Earle's salts supplemented with 10% (v/v) fetal calf serum and 1% (v/v) nonessential amino acids (Invitrogen). Northern Blotting—Total RNA was extracted from either DT40 cells or chicken embryos using the TRIzol® reagent (Invitrogen). Poly(A) RNA was isolated using oligo(dT)-cellulose (Amersham Biosciences), electrophoresed on an agarose-formaldehyde gel, and transferred to an Hybond-N+ membrane (Amersham Biosciences) (26Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989: 7.39, 9.31-7.52, 9.59Google Scholar). Hybridizations were carried out with the following probes: (a) chicken U2AF35 cDNA fragment PCR35; (b) a 1175-bp XbaI/XbaI (2403–3578) fragment obtained by restriction digest of pBluescript-chU2AF35III (a class III clone); additionally, a probe complementary to chicken β-actin was used as an internal control. Probes were gel-purified and labeled with [α-32P]dCTP by random priming. Pre-hybridization (30 min) and hybridization (1 h) were carried out at 68 °C in ExpressHyb Solution (Clontech). Following hybridization, washing was performed in 2× SSC, 0.05% SDS (three times 10 min at room temperature), and 0.1× SSC, 0.1% SDS (two times at 50 °C). Filters were exposed to a Kodak Biomax-MR film (Eastman Kodak Co.), with intensifying screens, at –70 °C. Autoradiograms were analyzed using the software package ONE-Dscan™, version 1.0 (Scanalytics, a Division of CSPI). NMD Inhibition and Reverse Transcriptase-PCR—RNA interference of Upf1 was carried out as described previously (29Wollerton M.C. Gooding C. Wagner E.J. Garcia-Blanco M.A. Smith C.W. Mol. Cell. 2004; 13: 91-100Abstract Full Text Full Text PDF PubMed Scopus (303) Google Scholar). Briefly, for a typical siRNA transfection, 24-well dishes were seeded with 105 cells prior to transfection. The following day (day 2) 120 pmol of siRNA duplex was transfected using 3 μl of LipofectAMINE® 2000 (Invitrogen) as described previously (30Wagner E.J. Garcia-Blanco M.A. Mol. Cell. 2002; 10: 943-949Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar). On day 3 cells were trypsinized and split to a well of a 6-well plate. On day 4 cells were retransfected with siRNA duplex as on day 2, and finally, cells were harvested on day 6. mRNA targets for gene specific knockdown were UPF1: AAGAUGCAGUUCCGCUCCAUU (31Mendell J.T. ap Rhys C.M. Dietz H.C. Science. 2002; 298: 419-422Crossref PubMed Scopus (220) Google Scholar) and control C2: AAGGUCCGGCUCCCCCAAAUG (30Wagner E.J. Garcia-Blanco M.A. Mol. Cell. 2002; 10: 943-949Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar). Gene silencing was monitored by immunoblotting. Total RNA was isolated with the TRIzol® reagent (Invitrogen) and treated with RQ1 RNase-free DNase (Promega). Reverse transcriptase reactions were primed with oligo(dT) by using Superscript II RT enzyme (Invitrogen). The resulting cDNA was amplified with primers BothFor, 5′-GCACAATAAACCGACGTTTAGCCAG-3′, and BothRev, 5′-TGGATCGGCTGTCCATTAAACCAAC-3′ (exons 2–4, Fig. 4). The amplification products were digested with HinfI, separated by gel electrophoresis, and detected by ethidium bromide staining. Expression and Purification of Recombinant Proteins—Full-length human U2AF35a cDNA was used to screen a Uni-ZAP®XR Human Fetal Spleen λ cDNA library (Stratagene®). Positive clones were analyzed by restriction digestion with HinfI and sequenced in order to isolate U2AF35b cDNA clones. U2AF35b cDNA was subsequently cloned into NcoI/KpnI sites of pFastBac™ HT plasmid, and recombinant baculoviruses were generated by using the Bac-to-Bac® Baculovirus Expression System (Invitrogen). His6-tagged U2AF35a and U2AF35b proteins were purified from baculovirus-infected cells as described previously (32Zuo P. Maniatis T. Genes Dev. 1996; 10: 1356-1368Crossref PubMed Scopus (245) Google Scholar) and dialyzed against 100 mm KCl buffer D (20 mm HEPES (pH 8.0), 0.5 mm EDTA, 20% glycerol, 1 mm dithiothreitol, 0.05% Nonidet P-40). U2AF65 and U2AF65Δ35 were expressed as glutathione S-transferase (GST) fusion proteins in Escherichia coli and purified as described previously (33Lin Y.