FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2080755654> ?p ?o ?g. }

• W2080755654 endingPage "3477" @default.
• W2080755654 startingPage "3465" @default.
• W2080755654 abstract "There is much evidence to indicate that FEN-1 efficiently cleaves single-stranded DNA flaps but is unable to process double-stranded flaps or flaps adopting secondary structures. However, the absence of Fen1 in yeast results in a significant increase in trinucleotide repeat (TNR) expansion. There are then two possibilities. One is that TNRs do not always form stable secondary structures or that FEN-1 has an alternative approach to resolve the secondary structures. In the present study, we test the hypothesis that concerted action of exonuclease and gap-dependent endonuclease activities of FEN-1 play a role in the resolution of secondary structures formed by (CTG)n and (GAA)n repeats. Employing a yeast FEN-1 mutant, E176A, which is deficient in exonuclease (EXO) and gap endonuclease (GEN) activities but retains almost all of its flap endonuclease (FEN) activity, we show severe defects in the cleavage of various TNR intermediate substrates. Precise knock-in of this point mutation causes an increase in both the expansion and fragility of a (CTG)n tract in vivo. Taken together, our biochemical and genetic analyses suggest that although FEN activity is important for single-stranded flap processing, EXO and GEN activities may contribute to the resolution of structured flaps. A model is presented to explain how the concerted action of EXO and GEN activities may contribute to resolving structured flaps, thereby preventing their expansion in the genome. There is much evidence to indicate that FEN-1 efficiently cleaves single-stranded DNA flaps but is unable to process double-stranded flaps or flaps adopting secondary structures. However, the absence of Fen1 in yeast results in a significant increase in trinucleotide repeat (TNR) expansion. There are then two possibilities. One is that TNRs do not always form stable secondary structures or that FEN-1 has an alternative approach to resolve the secondary structures. In the present study, we test the hypothesis that concerted action of exonuclease and gap-dependent endonuclease activities of FEN-1 play a role in the resolution of secondary structures formed by (CTG)n and (GAA)n repeats. Employing a yeast FEN-1 mutant, E176A, which is deficient in exonuclease (EXO) and gap endonuclease (GEN) activities but retains almost all of its flap endonuclease (FEN) activity, we show severe defects in the cleavage of various TNR intermediate substrates. Precise knock-in of this point mutation causes an increase in both the expansion and fragility of a (CTG)n tract in vivo. Taken together, our biochemical and genetic analyses suggest that although FEN activity is important for single-stranded flap processing, EXO and GEN activities may contribute to the resolution of structured flaps. A model is presented to explain how the concerted action of EXO and GEN activities may contribute to resolving structured flaps, thereby preventing their expansion in the genome. Trinucleotide repeats (TNRs) 2The abbreviations used are: TNR, trinucleotide repeat; EXO, exonuclease; GEN, gap endonuclease; nt, nucleotide(s); WT, wild type; MMS, methyl methanesulfonate; pol, polymerase; FEN, flap endonuclease. 2The abbreviations used are: TNR, trinucleotide repeat; EXO, exonuclease; GEN, gap endonuclease; nt, nucleotide(s); WT, wild type; MMS, methyl methanesulfonate; pol, polymerase; FEN, flap endonuclease. are a member of a class of DNAs termed microsatellites, which are composed of multiple repeats of a 1–6-bp DNA motif in a head to tail configuration (1Toth G. Gaspari Z. Jurka J. Genome Res. 2000; 10: 967-981Crossref PubMed Scopus (1054) Google Scholar). TNR expansion at specific gene regions interferes with the expression or properties of their gene product and can manifest in disease. The expansion of TNRs is associated with at least 20 neurological disorders, including Huntington disease, fragile X syndrome, myotonic dystrophy, and Friedreich's ataxia (2Gatchel J.R. Zoghbi H.Y. Nat. Rev. Genet. 2005; 6: 743-755Crossref PubMed Scopus (622) Google Scholar). Stretches of (CAG)n and (CGG)n are more prone to secondary structure formation than (AGG)n, (AGT)n, and (CAA)n (3Moore H. Greenwell P.W. Liu C.P. Arnheim N. Petes T.D. