FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2080584359> ?p ?o ?g. }

• W2080584359 endingPage "23126" @default.
• W2080584359 startingPage "23120" @default.
• W2080584359 abstract "Chick cDNA clones for a new member of the FACIT (fibril-associated collagens with interrupted triple helices) subfamily have been isolated and sequenced. The collagen chain encoded by these cDNAs was assigned the next consecutive number, making it the α1(XX) collagen chain. Assignment of type XX collagen to the FACIT family was based on sequence similarities to types XII and XIV collagen. Type XX collagen mRNA is not abundant in the chick embryo. It is most prevalent in corneal epithelium. It is also detectable by reverse transcription polymerase chain reaction in embryonic skin, sternal cartilage, and tendon, but is barely detectable in calvaria, notochord, or neural retina at select stages of development, suggesting that it is not expressed in these tissues. The cDNA predicts that the α1(XX) collagen polypeptide is smaller than the short forms of collagen XII and XIV. A polyclonal antibody against a synthetic α1(XX) peptide reacts with polypeptide bands of 185, 170, and 135 kDa by Western blot analysis. From its similarity to types XII and XIV collagen, type XX is expected to bind to collagen fibrils, projecting the amino-terminal domains away from the fibrillar surface. The projecting NC 3 domains are predicted to be about half the length of those of collagen XIV. Chick cDNA clones for a new member of the FACIT (fibril-associated collagens with interrupted triple helices) subfamily have been isolated and sequenced. The collagen chain encoded by these cDNAs was assigned the next consecutive number, making it the α1(XX) collagen chain. Assignment of type XX collagen to the FACIT family was based on sequence similarities to types XII and XIV collagen. Type XX collagen mRNA is not abundant in the chick embryo. It is most prevalent in corneal epithelium. It is also detectable by reverse transcription polymerase chain reaction in embryonic skin, sternal cartilage, and tendon, but is barely detectable in calvaria, notochord, or neural retina at select stages of development, suggesting that it is not expressed in these tissues. The cDNA predicts that the α1(XX) collagen polypeptide is smaller than the short forms of collagen XII and XIV. A polyclonal antibody against a synthetic α1(XX) peptide reacts with polypeptide bands of 185, 170, and 135 kDa by Western blot analysis. From its similarity to types XII and XIV collagen, type XX is expected to bind to collagen fibrils, projecting the amino-terminal domains away from the fibrillar surface. The projecting NC 3 domains are predicted to be about half the length of those of collagen XIV. fibril-associated collagens with interrupted triple helices polymerase chain reaction thrombospondin amino-terminal-like noncollagenous collagenous glyceraldehyde-3-phosphate dehydrogenase reverse transcription fibronectin type III module The fibril-associated collagens with interrupted triple helices (FACITs)1 are a subgroup within the collagen family containing types IX, XII, and XIV collagen (1Shaw L.M. Olsen B.R. Trends. Biochem. Sci. 1991; 16: 191-194Abstract Full Text PDF PubMed Scopus (251) Google Scholar). Characteristics shared by the α chains in this class are a carboxyl triple helical domain (Col 1) of about 103–115 amino acid residues containing two imperfections in the Gly-X-Y triplet structure; two cysteinyl residues, one at the end of Col 1 and another five residues into the adjacent noncollagenous (NC) 1 domain; and conservation of the sequences of the NC1 and NC2 domains (1Shaw L.M. Olsen B.R. Trends. Biochem. Sci. 1991; 16: 191-194Abstract Full Text PDF PubMed Scopus (251) Google Scholar). The α1(XII), α1(XIV), and the long splice variant of the α1(IX) collagen chain each also have a thrombospondin amino-terminal-like (Tsp) module (also called the PARP domain) (2Moradi-Ameli M. Deleage G. Geourjon C. van der Rest M. Matrix Biol. 1994; 14: 233-239Crossref PubMed Scopus (25) Google Scholar). Although all the possible supramolecular structures of types IX, XII, and XIV collagen are not yet elucidated, each has been shown to be capable of associating with fibrillar surfaces (3van der Rest M. Mayne R. J. Biol. Chem. 1988; 263: 1615-1618Abstract Full Text PDF PubMed Google Scholar, 