FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2080776632> ?p ?o ?g. }

• W2080776632 endingPage "40741" @default.
• W2080776632 startingPage "40732" @default.
• W2080776632 abstract "The endothelial nitric-oxide synthase gene is constitutively expressed in endothelial cells. Several transcriptionally active regulatory elements have been identified in the proximal promoter, including a GATA-2 and an Sp-1 binding site. Because they cannot account for the constitutive expression of endothelial nitric-oxide synthase gene in a restricted number of cells, we have searched for other cell-specific regulatory elements. By DNase I hypersensitivity mapping and deletion studies we have identified a 269-base pair activator element located 4.9 kilobases upstream from the transcription start site that acts as an enhancer. DNase I footprinting and linker-scanning experiments showed that several regions within the 269-base pair enhancer are important for transcription factor binding and for full enhancer activity. The endothelial specificity of this activation seems partly due to interaction between this enhancer in its native configuration and the promoter in endothelial cells. EMSA experiments suggested the implication of MZF-like, AP-2, Sp-1-related, and Ets-related factors. Among Ets factors, Erg was the only one able to bind to cognate sites in the enhancer, as found by EMSA and supershift experiments, and to activate the transcriptional activity of the enhancer in cotransfection experiments. Therefore, multiple protein complexes involving Erg, other Ets-related factors, AP-2, Sp-1-related factor, and MZF-like factors are important for the function of this enhancer in endothelial cells. The endothelial nitric-oxide synthase gene is constitutively expressed in endothelial cells. Several transcriptionally active regulatory elements have been identified in the proximal promoter, including a GATA-2 and an Sp-1 binding site. Because they cannot account for the constitutive expression of endothelial nitric-oxide synthase gene in a restricted number of cells, we have searched for other cell-specific regulatory elements. By DNase I hypersensitivity mapping and deletion studies we have identified a 269-base pair activator element located 4.9 kilobases upstream from the transcription start site that acts as an enhancer. DNase I footprinting and linker-scanning experiments showed that several regions within the 269-base pair enhancer are important for transcription factor binding and for full enhancer activity. The endothelial specificity of this activation seems partly due to interaction between this enhancer in its native configuration and the promoter in endothelial cells. EMSA experiments suggested the implication of MZF-like, AP-2, Sp-1-related, and Ets-related factors. Among Ets factors, Erg was the only one able to bind to cognate sites in the enhancer, as found by EMSA and supershift experiments, and to activate the transcriptional activity of the enhancer in cotransfection experiments. Therefore, multiple protein complexes involving Erg, other Ets-related factors, AP-2, Sp-1-related factor, and MZF-like factors are important for the function of this enhancer in endothelial cells. nitric-oxide synthase endothelial NOS human eNOS base pair(s) kilobase pair(s) human microdermal endothelial cell hypersensitive site polymerase chain reaction electromobility shift assay Nitric-oxide synthases (NOS)1 are enzymes that metabolize l-arginine to form NO, and three isoforms have been identified. In the vascular system, the NOS III isoform (eNOS), first identified in endothelial cells, regulates vascular tone (1Palmer R.M.J. Rees D.D. Ashton D.S. Moncada S. Biochem. Biophys. Res. Commun. 1988; 153: 1251-1256Crossref PubMed Scopus (1127) Google Scholar), platelet aggregation (2Alheid U. Frolich J.C. Förstermann U. Thromb. Res. 1987; 47: 561-571Abstract Full Text PDF PubMed Scopus (132) Google Scholar), and smooth muscle cell proliferation (3Garg U.C. Hassid A. J. Clin. Invest. 