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1504-1509Crossref PubMed Scopus (172) Google Scholar). NMR studies show that both CAG or CTG (4Gacy A.M. Goellner G. Juranic N. Macura S. McMurray C.T. Cell. 1995; 81: 533-540Abstract Full Text PDF PubMed Scopus (514) Google Scholar) and CGG (5Chen X. Mariappan S.V. Catasti P. Ratliff R. Moyzis R.K. Laayoun A. Smith S.S. Bradbury E.M. Gupta G. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 5199-5203Crossref PubMed Scopus (226) Google Scholar) form stable hairpin structures, comprising a repeat unit of two GC pairs and a mismatched pair under physiological conditions. However, CAA/GTT repeats form no hairpins in vitro (6Spiro C. Pelletier R. Rolfsmeier M.L. Dixon M.J. Lahue R.S. Gupta G. Park M.S. Chen X. Mariappan S.V. McMurray C.T. Mol. Cell. 1999; 4: 1079-1085Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar, 7Richard G.F. Goellner G.M. McMurray C.T. Haber J.E. EMBO J. 2000; 19: 2381-2390Crossref PubMed Scopus (116) Google Scholar). All but one of the diseases, Friedreich's ataxia, occurs due to the expansion of GAA repeats in the first intron of the human frataxin gene (8Campuzano V. Montermini L. Molto M.D. Pianese L. Cossee M. Cavalcanti F. Monros E. Rodius F. Duclos F. Monticelli A. Zara F. Canizares J. Koutnikova H. Bidichandani S.I. Gellera C. Brice A. Trouillas P. De Michele G. Filla A. De Frutos R. Palau F. Patel P.I. Di Donato S. Mandel J.L. Cocozza S. Koenig M. Pandolfo M. Science. 1996; 271: 1423-1427Crossref PubMed Scopus (2254) Google Scholar). Repeating GAAs can adopt unusual DNA conformations, primarily a structure containing pyrimidinepurine-pyrimidine (YRY) triple helix with non-Watson-Crick pairs (9Bidichandani S.I. Ashizawa T. Patel P.I. Am. J. Hum. Genet. 1998; 62: 111-121Abstract Full Text Full Text PDF PubMed Scopus (319) Google Scholar, 10Gacy A.M. Goellner G.M. Spiro C. Chen X. Gupta G. Bradbury E.M. Dyer R.B. Mikesell M.J. Yao J.Z. Johnson A.J. Richter A. Melancon S.B. McMurray C.T. Mol. Cell. 1998; 1: 583-593Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar, 11Mariappan S.V. Catasti P. Silks L.A. II I Bradbury E.M. Gupta G. J. Mol. Biol. 1999; 285: 2035-2052Crossref PubMed Scopus (73) Google Scholar) and duplexes that associate strongly with each other called sticky DNAs (12Sakamoto N. Chastain P.D. Parniewski P. Ohshima K. Pandolfo M. Griffith J.D. Wells R.D. Mol. Cell. 1999; 3: 465-475Abstract Full Text Full Text PDF PubMed Scopus (272) Google Scholar, 13Vetcher A.A. Wells R.D. J. Biol. Chem. 2004; 279: 6434-6443Abstract Full Text Full Text PDF PubMed Scopus (19) Google Scholar). Heidenfelder et al. (14Heidenfelder B.L. Makhov A.M. Topal M.D. J. Biol. Chem. 2003; 278: 2425-2431Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar) showed for the first time that expanded GAA and TTC repeats form hairpin structures as well. Thus, multiple structures may play a role in genomic instability. The location of the secondary structure with respect to leading/lagging and nascent/template strands is also important in determining the repeat stability (15Freudenreich C.H. Stavenhagen J.B. Zakian V.A. Mol. Cell Biol. 1997; 17: 2090-2098Crossref PubMed Scopus (198) Google Scholar, 16Miret J.J. Pessoa-Brandao L. Lahue R.S. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 12438-12443Crossref PubMed Scopus (159) Google Scholar). In vivo studies of TNR stability have taken advantage of model systems in Escherichia coli, yeast, mice, and cell lines. Processes implicated in repeat tract instability include replication slippage, the direction of replication fork progression, lagging strand errors, Okazaki fragment processing, mismatch repair, gap filling, double strand break repair, and recombination (17Cleary J.D. Pearson C.E. Cytogenet. Genome Res. 2003; 100: 25-55Crossref PubMed Scopus (120) Google Scholar). These mechanisms are not mutually exclusive, and any combination of them may result in significant TNR expansion and a disease phenotype in higher organisms. Much attention has been focused on aberrations in DNA replication, a major source of TNR instability in proliferating cells. Chromosomal replication faces many obstacles during replication fork progression that could destabilize the genome and prove fatal if not overcome. One such obstacle stems from DNA secondary structure formation during replication. Studies have shown that TNRs associated with human diseases form stable secondary structures in vivo. Using an assay for hairpin formation, Moore et al. (3Moore H. Greenwell P.W. Liu C.P. Arnheim N. Petes T.D. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1504-1509Crossref PubMed Scopus (172) Google Scholar) showed that CAG, CTG, CCG, or CGG heteroduplex loops are inefficiently repaired during meiotic recombination and were copied during the next round of DNA replication. In contrast, AAG/CTT or CAA/TTG loops did not form hydrogen-bonded structures and were therefore removed (3Moore H. Greenwell P.W. Liu C.P. Arnheim N. Petes T.D. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1504-1509Crossref PubMed Scopus (172) Google Scholar). GAA/TTC repeats that cause Friedreich ataxia have also been shown to be destabilized during DNA replication (18Wells R.D. Parniewski P. Pluciennik A. Bacolla A. Gellibolian R. Jaworski A. J. Biol. Chem. 1998; 273: 19532-19541Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar, 19Sharma R. Bhatti S. Gomez M. Clark R.M. Murray C. Ashizawa T. Bidichandani S.I. Hum. Mol. Genet. 2002; 11: 2175-2187Crossref PubMed Google Scholar, 20Pollard L.M. Sharma R. Gomez M. Shah S. Delatycki M.B. Pianese L. Monticelli A. Keats B.J. Bidichandani S.I. Nucleic Acids Res. 2004; 32: 5962-5971Crossref PubMed Scopus (45) Google Scholar, 21Krasilnikova M.M. Mirkin S.M. Mol. Cell Biol. 2004; 24: 2286-2295Crossref PubMed Scopus (156) Google Scholar). However, non-structure-forming GTT repeats have a 1,000-fold lower expansion rate relative to hairpin forming CNG repeats (6Spiro C. Pelletier R. Rolfsmeier M.L. Dixon M.J. Lahue R.S. Gupta G. Park M.S. Chen X. Mariappan S.V. McMurray C.T. Mol. Cell. 1999; 4: 1079-1085Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar). This suggests that secondary structures can form in vivo and impair replication/repair enzymes. Studies in model organisms, such as S. cerevisiae, have shown that mutations in DNA replication enzymes, particularly Rad27 (yeast FEN-1 homolog), lead to TNR instability (6Spiro C. Pelletier R. Rolfsmeier M.L. Dixon M.J. Lahue R.S. Gupta G. Park M.S. Chen X. Mariappan S.V. McMurray C.T. Mol. Cell. 1999; 4: 1079-1085Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar, 22Johnson R.E. Kovvali G.K. Prakash L. Prakash S. Science. 1995; 269: 238-240Crossref PubMed Scopus (194) Google Scholar, 23Tishkoff D.X. Filosi N. Gaida G.M. Kolodner R.D. Cell. 1997; 88: 253-263Abstract Full Text Full Text PDF PubMed Scopus (394) Google Scholar, 24Kokoska R.J. Stefanovic L. Tran H.T. Resnick M.A. Gordenin D.A. Petes T.D. Mol. Cell Biol. 1998; 18: 2779-2788Crossref PubMed Scopus (167) Google Scholar, 25Freudenreich C.H. Kantrow S.M. Zakian V.A. Science. 1998; 279: 853-856Crossref PubMed Scopus (360) Google Scholar, 26Schweitzer J.K. Livingston D.M. Hum. Mol. Genet. 1998; 7: 69-74Crossref PubMed Scopus (164) Google Scholar, 27Schweitzer J.K. Livingston D.M. Genetics. 1999; 152: 953-963PubMed Google Scholar, 28Subramanian J. Vijayakumar S. Tomkinson A.E. Arnheim N. Genetics. 2005; 171: 427-441Crossref PubMed Scopus (33) Google Scholar). Rad27/FEN-1 is a multifunctional nuclease that plays a critical role in maintaining genome stability through RNA primer removal and long patch base excision repair. The role of FEN-1 in replication is well studied. During Okazaki fragment maturation, a 5′-flap is generated by polymerase δ (pol δ) strand-displacement synthesis. FEN-1 recognizes and cleaves the 5′-flap to create a nick, which is then ligated. FEN-1 interacts and works in a coordinated manner with proliferating cell nuclear antigen, pol δ, replication protein A, DNA ligase I, and DNA2 for efficient Okazaki fragment processing. In addition to its 5′-flap endonuclease activity (FEN), FEN-1 is also known as an obligate double-stranded DNA 5′ to 3′ exonuclease (EXO) that cleaves nick, gap, and 5′-recessed DNA as well as blunt ended DNA to a lesser extent (41Harrington J.J. Lieber M.R. EMBO J. 1994; 13: 1235-1246Crossref PubMed Scopus (368) Google Scholar, 42Shen B. Singh P. Liu R. Qiu J. Zheng L. Finger L.D. Alas S. BioEssays. 