4Keene D.R. Lunstrum G.P. Morris N.P. Stoddard D.W. Burgeson R.E. J. Cell Biol. 1991; 113: 971-978Crossref PubMed Scopus (145) Google Scholar, 5Koch M. Bohrmann B. Matthison M. Hagios C. Trueb B. Chiquet M. J. Cell Biol. 1995; 130: 1005-1014Crossref PubMed Scopus (92) Google Scholar, 6Young B.B. Gordon M.K. Birk D.E. Dev. Dyn. 2000; 217: 430-439Crossref PubMed Scopus (80) Google Scholar). Presented in this report are cDNAs for a new collagen that has characteristics very similar to types XII and XIV collagen. The polypeptide encoded by the cDNA has been assigned the next Roman numeral, α1(XX). We demonstrate here that type XX collagen mRNA is not abundant in any embryonic chick tissue. It is, however, a minor component of several connective tissues, such as sternal cartilage, cornea, and tendon. The embryonic tissue of highest abundance is the corneal epithelium, which makes large amounts of fibrillar collagens, as well as epithelial specific products. α1(XX) collagen polypeptides of 185, 170, and 135 kDa are detected by Western analysis, suggestive of alternative splicing. To obtain a human type XIV collagen cDNA, a BLAST search (7Altschul S.F. Gish W. Miller W. Meyer E.W. Lipman D.J. J. Mol. Biol. 1990; 215: 403-410Crossref PubMed Scopus (70322) Google Scholar) of the data base of expressed sequence tags was performed. A glycerol stock of IMAGE Consortium clone identification number 34933 (8Lennon G.G. Auffray C. Polymeropoulos M. Soares M.B. Genomics. 1996; 33: 151-152Crossref PubMed Scopus (1089) Google Scholar) was purchased. The clone was expanded for DNA isolation and sequence analysis. Automated DNA sequencing was performed by the Department of Physiology core facility at Tufts Medical School. Upon aligning the new human cDNA sequence with the sequence of chick and human types XII and XIV collagen, it became clear that clone 34933 was not a human α1(XIV) clone, but, instead, a close relative. The aligned sequences were used to select two conserved areas in the Tsp domain for making degenerate nucleotide primers that would amplify, by RT-PCR (conditions described below), chick and human α1(XII) and α1(XIV) mRNAs, as well as mRNA for the new collagen, designated α1(XX). Degenerate primers (dXX-1 and dXX-2rc) were synthesized corresponding to conserved regions GSFHK(V/L) H(/V)I and D(R/K)CC(D/E)(I/L)P in the Tsp domain. The primer sequences are: dXX-1, GG(A/G)AG(C/T)TT(C/T)CA(C/T)AAGGT(T/G)CA(T/C)(A/G)T and dXX-2rc, GG(G/A)A(T/G)(A/C)TCACA(A/G)CA(T/C)(T/C)(T/G)GTC. As described below, 13-day chick corneal mRNA was amplified with these primers and the product was inserted into the PCRII vector (Invitrogen, Carlsbad, CA), following the manufacturer's protocol. Transformed colonies were expanded and DNA was isolated using Qiagen's (Valencia, CA) Miniprep DNA isolation kit. Of the clones resulting from this procedure, sequence analysis demonstrated that chick α1(XII), α1(XIV), and α1(XX) cDNAs were obtained. The chick α1(XX) cDNAs were designated clones 2001, with a, b, c, etc. to distinguish individual selected colonies. All were identical. Embryonated eggs were purchased from Spafas (Norwich, CT) and Avian Services (Frenchtown, NJ). The following embryonic tissues were dissected from White Leghorn chick embryos, frozen immediately in liquid nitrogen, and then stored at −80 °C until used: 5.5-day notochord and neural retina, 7- and 12-day back skin, 7- and 13-day cornea, 14.5-day sterna, and 17-day lung, calvaria, and tendon. Total RNA was isolated from each using the Trizol reagent (Life Technologies, Inc.) following the manufacturer's instructions. Poly(A)+ mRNA was isolated using Qiagen Oligotex beads. In other dissections, corneas without surrounding scleral tissue were removed from day 13 embryos and placed into a dish containing 50 mm EDTA, 0.25% dispase (Roche Molecular Biochemicals) in phosphate-buffered saline, pH 7.4, at 37 °C. After 5 min of incubation, the epithelia were gently removed from the underlying stroma. Separated corneal epithelial and stromal/endothelial layers were immediately frozen in liquid nitrogen and then used to isolate poly(A)+ mRNA as described above. A primer, TTACCCGCACTTTGTAGCCATTGA, corresponding to the reverse complement of bases 63–86 of clone 2015 (see Fig. 1), was labeled using the Kinase MaxTM 5′ end-labeling kit from Ambion (Austin, TX), following the protocol