-S. Green M.R. Cell. 1991; 64: 971-981Abstract Full Text PDF PubMed Scopus (366) Google Scholar). The plasmids used for protein expression were described previously (13Zamore P.D. Patton J.G. Green M.R. Nature. 1992; 355: 609-614Crossref PubMed Scopus (457) Google Scholar, 34Fleckner J. Zhang M. Valcarcel J. Green M.R. Genes Dev. 1997; 11: 1864-1872Crossref PubMed Scopus (206) Google Scholar). The purified proteins were dialyzed against 100 mm KCl buffer D. Protein concentrations were estimated by comparing dilutions of the preparations to serial dilutions of a bovine serum albumin standard in SDS-containing denaturing gels. Construction and Expression of GFP Fusion Proteins—Green fluorescent protein (GFP) fusion constructs were obtained by restriction digestion and subcloning into the appropriate pEGFP-C vector (Clontech). GFP-U2AF35a was described previously (35Gama-Carvalho M. Carvalho M.P. Kehlenbach A. Valcarcel J. Carmo-Fonseca M. J. Biol. Chem. 2001; 276: 13104-13112Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar). GFP-U2AF35b was constructed by digestion of pBS-U2AF35b with BglII followed by fill-in and PstI digestion. The insert was then cloned into PstI/SmaI sites of pEGFP-C3. HeLa cells were transfected and analyzed by confocal microscopy as described previously (35Gama-Carvalho M. Carvalho M.P. Kehlenbach A. Valcarcel J. Carmo-Fonseca M. J. Biol. Chem. 2001; 276: 13104-13112Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar). In Vitro Binding Assays—GST pull-down assays were carried out using 1 μg of GST-U2AF65 or GST-U2AF65Δ35 fusion proteins immobilized on 10 μl of glutathione S-Sepharose 4B beads (Amersham Biosciences) and incubating with 5 μl of a standard [35S]methionine-labeled rabbit reticulocyte RNase-A-treated lysate reaction (TnT T7 kit; Promega). Incubation was carried out in 20 mm HEPES (pH 7.5), 100 mm NaCl, 0.5% Nonidet P-40, 5 mm MgCl2, 0.1 mm EDTA, 100 μg/ml bovine serum albumin, 1 mm dithiothreitol, for 2 h at 4 °C. After extensive washing of the beads, proteins were eluted by boiling in SDS-loading dye, electrophoresed on SDS-10% polyacrylamide gels, and visualized by autoradiography. Alternatively, 0.5 μg of GST-U2AF65 or GST-U2AF65Δ35 was incubated with 0.5 μg of His-U2AF35a or His-U2AF35b in 50 mm Tris-HCl (pH 7.5), 200 mm NaCl, 0.5% Nonidet P-40, on ice, for 15 min. Then 10 μl of Ni2+-NTA-agarose beads (Qiagen) was added, and incubation was continued at 4 °C for 1 h. Beads were washed three times with 50 mm Tris-HCl (pH 7.5), 200 mm NaCl, 15 mm imidazole and resuspended in 15 μl of SDS-loading dye. Proteins were resolved on SDS-PAGE, transferred to nitrocellulose, and probed by Western blotting with anti-U2AF65 monoclonal antibody MC3 (36Gama-Carvalho M. Krauss R.D. Chiang L. Valcarcel J. Green M.R. Carmo-Fonseca M. J. Cell Biol. 1997; 137: 975-987Crossref PubMed Scopus (109) Google Scholar) and anti-U2AF35 polyclonal serum. Immunoblots were developed using horseradish peroxidase-coupled secondary antibodies and detected by enhanced chemiluminescence (ECL; Amersham Biosciences). UV Cross-linking—U15CAG oligo RNA was 5′ end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4 polynucleotide kinase (New England Biolabs). RNA-protein binding reactions were assembled in buffer D, with 2 mg/ml tRNA, 0.5 μm purified GST-U2AF65, and