2005; 27: 717-729Crossref PubMed Scopus (113) Google Scholar). Recently, FEN-1 was also shown to possess a gap endonuclease (GEN) activity (29Parrish J.Z. Yang C. Shen B. Xue D. EMBO J. 2003; 22: 3451-3460Crossref PubMed Scopus (103) Google Scholar). The GEN activity of FEN-1 cleaves the template strand of a gapped DNA fork and bubble substrates that mimic a stalled DNA replication fork (29Parrish J.Z. Yang C. Shen B. Xue D. EMBO J. 2003; 22: 3451-3460Crossref PubMed Scopus (103) Google Scholar, 30Zheng L. Zhou M. Chai Q. Parrish J. Xue D. Patrick S.M. Turchi J.J. Yannone S.M. Chen D. Shen B. EMBO Rep. 2005; 6: 83-89Crossref PubMed Scopus (115) Google Scholar). All three activities are reported to be important for the function of FEN-1 in replication, recombination, repair, and probably apoptosis (29Parrish J.Z. Yang C. Shen B. Xue D. EMBO J. 2003; 22: 3451-3460Crossref PubMed Scopus (103) Google Scholar, 30Zheng L. Zhou M. Chai Q. Parrish J. Xue D. Patrick S.M. Turchi J.J. Yannone S.M. Chen D. Shen B. EMBO Rep. 2005; 6: 83-89Crossref PubMed Scopus (115) Google Scholar, 34Liu R. Qiu J. Finger L.D. Zheng L. Shen B. Nucleic Acids Res. 2006; 34: 1772-1784Crossref PubMed Scopus (33) Google Scholar, 41Harrington J.J. Lieber M.R. EMBO J. 1994; 13: 1235-1246Crossref PubMed Scopus (368) Google Scholar, 43Shen B. Nolan J.P. Sklar L.A. Park M.S. J. Biol. Chem. 1996; 271: 9173-9176Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar, 44Negritto M.C. Qiu J. Ratay D.O. Shen B. Bailis A.M. Mol. Cell Biol. 2001; 21: 2349-2358Crossref PubMed Scopus (44) Google Scholar). It has been proposed that FEN activity can only occur when FEN-1 can track along a single-stranded DNA flap but not double-stranded DNA to reach the cleavage site (31Murante R.S. Rust L. Bambara R.A. J. Biol. Chem. 1995; 270: 30377-30383Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar, 32Bambara R.A. Murante R.S. Henricksen L.A. J. Biol. Chem. 1997; 272: 4647-4650Abstract Full Text Full Text PDF PubMed Scopus (298) Google Scholar). If a hairpin or loop structure is formed by the displaced α-segment (the RNA primer and DNA segment that is synthesized by polymerase α), the FEN activity is inhibited. If that is the case in vivo, then the presence or absence of the Rad27 nuclease in yeast should make no difference in the rate of expansion during replication of the repeated sequence, such as (CTG)n. However, the expansion of (CTG)n in rad27 null mutants was 180-fold higher than in wild type yeast cells in the assay system employed by Spiro et al. (6Spiro C. Pelletier R. Rolfsmeier M.L. Dixon M.J. Lahue R.S. Gupta G. Park M.S. Chen X. Mariappan S.V. McMurray C.T. Mol. Cell. 1999; 4: 1079-1085Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar). The results illustrate the dynamics of the hairpin structure formation and more importantly demonstrate that Rad27 nuclease plays a role in resolving the intrinsic secondary structure of the displaced α-segment of Okazaki fragments. We therefore hypothesize that Rad27 may use an alternative pathway to resolve the α-segment when a stable secondary structure is built in. We propose that the concerted action of EXO and GEN activities of Rad27/FEN-1 can resolve various secondary structures in eukaryotic cells. By screening a pool of more than 100 point mutations of FEN-1 (30Zheng L. Zhou M. Chai Q. Parrish J. Xue D. Patrick S.M. Turchi J.J. Yannone S.M. Chen D. Shen B. EMBO Rep. 2005; 6: 83-89Crossref PubMed Scopus (115) Google Scholar), a human FEN-1 allele, FEN-1-E178A was characterized to abolish over 95% of the GEN activity and some of its EXO activity while it retained most of the FEN activity on 5′ double flap substrates. The substitution of glutamate at position 178 with alanine may cause a slight protein conformational change that alters substrate binding affinity, thereby biasing its nuclease activity profile. The E178A mutation is an ideal point mutation to study the effect of the loss of GEN and EXO activities on TNR expansion. The particular residue Glu178 is highly conserved across different species and lies near the active center important for catalysis. Since hFEN-1 and Rad27 share considerable sequence homology and are functionally conserved, we knocked the analogous point mutation E176A into the yeast genome. The point mutation led to considerable TNR