of the kit. 50,000 cpm of labeled primer was added to 20 μg of embryonic chick day 13 total RNA and the mixture was ethanol-precipitated. The pellet was taken up in 30 μl of hybridization buffer (80% deionized formamide, 100 mmsodium citrate, pH 6.4, 300 mm sodium acetate, pH 6.4, 1 mm EDTA), incubated at 37 °C overnight, and then ethanol-precipitated again. The pellet was resuspended in 22 μl of water, and then to it was added 8 μl of 5× RT buffer (250 mm Tris-HCl, pH 8.3, 375 mm KCl, 15 mm MgCl2), 4 μl of 0.1 m DTT, 4 μl of containing 10 mm of each dNTP, and 2 μl (400 units) of Superscript II RNase H-minus reverse transcriptase. After incubating for 37 °C for 1 h, 1 μl of a mix of 40 μg/ml RNase A and 2 units/ml RNase T1 were added, and incubation at 37 °C was continued for 30 min. Loading buffer (4 μl of 95% formamide, 60 mm EDTA, pH 8.0, 0.025% xylene cyanol, 0.25% bromphenol blue) was added to the sample, the temperature was raised to 95 °C for 3 min, and then an aliquot was applied to a 10% denaturing acrylamide gel. After electrophoresis at 40 W, the gel was dried and exposed to film. A 10-day exposure was required to visualize the α1(XX) primer extended product. To obtain the 5′ untranslated region sequence, unlabeled RNase digested primer-extended product was generated. The ∼330-nucleotide product was adapted for amplification using the Life Technologies, Inc. 5′ RACE system kit and subjected to two rounds of polymerase chain reaction using the nested primer of the kit and the collagen XX-specific extension primer. After agarose gel purification, the excised product was sequenced using the USB (Cleveland, OH) Thermo Sequenase Radiolabeled Terminator Cycle Sequencing kit, following the manufacturer's instructions. First strand cDNA synthesis from mRNA was performed as previously described (9Gordon M.K. Foley J.W. Linsenmayer T.F. Fitch J.M. Dev. Dyn. 1996; 206: 49-58Crossref PubMed Scopus (55) Google Scholar, 10Gordon M.K. Fitch J.M. Foley J.W. Gerecke D.R. Linsenmayer C. Birk D.E. Linsenmayer T.F. Invest. Ophthalmol. Vis. Sci. 1997; 38: 153-166PubMed Google Scholar) and used as template in PCR. For RT-PCR, competitive PCR or routine DNA amplifications, the following conditions were used: a 20 μl of final reaction volume mixture was assembled consisting of template DNA, 10 mm Tris-HCl, pH 8.3, 50 mmKCl, 1.5 mm MgCl2, 200 μm each dNTP, 1 μm each 5′ and 3′ specific primers, and 2.5 units Amplitaq (PE Applied Biosystems, Foster City, CA). The templates were amplified for one cycle of 94 °C for 1 min; 35 cycles of 94 °C for 1 min, 56 °C for 1.5 min, 72 °C for 2.5 min; and a final cycle of 72 °C for 10 min in a Perkin-Elmer 9600 thermocycler. Using a kit fromCLONTECH (Palo Alto, CA), 13-day chick cornea mRNA was made into a cDNA library and adaptor primers were ligated to both the 5′ and 3′ ends, as previously described (11Koch M. Olson P.F. Albus A. Jin W. Hunter D.D. Brunken W.J. Burgeson R.E. Champliaud M.F. J. Cell Biol. 1999; 145: 605-618Crossref PubMed Scopus (214) Google Scholar). The cDNA 2001 (see Fig. 1) sequence was used to design chick α1(XX) collagen-specific primers for 5′ and 3′ rapid amplification of cDNA ends. A specific primer was paired with a nested adaptor primer to amplify longer α1(XX) cDNAs from the library. Essential to the success of this method is the running of accompanying PCRs, amplified with nested adaptor primer alone. After agarose gel electrophoresis, products uniquely amplified with a specific α1(XX) collagen primer in conjunction with the nested adaptor primer were stabbed from the gel and reamplified with a nested α1(XX) primer and the nested adaptor primer. Unique products of this reamplification were isolated from agarose gels and ligated into PCRII for transformation. Isolated transformants were checked for insert size and sequenced. These new sequence data were used to generate additional specific primers for repeating the process, expanding the overlapping clones in each direction from the Tsp domain. These continuous rounds of marathon library screening resulted in 18 overlapping clones, shown in Fig. 1. The sequence derived from the clones is available in GenBankTM accession number AF312825. Listing the sense strand primer first and the reverse complement antisense primer second, the pairs used to obtain these clones from the marathon library are as follows: for 2002, AP2 (the CLONTECHMarathon kit nested adaptor primer) and TCCCAGCATGATGAAGCCAGCGGT; for 2003, AGGTTGTGTGCAACAGCTTA and AP2; for 2004, AP2 and AGCTCCCCTCATCCCTCAATG; for 2005, 2006, 2007, and 2008, CAAAGGAGAAAAAGGCATGGC and AP2; for 2009, AP2 and GAATGTCTCTGAACAGGGTGAAGGTGCGGG; for 2010, AP2 and TGAACAGGGTGAAGGTGCGGGAGCCACTGA; for 2013, AP2 and TCTGCTAGACATGTAGGTGACGCGATGAC; for 2014, AP2 and GGCATCTTCCCCATACAACGCATAC; for 2015 and 2016, AP2 and GCCACCTGCTTCAGCTCAGCCTCATCCGCG. Other cDNA clones were derived by RT-PCR directly from 13-day cornea mRNA using the following primers: for clone 2011, primers GGGGAAGATGCCAGTGAT and TGAACAGGGTGAAGGTGCGGGAGCCACTGA; for 2012, ATCAAGCTCTATCTGGACTGTAAA and CAGAAGTGCAGGAGCAGGCAG; for 2017, AGGAGAGAAAGGAGACACTGG and CACATCGGCCATCAGGGAATGA; for 2018, CAGGAGGTCCAGGAGGTCCCT and a modified oligo dT primer, (N)(N)(N)(N)(T)25. The α1(XX) collagen competitor was a deletion construct, produced as previously reported (9Gordon M.K. Foley J.W. Linsenmayer T.F. Fitch J.M. Dev. Dyn. 1996; 206: 49-58Crossref PubMed Scopus (55) Google Scholar, 10Gordon M.K. Fitch J.M. Foley J.W. Gerecke D.R. Linsenmayer C. Birk D.E. Linsenmayer T.F. Invest. Ophthalmol. Vis. Sci. 1997; 38: 153-166PubMed Google Scholar, 12Gordon M.K. Foley J.W. Birk D.E. Fitch J.M. Linsenmayer T.F. J. Biol. Chem. 1994; 269: 24959-24966Abstract Full Text PDF PubMed Google Scholar). The G3PDH competitor and primers were those previously reported (9Gordon M.K. Foley J.W. Linsenmayer T.F. Fitch J.M. Dev. Dyn. 1996; 206: 49-58Crossref PubMed Scopus (55) Google Scholar, 10Gordon M.K. Fitch J.M. Foley J.W. Gerecke D.R. Linsenmayer C. Birk D.E. Linsenmayer T.F. Invest. Ophthalmol. Vis. Sci. 1997; 38: 153-166PubMed Google Scholar,12Gordon M.K. Foley J.W. Birk D.E. Fitch J.M. Linsenmayer T.F. J. Biol. Chem. 1994; 269: 24959-24966Abstract Full Text PDF PubMed Google Scholar). The template for making the α1(XX) collagen deletion construct was clone 2001. Base numbers correspond to those found in GenBankTM accession number AF312825. Primers used to amplify the fragments on each side of the deletion were as follows: (a) the “extreme” end sense primer ATCAAGCTCTATCTGGACTGTAAA (bases 3355–3378) in conjunction with CTCCTCCTCCGCCCC-TCGTGATCCACTCCT (the reverse complement of bases 3470–3483 linked to bases 3525–3540), and (b) sense primer AGGAGTGGATCACGA-GGGGCGGAGGAGGAC (bases 3470–3483 linked to bases 3525–3540) in conjunction with CAGAAGTGCAGGAGCAGGCAG (reverse complement of bases 3596–3616). Products were isolated from agarose gels, mixed together, and fused by overlap extension (13Ho S.N. Hunt H.D. Horton R.M. Pullen J.K. Pease L.R. Gene. 1989; 77: 51-59Crossref PubMed Scopus (6824) Google Scholar) with both primers referred to as extreme end primers: ATCAAGCTCTATCTGGACTGTAAA (sense primer, same as given above ina) and GGAAGATCACAGCATCGGTC (reverse complement 3438–3557). The overlap extension product, spanning bases 3355 to 3557 with bases 3484–3524 deleted, was ligated into PCRII and used to transform bacteria. Isolated colonies were sequenced. Several competitor clones had the correct sequence with the desired deletion. One was grown in large scale and plasmid DNA was isolated with Qiagen's maxiprep kit. After linearizing the plasmid by XhoI digestion, the competitor was quantitated on agarose gels by comparison to known standards. To perform the competitive PCR, 400 ng of 7-day and 13-day corneal mRNA and 13-day corneal epithelial and stromal/endothelial mRNA were made into cDNA in a 20-μl volume. A set of seven PCRs was done for each tissue, varying the amount of competitor added to each reaction. In each tube, buffer, dNTPs, extreme end primers and enzyme components for a 20-μl PCR were brought up to a volume of 18 μl so that 1 μl of tissue cDNA (representing 20 ng of mRNA starting material) and 1 μl of a serial dilution of competitor DNA could be added as previously described (9Gordon M.K. Foley J.W. Linsenmayer T.F. Fitch J.M. Dev. Dyn. 1996; 206: 49-58Crossref PubMed Scopus (55) Google Scholar, 10Gordon M.K. Fitch J.M. Foley J.W. Gerecke D.R. Linsenmayer C. Birk D.E. Linsenmayer T.F. Invest. Ophthalmol. Vis. Sci. 1997; 38: 153-166PubMed Google Scholar). In the series of seven tubes, the 1 μl of competitor DNA corresponded to the following 3-fold dilutions: 0.67, 0.33, 0.10, 0.067, 0.033, 0.01, and 0.0067 amol/μl. G3PDH