His-tagged U2AF35a or U2AF35b, and ∼50,000 cpm 32P-labeled RNA in a final volume of 20 μl. After a 15-min incubation on ice, samples were UV cross-linked (Stratalinker; 254 nm, 0.6 J, 4-cm distance to light source) and then treated with RNase A (final concentration, 1 mg/ml) at 37 °C for 20 min. Samples were mixed with SDS-loading dye, boiled for 5 min, and loaded on an SDS-10% polyacrylamide gel. The gel was fixed and dried, and cross-linked proteins were detected by autoradiography. In Vitro Splicing Assays—HeLa nuclear extract was prepared as described by Dignam et al. (37Dignam J. Lebovitz R. Roeder R. Nucleic Acids Res. 1983; 11: 1475-1489Crossref PubMed Scopus (9132) Google Scholar) and depleted of U2AF exactly as described (38Valcarcel J. Martinez C. Green M.R. Richter J.D. mRNA Formation and Function. Academic Press, New York1997: 31-53Crossref Google Scholar) by passing the extract over an oligo(dT)-cellulose column at 1 m KCl. The column flow-through of this procedure yielded the depleted nuclear extract (odTΔNE). Transcription templates were generated by PCR using plasmids harboring the sequence of AdML (39Watakabe A. Tanaka K. Shimura Y. Genes Dev. 1993; 7: 407-418Crossref PubMed Scopus (307) Google Scholar, 40Zillmann M. Zapp M. Berget S. Mol. Cell. Biol. 1988; 8: 814-821Crossref PubMed Scopus (135) Google Scholar) preceded by an SP6 promoter. Full-length substrates were transcribed in the presence of a CAP analogue (m7G(5′)ppp(5′)G, New England Biolabs) and [α-32P]UTP (Amersham Biosciences) as described (17Guth S. Martinez C. Gaur R.K. Valcarcel J. Mol. Cell. Biol. 1999; 19: 8263-8271Crossref PubMed Scopus (72) Google Scholar). After a 2-h incubation at 37 °C, the transcripts were gel-purified, ethanol-precipitated, and resuspended in water. Splicing reactions and splicing complementation assays were performed as described previously (17Guth S. Martinez C. Gaur R.K. Valcarcel J. Mol. Cell. Biol. 1999; 19: 8263-8271Crossref PubMed Scopus (72) Google Scholar). Spliced products were resolved on 13% denaturing polyacrylamide gels in Tris/borate/EDTA buffer (TBE) and analyzed by autoradiography. Real Time Quantitative PCR—Total RNA was extracted from a variety of murine tissues (brain, heart, lung, and skeletal muscle) using the TRIzol® reagent (Invitrogen) and treated with RNase-free DNase I (Roche Diagnostics). The concentration of RNA was determined by spectrophotometry, and RNA quality was assessed by gel electrophoresis. Only samples yielding distinct 28 S and 18 S bands and A260/A280 ratios between 1.8 and 2.1 were further used. Production of cDNA was carried out using Superscript II reverse transcriptase (Invitrogen). TaqMan® Minor Groove Binder probes and primers (Table I) were designed by using the computer software Primer Express (Applied Biosystems, Foster City, CA). Primer and probe concentrations were optimized for each amplicon using Mouse Universal RNA (Invitrogen) as a template. The values obtained for each set of primers and probe are listed in Table I. For 18 S quantification we used a pre-developed assay (D64333760, Applied Biosystems, Foster City, CA). All reactions were performed in the ABI7000 Sequence Detector (Applied Biosystems, Foster City, CA). The relative expression of each gene in murine tissues was calculated using a derivative of the 2(–ΔΔC(t)) method, as described (41Schmittgen T.D. Teske S. Vessela R.L. True L.D. Zakrajsek B.A. Int. J. Cancer. 