instability and fragility but showed no mutator phenotype or sensitivity to UV or DNA-alkylating agents. We also purified the mutant and wild type yeast proteins to correlate the phenotype with the loss of each biochemical activity. Our study suggests that FEN activity is important for flap processing, whereas EXO and GEN activities may contribute to the resolution of the structured flap during Okazaki fragment maturation. Protein Expression and Purification—The construction of the protein expression vector encoding the His6-tagged wild type Saccharomyces cerevisiae Rad27 is as previously described (18Wells R.D. Parniewski P. Pluciennik A. Bacolla A. Gellibolian R. Jaworski A. J. Biol. Chem. 1998; 273: 19532-19541Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar). The plasmid for expression of the His6-tagged Rad27-E176A mutant protein was generated by the QuikChange site-directed mutagenesis protocol (Stratagene, La Jolla, CA) using primers E176AF (TATGCCGCAGCAAGTGCAGATATGGACACACTC) and E176AR (GAGTGTGTCCATATCTGCACTTGCTGCGGCATA) (the substituted codon is underlined). The pET28b vector containing Rad27 and the mutant gene was transformed into E. coli Rosetta cells (Stratagene, La Jolla, CA) for overexpression. The protein expression was performed as previously described, and all purification steps were carried out at 4°C (18Wells R.D. Parniewski P. Pluciennik A. Bacolla A. Gellibolian R. Jaworski A. J. Biol. Chem. 1998; 273: 19532-19541Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar). To purify His6-tagged Rad27 or E176A, the harvested cells were lysed in 50 ml of Bugbuster protein extraction reagent (Novagen, San Diego, CA) containing two tablets of complete EDTA free protease inhibitor mixture (Roche Applied Science), 50 μl of benzonase nuclease (Novagen, San Diego, CA), 5 mg of lysozyme, and 5 mm β-mercaptoethanol. The cell lysate was subsequently spun at 13,000 rpm for 15 min. An aliquot of 5 m NaCl was added to the cleared lysate to bring the final concentration of NaCl to 1 m and incubated on ice for 15–20 min. The lysate was again spun to obtain a clear supernatant containing recombinant Rad27 or E176A, which was then purified using a HisTrap™ FF column (Amersham Biosciences) according to a previously published protocol (18Wells R.D. Parniewski P. Pluciennik A. Bacolla A. Gellibolian R. Jaworski A. J. Biol. Chem. 1998; 273: 19532-19541Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar). The fraction of interest was dialyzed overnight into buffer A (30 mm HEPES, pH 7.8, 0.5% inositol, 0.25 mm EDTA, 0.01% Nonidet P-40, 1 mm dithiothreitol, and 30 mm KCl). The sample was then applied to a SP Sepharose column equilibrated with buffer B (50 mm MES, pH 6.0, with 0.02% sodium azide and 1 mm dithiothreitol). His6-tagged Rad27 or E176A was then eluted with buffer B using a linear gradient of NaCl (0–1 m). The fraction of interest was dialyzed overnight into buffer C (20 mm Tris, pH 7.5, 15% glycerol, 200 mm NaCl, and 2 mm β-mercaptoethanol). The protein was quantified by Bradford Protein Assay kit (Bio-Rad) using the microtiter plate assay and IgG as the protein standard. Nuclease Assays—32P-Labeled DNA substrates were prepared according to a previously described protocol (34Liu R. Qiu J. Finger L.D. Zheng L. Shen B. Nucleic Acids Res. 2006; 34: 1772-1784Crossref PubMed Scopus (33) Google Scholar). Oligonucleotides used for substrate preparation are specified in each experiment, and corresponding sequences are summarized in Table 1. The FEN, GEN, and EXO nuclease activities of Rad27 and E176A were assayed as previously described (30Zheng L. Zhou M. Chai Q. Parrish J. Xue D. Patrick S.M. Turchi J.J. Yannone S.M. Chen D. Shen B. EMBO Rep. 2005; 6: 83-89Crossref PubMed Scopus (115) Google Scholar). Briefly, an indicated concentration of Rad27 or E176A was incubated with FEN, GEN, or EXO DNA substrates, respectively, in 50 mm Tris-Cl (pH 8.0), 5 mm Mg2+, and 1 mm dithiothreitol. Reactions were carried out at 37 °C for 30 min if not specified. DNA substrates and cleavage products were resolved by DNA-sequencing PAGE, visualized with a PhosphorImager, and semiquantified with the ImageQuant software (GE Healthcare, Piscataway, NJ). The percentage of products was calculated by dividing the intensity of product bands by the total