was quantitated using competitor and primers that were previously described (9Gordon M.K. Foley J.W. Linsenmayer T.F. Fitch J.M. Dev. Dyn. 1996; 206: 49-58Crossref PubMed Scopus (55) Google Scholar, 10Gordon M.K. Fitch J.M. Foley J.W. Gerecke D.R. Linsenmayer C. Birk D.E. Linsenmayer T.F. Invest. Ophthalmol. Vis. Sci. 1997; 38: 153-166PubMed Google Scholar). Ten microliters of each competitive PCR was applied to 3% MetaPhor agarose gels (FMC, Rockland, ME) made with TBE buffer and 0.5 μg/ml ethidium bromide. The endogenous α1(XX) collagen product was 202 base pairs; the competitor was 159 base pairs. The G3PDH endogenous product was 101 base pairs; its competitor was 60 base pairs. Gels were photographed with an Eagle Eye II (Stratagene, La Jolla, CA) digital camera. Photograph exposure times were chosen that ensured no band exceeded 256 pixels. The images were stored on disks for later analysis. The optical density of the bands was analyzed by Scanalytics (Billerica, MA) DNA One Scan software, and the ratio of the endogenous to the competitor band was converted to a number of amol. Because the endogenous and competitor PCR products differed in size, a correction factor was applied to adjust for molar differences in the binding of ethidium bromide. The calculated amol of cDNA synthesized from endogenous G3PDH mRNA was multiplied by 60/101, or 0.594, and the amol of endogenous α1(XX) collagen cDNA made from mRNA was multiplied by 159/202, or 0.787. The data were then plotted as amol endogenous α1(XX) collagen product/amol α1(XX) competitor on the y axis versus amol α1(XX) competitor added on the x axis. The point on the graph at which endogenous/competitor equals 1 is the equivalence point, and represents the amount of target mRNA in the starting sample. To represent the amount of mRNA present in an equal number of cells, the amol α1(XX) collagen mRNA was normalized by dividing it by the corresponding amol G3PDH mRNA value. All relative PCRs were performed in 20 μl containing the following: 1 μl of cDNA (representing 0.014 ng of poly(A)+ RNA), 10 mm Tris-HCl, pH 8.3, 50 mm KCl, 1.5 mm MgCl2, 0.4 μm each primer (either the pair for type XX collagen or for the experimental normalizer, G3PDH, as in the competitive PCR above), 0.1 mm each dNTP, 0.2 μl of [α-32P]dCTP (10 μCi/μl; >3000 Ci per mmol) and 0.025 units of Amplitaq (PE Applied Biosystems, Foster City, CA). For consistency, multiple PCRs were set up from master mixes made with all reagents except the cDNA; 19-μl aliquots of the master mix were put in thin-walled 250-μl tubes, and 1 μl of the appropriate cDNA was added. Conditions for cycling were as follows: 1 premelt step at 94 °C for 1 min, followed by the linear range number of cycles, experimentally determined to be 21 (see below), each consisting of a 94 °C melting step for 15 s, a 56 °C annealing incubation for 25 s, and a 72 °C elongation step for 90 s. Reactions were terminated in the linear range of amplification to ensure that the amount of product amplified reflects the quantity of starting mRNA. To determine this range, eight identical 20-μl PCRs were performed using the type XX collagen extreme end primers or G3PDH primers for each embryonic tissue cDNA tested. These were 5.5-day notochord and neural retina, 7- and 12-day back skin, 7- and 13-day cornea, 14.5-day sterna, and 17-day lung, calvaria, and tendon. The samples were loaded into a Perkin-Elmer 9600 thermocycler, and one tube of each was removed after 15 cycles, one after 17 cycles, and one each after completing cycles 19, 21, 23, 25, 27, and 35. After adding 10 μl of loading buffer (95% formamide, 10 mm EDTA, pH 7.6, 0.1% xylene cyanol, 0.1% bromphenol blue) to each tube, 5 μl of each sample was applied to 5% denaturing polyacrylamide gels (containing 7.7 m urea) (14Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). The gel was run at 2000 V until the dye ran to the bottom, and then it was fixed in 10% methanol, 10% acetic acid; dried; and exposed to film. Bands were excised from the dried gel and counted by the Cerenkov method in a scintillation counter. The cpm (y axis) were plottedversus the cycle number (x axis). The linear range of amplification for all tissues with the G3PDH primers and for the tissues most abundant in collagen XX was between 19 and 23 cycles. All subsequent relative PCRs were performed for 21 