2003; 107: 323-329Crossref PubMed Scopus (66) Google Scholar). To validate the use of the 2–ΔCt method, serial dilutions of cDNA prepared from Mouse Universal RNA were amplified by real time PCR using gene-specific primers and fluorogenic probes for U2AF35a, U2AF35b, U2AF65, and 18 S rRNA. All the analyzed transcripts exhibited high linearity amplification plots (r2 > 0.98) (data not shown). The slopes of the Ct versus the log RNA quantity were –3.36, –3.27, –3.28, and –3.27 for U2AF35a, U2AF35b, U2AF65, and 18 S rRNA, respectively. The similarity of these slopes clearly shows that the PCR efficiencies for these genes are similar. Also when doing ΔCt plots versus log RNA quantities for each pair of genes, the slope was approximately equal to 0, further confirming that the expression of each of these genes can be directly compared with one another.Table ISequence of primers and TaqMan® MGB probes used in the quantitative real time reverse transcriptase-PCRGenePrimers and probes sequencesConcentration in reactionAmplicon sizenmbpU2AF35aForward, 5′-TAGCCAGACCATTGCCTCTT-3′900Reverse, 5′-CGCAAACCGTCAGCAGACT3′90072Probe, FAM-5′-AACATTTACCGTAACCCT3′-MGB150U2AF35bForward, 5′-TCCCCAAAACAGTGCACAGA3′900Reverse, 5′-TCATCATAGTGCTCCTGCATCTC3′90078Probe, FAM-5′-GGCTCACACTGTGCTG3′-MGB150U2AF65Forward, 5′-ACATCACCCCAATGCAGTACAA3′300Reverse, 5′-AGGGCAGTGGCTGGAATCT3′30061Probe, FAM-5′-ACCCGCAGCTTGCATG3′-MGB200 Open table in a new tab Sequence Analysis—BLAST searches (42Altschul S.F. Madden T.L. Schaffer A.A. Zhang J. Zhang Z. Miller W. Lipman D.J. Nucleic Acids Res. 1997; 25: 3389-3402Crossref PubMed Scopus (58771) Google Scholar) were carried out on NCBI data bases (National Center for Biotechnology Information, www.ncbi.nlm.nih.gov/blast) and on the Mouse, Fugu, and Danio rerio Ensembl genomic sequence data bases (43Hubbard T. Barker D. Birney E. Cameron G. Chen Y. Clark L. Cox T. Cuff J. Curwen V. Down T. Durbin R. Eyras E. Gilbert J. Hammond M. Huminiecki L. Kasprzyk A. Lehvaslaiho H. Lijnzaad P. Melsopp C. Mongin E. Pettett R. Pocock M. Potter S. Rust A. Schmidt E. Searle S. Slater G. Smith J. Spooner W. Stabenau A. Stalker J. Stupka E. Ureta-Vidal A. Vastrik I. Clamp M. Nucleic Acids Res. 2002; 30: 38-41Crossref PubMed Scopus (1142) Google Scholar) (www.ensembl.org/). Genomic structures were further analyzed using Wise2 software (44Birney E. Thompson J.D. Gibson T.J. Nucleic Acids Res. 1996; 24: 2730-2739Crossref PubMed Scopus (136) Google Scholar) from EMBL-EBI (European Bioinformatic Institute; www.ebi.ac.uk/). Analysis of synonymous and nonsynonymous codon positions was carried out with SNAP (45Nei M. Gojobori T. Mol. Biol. Evol. 1986; 3: 418-426PubMed Google Scholar). Protein sequences were obtained from SPTREMBL, SWISSPROT, and GenBank™ and predicted from ESTs sequences. Multiple sequence alignments were generated with Clustal X (1.83) (46Thompson J.D. Gibson T.J. Plewniak F. Jeanmougin F. Higgins D.G. Nucleic Acids Res. 1997; 25: 4876-4882Crossref PubMed Scopus (35075) Google Scholar), with no adjustment of the default parameters, and shaded using BOXSHADE 3.21 (www.ch.embnet.org/) according to conservation and similarity of residues Cloning of Chicken U2AF1 Gene and Identification of Three Alternatively Spliced and Polyadenylated mRNA Isoforms— Chicken (Gallus gallus) U2AF1 cDNA was cloned using degenerate primers complementary to previously defined conserved regions in the U2AF1 sequence from H. sapiens, D. mel" @default.
• W2080521229 created "2016-06-24" @default.
• W2080521229 creator A5006220828 @default.
• W2080521229 creator A5019024895 @default.
• W2080521229 creator A5022884999 @default.
• W2080521229 creator A5036242198 @default.
• W2080521229 creator A5049948775 @default.
• W2080521229 creator A5052404960 @default.
• W2080521229 creator A5060543281 @default.
• W2080521229 creator A5067098592 @default.
• W2080521229 creator A5083230780 @default.
• W2080521229 date "2004-06-01" @default.