intensity of substrate and product bands.TABLE 1Oligonucleotides used for the construction of nuclease substratesOligonucleotideSequenceSubstratesBRF15′-GTTAAGATAGGTCTGCTTGGGATGTCAAGCAGTCCTAACTGGAAATCTAGCTCTGTGGAGTTGAGGCAGA GTCCTTAAGC-3′Double flap and nickCBRF1415′-GCTTAAGGACTCTGCCTCAACTCCACAGAGCTAGATTTCCC-3′Double flapBRF8-405′-CAGTTGTTGAATGCAAAGAAGAAGTGCCATTAATACCGGTAGTTAGGACTGCTTGACATCCCAAGCAGAC CTATCTTAAC-3′Double flapBRF8-55′-CCGGTAGTTAGGACTGCTTGACATCCCAAGCAGACCTATCTTAAC-3′Double flapBRF8-205′-GAAGTGCCATTAATACCGGTAGTTAGGACTGCTTGACATCCCAAGCAGACCTATCTTAAC-3′Double flapCBRF1405′-GCTTAAGGACTCTGCCTCAACTCCACAGAGCTAGATTTCC-3′NickCBRFG05′-AGTTAGGACTGCTTGACATCCCAAGCAGACCTATCTTAAC-3′NickFLGT45′-GATGTCAAGCAGTCCTAACTTTTTTTGAGGCAGAGTCC-3′GapSHEN145′-GGACTCTGCCTCAA-3′GapFLAPG1CS5′-AGTTAGGACTGCTTGACATC-3′GapCBRFG45′-AGGACTGCTTGACATCCCAAGCAGACCTATCTTAAC-3′GapCBRF1325′-GCTTAAGGACTCTGCCTCAACTCCACAGAGCT-3′GapCTG205′-(CTG)20TTTGAGGCAAGAGTCC-3′HairpinGTT205′-(GTT)20TTTGAGGCAAGAGTCC-3′Long flapZFAD5′-CACGTTGACTACCGTC-3′HairpinZFBR25′-GGACTCTTGCCTCAAAGACGGTAGTCAACGTG-3′HairpinFBR1G5′-GGACTCTGCCTCAAGACGGTAGTCAACGTG-3′Fold-backFLAP3B15′-CACGTTGACTACCGTCG-3′Fold-backFPG25′-TAGGACTGCTTGACATCATACAGTATGATGTCAAGCAGTCCTACTTTGAGGCAGAGTCC-3′Fold-backILT15′-CAGGAGGCGTCGGGTGGACGGTCCCTAATGGGTCAGTGCTGGT-3′Internal loopIL(T48)5′-ACCAGCACTGACCCATTAGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTC CGTCCACCCGACGCCTCCTG-3′Internal loopUa(TTC)9Ub5′-ACTGTGTCTGTC(TTC)9GCGACCTGATCC-3′Loop(GAA)9Ud5′-(GAA)9GACAGACACAGT-3′Loop(GAA)10Ud5′-(GAA)10GACAGACACAGT-3′Loop(GAA)12Ud5′-(GAA)12GACAGACACAGT-3′Loop(GAA)15Ud5′-(GAA)15GACAGACACAGT-3′Loop Open table in a new tab TNR Stability and Fragility Assays in Yeast—The RDKY2672 strain (MATa, ura3-52, his3Δ200, trp1Δ63, leu2Δ1, ade2Δ1, ade8, lys2-Bgl, hom3-10) was used for all of the studies. The rad27 deletion mutant strain was made by PCR-based gene disruption with the KanMX module as described by Wach et al. (35Wach A. Brachat A. Pohlmann R. Philippsen P. Yeast. 1994; 10: 1793-1808Crossref PubMed Scopus (2218) Google Scholar). The point mutation E176A was knocked in by using the two-step gene replacement strategy (36Scherer S. Davis R.W. Proc. Natl. Acad. Sci. U. S. A. 1979; 76: 4951-4955Crossref PubMed Scopus (478) Google Scholar). Colonies were screened for the gain of BsgI restriction site. The yeast strains Kar212 (MATα, Kar1-1, ade trp1-289, ura3-52, leu2-3, 112) CTG-0, 85, and 155 were kindly provided by Catherine Freudenreich (Tufts University, Boston, MA). Assays for trinucleotide repeat stability and fragility were done as described by Liu and Bambara (37Liu Y. Bambara R.A. J. Biol. Chem. 2003; 278: 13728-13739Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar). Mutator and Sensitivity Assays in Yeast—Mutation rates for the accumulation of Canr mutants and Hom+, Lys+ revertants were determined by fluctuation analyses by the method of the median (38Lea D.E. Coulson C.A. J. Genet. 1949; 49: 264-285Crossref PubMed Scopus (1072) Google Scholar) using 10 independent cultures per experiment as previously described (39Marsischky G.T. Filosi N. Kane M.F. Kolodner R. Genes Dev. 1996; 10: 407-420Crossref PubMed Scopus (491) Google Scholar). All rates are the average of two or three independent experiments. Mutation spectra were determined by DNA sequence analysis as previously described (39Marsischky G.T. Filosi N. Kane M.F. Kolodner R. Genes Dev. 1996; 10: 407-420Crossref PubMed Scopus (491) Google Scholar). UV and methyl methanesulfonate sensitivity assays were conducted as described by Reagan et al. (40Reagan M.S. Pittenger C. Siede W. Friedberg E.C. J. Bacteriol. 1995; 177: 364-371Crossref PubMed Google Scholar). Rad27-E176A Is Deficient in EXO and GEN Activities— FEN-1 possesses three activities that vary in efficacy, with FEN activity being the strongest and GEN activity being the weakest. As a result, increasing amounts of the proteins have to be used to visualize these activities in vitro. For biochemical characterization of Rad27-E176A and Rad27 proteins, the wild type and mutant proteins were overexpressed in E. coli cells and purified to >95% purity. Various substrates (i.e. double flap, nick, and gap) were tested. A double-flap substrate with a 1-nt 3′-flap is the optimal substrate for FEN-1 where the enzyme cuts