cycles. Relative PCRs were performed for all tissue samples at the same time, using a master mix of components, and run on one gel for consistency. Bands were excised from the gel and counted as described above. The sequence of the translated α1(XX) collagen polypeptide was computer analyzed to determine an optimal antigenic site. The services of Alpha Diagnostics (San Antonio, TX) were used to synthesize the selected peptide and to generate a monospecific polyclonal antibody against the α1(XX) collagen chain. The α1(XX) peptide sequence chosen was KADLQEVSFDQQEC, a region in the Tsp domain. (The carboxyl-terminal cysteine is not in the α1(XX) collagen sequence but is needed for coupling the peptide before injection into rabbits.) The enzyme-linked immunosorbent assay titer of the 10-week bleed, diluted 1:100,000, showed that the anti-chick anti-collagen XX antibody was more than 6 times greater than the preimmune serum. Synthetic peptides were made for the analogous regions of the Tsp domain in α1(XIV) collagen (KGDFQTVTFEGPE) and α1(XII) collagen (RGEVQTVTFDNDE) and were used to check for cross-reactivity with the anti-collagen XX antibody. By enzyme-linked immunosorbent assay, no cross-reaction was detected. To isolate corneal proteins for Western analysis, central corneas were isolated from 13-day chick embryos and stored at −80 °C until use. Prior to extraction, tissue was weighed. For each gram, 5 ml of low salt extraction buffer (200 mm NaCl, 25 mmTris, 10 mm EDTA, 10 mm benzamidine-HCl, 0.1 mm N-ethylmaleimide, 1 μg/ml leupeptin, 1 μg/ml pepstatin, pH 7.8) was added. The tissue was homogenized in a polytron. An equal volume of buffer was added to reduce viscosity, and the sample was rehomogenized. Following centrifugation at 20,000 × g for 30 min at 4 °C, the supernatant was collected. The protein concentration was determined to be 0.45 mg/ml by a dye binding assay (Bio-Rad) using IgG as a standard. Samples (40 μg of total protein) were run in reducing (1% mercapoethanol) sample buffer (14Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar), heated to 95 °C, 10 min, and loaded on a 5% SDS-polyacrylamide gel (with a 4% stacking gel). After electrophoresis, proteins were transferred to nitrocellulose membrane (Bio-Rad). The blot was blocked with 5% nonfat dry milk in phosphate-buffered saline, washed with phosphate-buffered saline/Tween 20, and incubated with primary antibody (1:10,000 in phosphate-buffered saline/Tween 20/1% bovine serum albumin) at room temperature for 1 h. (In addition to the anti-chick α1(XX) collagen antibody, anti-chick anti-α1(XIV) collagen (10Gordon M.K. Fitch J.M. Foley J.W. Gerecke D.R. Linsenmayer C. Birk D.E. Linsenmayer T.F. Invest. Ophthalmol. Vis. Sci. 1997; 38: 153-166PubMed Google Scholar), anti-bovine anti-collagen XII antibody 1851 (15Lunstrum G.P. Morris N.P. McDonough A.M. Keene D.R. Burgeson R.E. J. Cell Biol. 1991; 113: 963-969Crossref PubMed Scopus (50) Google Scholar). and anti-chick anti-α1(XII) collagen antibody 522 (5Koch M. Bohrmann B. Matthison M. Hagios C. Trueb B. Chiquet M. J. Cell Biol. 1995; 130: 1005-1014Crossref PubMed Scopus (92) Google Scholar, 9Gordon M.K. Foley J.W. Linsenmayer T.F. Fitch J.M. Dev. Dyn. 1996; 206: 49-58Crossref PubMed Scopus (55) Google Scholar) were used as control primary antibodies.) Membranes were washed and incubated with horseradish peroxidase-conjugated anti-rabbit secondary antibody (Jackson ImmunoResearch, West Grove, PA) (1:20,000) for 1 h. Chemiluminescence (Pierce) was recorded on x-ray films. The data base of expressed sequence tag cDNAs was searched for human type XIV collagen cDNAs. Four candidate cDNAs were found. One expressed sequence tag had been placed in the data base with about 70 bases sequenced, encoding 23 amino acid residues of a Tsp domain, and on the basis of sequence similarity, it was tentatively identified as an α1(XIV) collagen cDNA. Although this region was highly homologous to type XIV collagen, it was not identical to the known human sequence: 16 of the 23 amino acid residues were identical, but 7 were conservative changes. A glycerol stock of this clone was purchased (IMAGE Consortium clone identification number 34933 (8Lennon G.G. Auffray C. Polymeropoulos M. Soares M.B. Genomics. 