1989; 83: 1774-1777Crossref PubMed Scopus (1997) Google Scholar). The enzyme is activated by increased intracellular calcium concentration and by translocation from caveolae to cytosol (for review see Ref. 4Fleming I. Busse R. Cardiovasc Res. 1999; 43: 532-541Crossref PubMed Scopus (359) Google Scholar). The eNOS expression is constitutive in endothelial cells, but under several physiological and pathological conditions, transcriptional regulation (5Navarro-Antolin J. Rey-Campos J. Lamas S. J. Biol. Chem. 2000; 275: 3075-3080Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar, 6Ziegler T. Silacci P. Harrison V.J. Hayoz D. Hypertension. 1998; 32: 351-355Crossref PubMed Scopus (208) Google Scholar), and changes in mRNA stability (7Yoshizumi M. Perrella M.A. Burnett Jr., J.C. Lee M.E. Circ. Res. 1993; 73: 205-209Crossref PubMed Scopus (705) Google Scholar, 8Laufs U. Liao J.K. J. Biol. Chem. 1998; 273: 24266-24271Abstract Full Text Full Text PDF PubMed Scopus (978) Google Scholar) have been described. Several studies were aimed at characterizing the 5′-upstream sequences that drive transcriptional activity of the promoter up to 3500 bp. A major transcriptional effect was identified for Sp-1/Sp-3 and GATA-2 transcription factors, for which binding sites are located respectively at −103 and −230 bp upstream from the major transcription start site (9Zhang R. Min W. Sessa W.C. J. Biol. Chem. 1995; 270: 15320-15326Abstract Full Text Full Text PDF PubMed Scopus (201) Google Scholar, 10Wariishi S. Miyahara K. Toda K. Ogoshi S. Doi Y. Ohnishi S. Mitsoui Y. Yui Y. Kawai C. Shizuta Y. Biochem. Biophys. Res. Commun. 1995; 216: 729-735Crossref PubMed Scopus (34) Google Scholar, 11Tang J.-L. Zembowicz A. Xu X.-M. Wu K. Biochem. Biophys. Res. Commun. 1995; 213: 673-680Crossref PubMed Scopus (36) Google Scholar). A second positive regulatory domain was detected between −140/−120 bp in the proximal promoter (12Karantzoulis-Fegaras F. Antoniou H. Lai S.L.M. Kulkarni G. D'Abreo C. Wong G.K.T. Miller T.L. Chan Y. Atkins J. Wang Y. Marsden P.A. J. Biol. Chem. 1999; 274: 3076-3093Abstract Full Text Full Text PDF PubMed Scopus (183) Google Scholar). It was also shown that a 1600-bp human eNOS (heNOS) promoter fragment allows the endothelial expression of a reporter gene in transgenic mice but is not sufficient to observe a full expression of the gene in all endothelial territories and to reproduce the endogenous pattern of expression (13Guillot P.V. Guan J. Liu L. Kuivenhoven J.A. Rosenberg R.D. Sessa W.C. Aird W.C. J. Clin. Invest. 1999; 103: 799-805Crossref PubMed Scopus (56) Google Scholar). In this study, we characterized cis-acting sequences, located 4.9 kb upstream from the major transcription start site, that increase constitutive expression of the heNOS gene in endothelial cells. Analysis of the enhancer sequence by DNase I footprinting and linker-scanning mutants led us to identify five major binding sites, in particular for Erg and other Ets family member proteins, for Sp-1-related factors, and for MZF-like transcription factors. Sonicated salmon sperm DNA, proteinase K, RNase A, poly(dI·dC) were from Roche Molecular Biochemicals. MCDB-131 medium, hydrocortisone and Nonidet P40 (Igepal) from Sigma. Fetal calf serum, penicillin and streptomycin were from Seromed (Berlin, Germany). Epidermal growth factor, human recombinant and polyethyleneimine suspension (EXGEN 500), were from Euromedex (Souffelweyersheim, France). RPMI medium, phosphate-buffered saline, and l-glutamine were from Life Technologies, Inc. DNase I was from Worthington (Lakewood, NJ). HMEC-1 are human dermal microvascular endothelial cells immortalized by transfection with a pBR322-derived plasmid containing the coding region for the simian virus 40 A gene product, large T antigen, and were a gift from Thomas J. Lawley (Emory University, School of Medicine, Atlanta, GA). Human umbilical vein endothelial cells were isolated as described by Jaffe et al.(14Jaffe E.A. Nachman R.L. Becker C.G. Minick C.R. J. Clin. Invest. 