at the base of the flap using its FEN activity (45Kao H.I. Henricksen L.A. Liu Y. Bambara R.A. J. Biol. Chem. 2002; 277: 14379-14389Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar). Two sets of experiments (concentration-dependent and time course) were done to quantify the three activities. The results showed that the mutant E176A lost ∼40% of EXO (Figs. 1B and 2B) and ∼95% of GEN activity (Figs. 1C and 2C), whereas the FEN-1 activity was almost the same as wild type Rad27 protein (Figs. 1A and 2A).FIGURE 2Activities of Rad27 and E176A on double flap, nick, and gap substrates. DNA substrates were labeled with 32P as indicated. Labeled substrates (1 pmol) were incubated with purified recombinant Rad27 proteins (WT or E176A), at 37 °C for different time points (0, 5, 10, 20, 40, and 60 min). A, FEN of 0.1 pmol of Rad27 and E176A proteins on 5′-labeled double flap substrate. B, EXO with 0.4 pmol of enzyme on 5′-labeled nick substrate; C, GEN activity with 0.8 pmol of enzyme on 3′-labeled gap substrate. In each panel, the top shows the schematic structure of corresponding DNA substrates. The middle shows the image of PAGE separating the DNA substrate and the cleavage products at different time points. The graph in the bottom represents the percentage cleavage of DNA substrates. Values are means of three independent assays. Rnd, random sequence.View Large Image Figure ViewerDownload Hi-res image Download (PPT) The preliminary tests indicate that the mutant has intact FEN activity. To test if the flap length has any effect on the FEN activity of WT and mutant proteins, substrates with flaps of different lengths (5, 20, and 40 nt) were tested. In the presence of a 3′-flap, the activity of the wild type protein is similar on flaps of all three lengths (5, 20, and 40 nt). The mutant protein has no significant difference in the activity as compared with the wild type protein, suggesting that E176A has almost intact FEN activity (Fig. 3). Mutant Enzyme E176A Cannot Process (CTG)20 Hairpin Structures as Efficiently as Wild Type Protein—We further tested the defect in EXO and GEN activities of Rad27-E176A with various probable TNR intermediate substrates (Fig. 4). Repeats that form DNA secondary structures are more likely to undergo TNR expansion (16Miret J.J. Pessoa-Brandao L. Lahue R.S. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 12438-12443Crossref PubMed Scopus (159) Google Scholar), because these structures inhibit recognition and processing by the repair machinery (46McMurray C.T. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1823-1825Crossref PubMed Scopus (185) Google Scholar, 47Gordenin D.A. Kunkel T.A. Resnick M.A. Nat. Genet. 1997; 16: 116-118Crossref PubMed Scopus (189) Google Scholar). Spiro et al. (6Spiro C. Pelletier R. Rolfsmeier M.L. Dixon M.J. Lahue R.S. Gupta G. Park M.S. Chen X. Mariappan S.V. McMurray C.T. Mol. Cell. 1999; 4: 1079-1085Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar) characterized synthetic flap templates to examine if hairpins indeed increase the rate of expansions. They found that FEN-1 cleavage is strongly inhibited by hairpins containing (CNG)n flaps. (CTG)20 has been demonstrated by NMR to have stable secondary structure in solution (6Spiro C. Pelletier R. Rolfsmeier M.L. Dixon M.J. Lahue R.S. Gupta G. Park M.S. Chen X. Mariappan S.V. McMurray C.T. Mol. Cell. 1999; 4: 1079-1085Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar). Here we employ the same (CTG)20 hairpin substrate labeled at 5′- and 3′-ends to compare the cleavage efficiencies of WT and mutant proteins. To test the activity on hairpin substrates in our experiments, 400 fmol of protein was used. This substrate is an intermediate for TNR expansion that, if not resolved, can integrate into the genome. On this substrate, EXO activity cleaves nucleotides from the 5′-end of the hairpin (Fig. 4A), creating a substrate for gap-dependent endonuclease activity. W" @default.
• W2080755654 created "2016-06-24" @default.
• W2080755654 creator A5013552041 @default.
• W2080755654 creator A5034982989 @default.
• W2080755654 creator A5050194549 @default.
• W2080755654 creator A5067537622 @default.
• W2080755654 creator A5071260275 @default.
• W2080755654 date "2007-02-01" @default.
• W2080755654 modified "2023-09-26" @default.