1996; 33: 151-152Crossref PubMed Scopus (1089) Google Scholar)) and expanded for DNA isolation. Sequence analysis demonstrated that the cDNA encoded 233 amino acid residues of a Tsp domain and 12 amino acids (four triplets) of a collagenous domain (Col 2), suggesting that it was indeed a member of the collagen family. BLAST searches (7Altschul S.F. Gish W. Miller W. Meyer E.W. Lipman D.J. J. Mol. Biol. 1990; 215: 403-410Crossref PubMed Scopus (70322) Google Scholar) indicated that the Tsp domain of the new collagen α chain was closest in identity to type XIV collagen and second closest to type XII collagen. Within the Tsp domains found in collagens (2Moradi-Ameli M. Deleage G. Geourjon C. van der Rest M. Matrix Biol. 1994; 14: 233-239Crossref PubMed Scopus (25) Google Scholar), localized areas are unique to collagens XII and XIV of avian and mammalian species. The new human cDNA shared these subfamily similarities, allowing us to design degenerate primers that would theoretically amplify mRNAs of any subfamily member, type XII, XIV, or the new chain, from chick or human, by RT-PCR. Because of our interest in development, particularly of the cornea, our goal was to obtain the chick cDNA corresponding to the new human collagen α chain. As expected, by amplifying chick cornea cDNA with this degenerate primer pair, cDNA clones were obtained for the known Tsp domains of chick types XII and XIV, as well as for a new cDNA (clone 2001, shown in Fig. 1), almost identical in sequence to the human cDNA (data not shown). Using this chick α chain sequence, unique primers were designed from regions where the sequence diverged from collagens XII and XIV. These primers amplified only the new chick collagen α chain, and not α1(XII) or α1(XIV) collagens in RT-PCR. A Marathon cDNA library was made from day 13 embryonic chick corneal mRNA, and the specific primers were used to extend the sequence of chick cDNA by 5′ and 3′ rapid amplification of cDNA ends. The resulting overlapping clones are shown in Fig. 1. The divergence of the domain structure from α1(XII) and α1(XIV) collagen chain sequences in the NC3 domain suggested that the cDNA represented a new member of the FACIT family and not a new α chain of an already described collagen. Assigning the translated cDNA sequence the next available Roman numeral, the clone was designated the α1(XX) collagen chain. The nucleotide sequence of the composite cDNA is found under GenBankTM accession numberAF312825. It is believed that the entire 3′ end of the mRNA is represented in this composite because two clones, isolated by different methods, yielded identical 3′ end products, each with a poly(A) tail. One cDNA was isolated by 3′ rapid amplification of cDNA ends of the marathon library using a primer in the Col 1 domain and the adaptor primer; the other was isolated by RT-PCR, using a specific forward Col 1 primer and a modified oligo dT primer, (N)(N)(N)(N)(T)25, with total RNA isolated from 13-day chick embryo corneal epithelium as template. We attempted to estimate how much of the 5′ end of the mRNA was missing from our cDNAs by comparing the number of sequenced nucleotides with the size of the mRNA on Northern blots. However, no signal was ever detected on Northern blots of cornea mRNA. Ultimately, it became clear from competitive PCR quantitations that this analysis failed because the α1(XX) collagen mRNA is a nonabundant species. Primer extension was used as an alternative method to determine how much of the mRNA was not represented in the composite cDNA. As can be seen in Fig. 2, the major primer extended band, visible after a 10-day exposure, was about 330 bases. The primer used was 86 nucleotides into clone 2015; therefore, about 245 nucleotides of the mRNA had ye" @default.
• W2080584359 created "2016-06-24" @default.
• W2080584359 creator A5038453915 @default.
• W2080584359 creator A5039590452 @default.
• W2080584359 creator A5046060163 @default.
• W2080584359 creator A5050142169 @default.
• W2080584359 creator A5052231842 @default.
• W2080584359 creator A5067941504 @default.
• W2080584359 creator A5090543730 @default.
• W2080584359 date "2001-06-01" @default.
• W2080584359 modified "2023-10-16" @default.
• W2080584359 title "α1(XX) Collagen, a New Member of the Collagen Subfamily, Fibril-associated Collagens with Interrupted Triple Helices" @default.
• W2080584359 cites W1494619635 @default.
• W2080584359 cites W1614079693 @default.
• W2080584359 cites W1926549366 @default.