• W2080521229 modified "2023-10-18" @default.
• W2080521229 title "Diversity of Vertebrate Splicing Factor U2AF35" @default.
• W2080521229 cites W1513114192 @default.
• W2080521229 cites W1520556951 @default.
• W2080521229 cites W1599357356 @default.
• W2080521229 cites W1913751214 @default.
• W2080521229 cites W1964378988 @default.
• W2080521229 cites W1966123525 @default.
• W2080521229 cites W1975580175 @default.
• W2080521229 cites W1977334426 @default.
• W2080521229 cites W1985094434 @default.
• W2080521229 cites W1985804396 @default.
• W2080521229 cites W1985991078 @default.
• W2080521229 cites W1990007398 @default.
• W2080521229 cites W1993243592 @default.
• W2080521229 cites W2004058003 @default.
• W2080521229 cites W2005591485 @default.
• W2080521229 cites W2012640439 @default.
• W2080521229 cites W2012827002 @default.
• W2080521229 cites W2013340095 @default.
• W2080521229 cites W2021018226 @default.
• W2080521229 cites W2023218737 @default.
• W2080521229 cites W2024853196 @default.
• W2080521229 cites W2029706883 @default.
• W2080521229 cites W2033613795 @default.
• W2080521229 cites W2033948688 @default.
• W2080521229 cites W2039671473 @default.
• W2080521229 cites W2039762550 @default.
• W2080521229 cites W2043191862 @default.
• W2080521229 cites W2050538166 @default.
• W2080521229 cites W2055238787 @default.
• W2080521229 cites W2057051846 @default.
• W2080521229 cites W2064128877 @default.
• W2080521229 cites W2065679706 @default.
• W2080521229 cites W2068681382 @default.
• W2080521229 cites W2068957119 @default.
• W2080521229 cites W2081646062 @default.
• W2080521229 cites W2084212780 @default.
• W2080521229 cites W2084715034 @default.
• W2080521229 cites W2094430977 @default.
• W2080521229 cites W2097382368 @default.
• W2080521229 cites W2098011283 @default.
• W2080521229 cites W2104668964 @default.
• W2080521229 cites W2105484013 @default.
• W2080521229 cites W2106154073 @default.
• W2080521229 cites W2107881958 @default.
• W2080521229 cites W2109552144 @default.
• W2080521229 cites W2109936378 @default.
• W2080521229 cites W2111295518 @default.
• W2080521229 cites W2116335962 @default.
• W2080521229 cites W2119469219 @default.
• W2080521229 cites W2120944746 @default.
• W2080521229 cites W2120960764 @default.
• W2080521229 cites W2125946663 @default.
• W2080521229 cites W2126409874 @default.
• W2080521229 cites W2131581981 @default.
• W2080521229 cites W2137259658 @default.
• W2080521229 cites W2137845412 @default.
• W2080521229 cites W2145070407 @default.
• W2080521229 cites W2146219830 @default.
• W2080521229 cites W2152075687 @default.
• W2080521229 cites W2153635048 @default.
• W2080521229 cites W2158714788 @default.
• W2080521229 cites W2159864549 @default.
• W2080521229 cites W2162210817 @default.
• W2080521229 cites W2165954869 @default.
• W2080521229 cites W2166797651 @default.
• W2080521229 cites W30786801 @default.
• W2080521229 cites W4301203760 @default.
• W2080521229 doi "https://doi.org/10.1074/jbc.m402136200" @default.
• W2080521229 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15096518" @default.
• W2080521229 hasPublicationYear "2004" @default.
• W2080521229 type Work @default.
• W2080521229 sameAs 2080521229 @default.
• W2080521229 citedByCount "50" @default.
• W2080521229 countsByYear W20805212292012 @default.
• W2080521229 countsByYear W20805212292013 @default.
• W2080521229 countsByYear W20805212292014 @default.
• W2080521229 countsByYear W20805212292015 @default.
• W2080521229 countsByYear W20805212292016 @default.
• W2080521229 countsByYear W20805212292017 @default.
• W2080521229 countsByYear W20805212292018 @default.
• W2080521229 countsByYear W20805212292019 @default.
• W2080521229 countsByYear W20805212292020 @default.
• W2080521229 countsByYear W20805212292021 @default.
• W2080521229 countsByYear W20805212292022 @default.

• next