• W2080755654 title "Concerted Action of Exonuclease and Gap-dependent Endonuclease Activities of FEN-1 Contributes to the Resolution of Triplet Repeat Sequences (CTG) - and (GAA) -derived Secondary Structures Formed during Maturation of Okazaki Fragments" @default.
• W2080755654 cites W146312310 @default.
• W2080755654 cites W1506492200 @default.
• W2080755654 cites W1729887059 @default.
• W2080755654 cites W1966666560 @default.
• W2080755654 cites W1976019826 @default.
• W2080755654 cites W1981277651 @default.
• W2080755654 cites W1986435856 @default.
• W2080755654 cites W1989547927 @default.
• W2080755654 cites W1994232734 @default.
• W2080755654 cites W2003329456 @default.
• W2080755654 cites W2012085970 @default.
• W2080755654 cites W2013735712 @default.
• W2080755654 cites W2014223000 @default.
• W2080755654 cites W2020390201 @default.
• W2080755654 cites W2021091954 @default.
• W2080755654 cites W2023476869 @default.
• W2080755654 cites W2025133427 @default.
• W2080755654 cites W2026380481 @default.
• W2080755654 cites W2033058075 @default.
• W2080755654 cites W2033229710 @default.
• W2080755654 cites W2034535098 @default.
• W2080755654 cites W2038220637 @default.
• W2080755654 cites W2038529419 @default.
• W2080755654 cites W2042160009 @default.
• W2080755654 cites W2052893592 @default.
• W2080755654 cites W2053076841 @default.
• W2080755654 cites W2053919212 @default.
• W2080755654 cites W2057787531 @default.
• W2080755654 cites W2064264662 @default.
• W2080755654 cites W2069157381 @default.
• W2080755654 cites W2076790103 @default.
• W2080755654 cites W2085617522 @default.
• W2080755654 cites W2087067785 @default.
• W2080755654 cites W2088489316 @default.
• W2080755654 cites W2090133673 @default.
• W2080755654 cites W2094502358 @default.
• W2080755654 cites W2097095628 @default.
• W2080755654 cites W2097784517 @default.
• W2080755654 cites W2100057937 @default.
• W2080755654 cites W2106837356 @default.
• W2080755654 cites W2115237139 @default.
• W2080755654 cites W2118767483 @default.
• W2080755654 cites W2120089138 @default.
• W2080755654 cites W2133167492 @default.
• W2080755654 cites W2134573093 @default.
• W2080755654 cites W2136218692 @default.
• W2080755654 cites W2140882548 @default.
• W2080755654 cites W2151469819 @default.
• W2080755654 cites W2156532481 @default.
• W2080755654 cites W2158155007 @default.
• W2080755654 cites W2159203886 @default.
• W2080755654 cites W2169526682 @default.
• W2080755654 cites W2169553212 @default.
• W2080755654 cites W2170472485 @default.
• W2080755654 doi "https://doi.org/10.1074/jbc.m606582200" @default.
• W2080755654 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17138563" @default.
• W2080755654 hasPublicationYear "2007" @default.
• W2080755654 type Work @default.
• W2080755654 sameAs 2080755654 @default.
• W2080755654 citedByCount "51" @default.
• W2080755654 countsByYear W20807556542013 @default.
• W2080755654 countsByYear W20807556542014 @default.
• W2080755654 countsByYear W20807556542015 @default.
• W2080755654 countsByYear W20807556542016 @default.
• W2080755654 countsByYear W20807556542017 @default.
• W2080755654 countsByYear W20807556542018 @default.
• W2080755654 countsByYear W20807556542019 @default.
• W2080755654 countsByYear W20807556542020 @default.
• W2080755654 countsByYear W20807556542021 @default.
• W2080755654 countsByYear W20807556542022 @default.
• W2080755654 crossrefType "journal-article" @default.
• W2080755654 hasAuthorship W2080755654A5013552041 @default.
• W2080755654 hasAuthorship W2080755654A5034982989 @default.
• W2080755654 hasAuthorship W2080755654A5050194549 @default.
• W2080755654 hasAuthorship W2080755654A5067537622 @default.
• W2080755654 hasAuthorship W2080755654A5071260275 @default.
• W2080755654 hasBestOaLocation W20807556541 @default.
• W2080755654 hasConcept C11305352 @default.
• W2080755654 hasConcept C12554922 @default.
• W2080755654 hasConcept C153911025 @default.
• W2080755654 hasConcept C185592680 @default.
• W2080755654 hasConcept C2777028655 @default.
• W2080755654 hasConcept C2777501222 @default.
• W2080755654 hasConcept C2910588993 @default.
• W2080755654 hasConcept C54355233 @default.
• W2080755654 hasConcept C552990157 @default.
• W2080755654 hasConcept C73573662 @default.
• W2080755654 hasConcept C82381507 @default.

• next