• W2080584359 cites W1995321216 @default.
• W2080584359 cites W2042096080 @default.
• W2080584359 cites W2045670556 @default.
• W2080584359 cites W2055043387 @default.
• W2080584359 cites W2060913542 @default.
• W2080584359 cites W2064239777 @default.
• W2080584359 cites W2066346262 @default.
• W2080584359 cites W2067580349 @default.
• W2080584359 cites W2068719237 @default.
• W2080584359 cites W2068726845 @default.
• W2080584359 cites W2074267151 @default.
• W2080584359 cites W2081416354 @default.
• W2080584359 cites W2107564206 @default.
• W2080584359 cites W2109394851 @default.
• W2080584359 cites W2147680527 @default.
• W2080584359 doi "https://doi.org/10.1074/jbc.m009912200" @default.
• W2080584359 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11274142" @default.
• W2080584359 hasPublicationYear "2001" @default.
• W2080584359 type Work @default.
• W2080584359 sameAs 2080584359 @default.
• W2080584359 citedByCount "96" @default.
• W2080584359 countsByYear W20805843592012 @default.
• W2080584359 countsByYear W20805843592014 @default.
• W2080584359 countsByYear W20805843592016 @default.
• W2080584359 countsByYear W20805843592017 @default.
• W2080584359 countsByYear W20805843592018 @default.
• W2080584359 countsByYear W20805843592019 @default.
• W2080584359 countsByYear W20805843592020 @default.
• W2080584359 countsByYear W20805843592021 @default.
• W2080584359 countsByYear W20805843592022 @default.
• W2080584359 countsByYear W20805843592023 @default.
• W2080584359 crossrefType "journal-article" @default.
• W2080584359 hasAuthorship W2080584359A5038453915 @default.
• W2080584359 hasAuthorship W2080584359A5039590452 @default.
• W2080584359 hasAuthorship W2080584359A5046060163 @default.
• W2080584359 hasAuthorship W2080584359A5050142169 @default.
• W2080584359 hasAuthorship W2080584359A5052231842 @default.
• W2080584359 hasAuthorship W2080584359A5067941504 @default.
• W2080584359 hasAuthorship W2080584359A5090543730 @default.
• W2080584359 hasBestOaLocation W20805843591 @default.
• W2080584359 hasConcept C104317684 @default.
• W2080584359 hasConcept C10919887 @default.
• W2080584359 hasConcept C12554922 @default.
• W2080584359 hasConcept C155181932 @default.
• W2080584359 hasConcept C185592680 @default.
• W2080584359 hasConcept C27523624 @default.
• W2080584359 hasConcept C3019161014 @default.
• W2080584359 hasConcept C50929876 @default.
• W2080584359 hasConcept C55493867 @default.
• W2080584359 hasConcept C71240020 @default.
• W2080584359 hasConcept C86803240 @default.
• W2080584359 hasConceptScore W2080584359C104317684 @default.
• W2080584359 hasConceptScore W2080584359C10919887 @default.
• W2080584359 hasConceptScore W2080584359C12554922 @default.
• W2080584359 hasConceptScore W2080584359C155181932 @default.
• W2080584359 hasConceptScore W2080584359C185592680 @default.
• W2080584359 hasConceptScore W2080584359C27523624 @default.
• W2080584359 hasConceptScore W2080584359C3019161014 @default.
• W2080584359 hasConceptScore W2080584359C50929876 @default.
• W2080584359 hasConceptScore W2080584359C55493867 @default.
• W2080584359 hasConceptScore W2080584359C71240020 @default.
• W2080584359 hasConceptScore W2080584359C86803240 @default.
• W2080584359 hasIssue "25" @default.
• W2080584359 hasLocation W20805843591 @default.
• W2080584359 hasOpenAccess W2080584359 @default.
• W2080584359 hasPrimaryLocation W20805843591 @default.
• W2080584359 hasRelatedWork W1969946367 @default.
• W2080584359 hasRelatedWork W2024305546 @default.
• W2080584359 hasRelatedWork W2062202096 @default.
• W2080584359 hasRelatedWork W2080584359 @default.
• W2080584359 hasRelatedWork W2091414986 @default.
• W2080584359 hasRelatedWork W2091573745 @default.
• W2080584359 hasRelatedWork W2161162374 @default.
• W2080584359 hasRelatedWork W2395415158 @default.
• W2080584359 hasRelatedWork W3178191813 @default.
• W2080584359 hasRelatedWork W69811284 @default.
• W2080584359 hasVolume "276" @default.
• W2080584359 isParatext "false" @default.
• W2080584359 isRetracted "false" @default.
• W2080584359 magId "2080584359" @default.
• W2080584359 workType "article" @default.