1973; 52: 2745-2756Crossref PubMed Scopus (6019) Google Scholar). Both cell types were cultured in MCDB-131 medium supplemented with 20% heat-inactivated fetal calf serum, 2 mml-glutamine, 100 units/ml penicillin, 100 μg/ml streptomycin, 10 ng/ml human recombinant epidermal growth factor, and 1 μg/ml hydrocortisone. HeLa cells were cultured in RPMI medium supplemented by 10% heat-inactivated fetal calf serum, 2 mml-glutamine, 100 units/ml penicillin, and 100 μg/ml streptomycin. Cells were maintained at 37 °C and 5% CO2 in an humidified incubator. In situ DNase I digestion method was performed as described previously by Stewartet al. (15Stewart A.F. Reik A. Schütz G. Nucleic Acids Res. 1991; 19: 3157Crossref PubMed Scopus (35) Google Scholar), using 0.2% and 0.05%, respectively, of Nonidet P-40 for permeabilization of HMEC-1 or HeLa cells. After phenol extraction, DNA samples (30 μg) were subsequently submitted to Southern blot analysis. DNase I hypersensitivity assay was also performed on isolated nuclei with standard procedures (16Wu C. Nature. 1980; 286: 854-860Crossref PubMed Scopus (753) Google Scholar). A PCR product extending from 5′-upstream from the DNase I hypersensitive site HS1 to downstream from the initiator methionine codon, was obtained by PCR using a commercially available long PCR kit (Taq+ Precision PCR system, Stratagene La Jolla, CA) and a human eNOS cosmid clone as template (17Nadaud S. Bonnardeaux A. Lathrop M. Soubrier F. Biochem. Biophys. Res. Commun. 1994; 198: 1027-1033Crossref PubMed Scopus (200) Google Scholar). The PCR product was subcloned between theNheI and HindIII sites of the firefly luciferase reporter gene vector pGL3-basic (Promega, WI). For generation of deletion mutants, the construct was partially digested by exonuclease III/S1 nuclease using a commercial kit (Erase-a-base system, Promega). All constructs were sequenced using Thermosequenase dye terminator cycle sequencing (Amersham Pharmacia Biotech) and an Applied Biosystems 373 DNA sequencer. Sense (pGL3-p2) and antisense (pGL3-p42) constructs containing the 269 bp activator element (−4907/−4638) in both orientations were generated by subcloning a 269-bp Pfupolymerase amplification product 5′ to the 1703-bp promoter fragment of the heNOS gene. For point mutation generation, a commercial kit (Quick Change mutagenesis kit, Stratagene) was used with pGL3-p2 as template. Constructs and mutants were checked by sequencing. Transfection assays were carried out using polyethyleneimine suspension in a commercially available solution (EXGEN 500). Briefly, HMEC-1 and HeLa cells were seeded on 2-cm2 multidish plates at 100 × 103/well and 50 × 103/well respectively, incubated 24 h, and then treated with a buffer (150 mmNaCl) containing 0.134 pmol of the relevant reporter gene vector, 0.134 pmol of pRenilla luciferase gene vector (Promega) as transfection standardizing control and polyethyleneimine suspension (4 μl for 2 μg of total DNA). Coexpression experiments were performed using expression vectors containing cDNA for various transcription factors, pCDNA1-Ets-2 (gift of Dr. J. Leiden), pCDNA1-Elf-1 (18John S. Reeves R.B. Lin J.X. Child R. Leiden J.M. Thompson C.B. Leonard W.J. Mol. Cell. Biol. 1995; 15: 1786-1796Crossref PubMed Google Scholar), pSG5-Ets1 (19Wasylyk C. Gutman A. Nicholson R. Wasylyk B. EMBO J. 1991; 10: 1127-1134Crossref PubMed Scopus (326) Google Scholar), pCMV5-Elk-1-FLAG (gift of Dr. R. Davis), pSG5-p55-Erg (20Schwachtgen J.L. Janel N. Barek L. Duterque-Coquillaud M. Ghysdael J. Meyer D. Kerbiriou-Nabias D. Oncogene. 1997; 15: 3091-3102Crossref PubMed Scopus (79) Google Scholar), and pCDNA3-kz-MZF-1 (gift of Dr. J. Morris). Identical experimental procedures were used, except that relevant expression vectors were included in polyethyleneimine suspension at convenient ratio compared with reporter vector. Luciferase activity was measured by luminometry using Dual luciferase revelation system (Promega) as described by the manufacturer. HMEC-1 nuclear extracts were prepared as described previously (21Dignam J.D. Lebovitz R.M. Roeder R.G. Nucleic Acids Res. 1983; 11: 1475-1489Crossref PubMed Scopus (9164) Google Scholar). For whole cell extract preparation, HeLa cells were seeded on a 2-cm2 multidish plate and transfected with 2 μg of relevant expression vectors or empty control vectors. After 40 h, the cells were harvested in 40 mm Tris-HCl, pH 7.4, 1 mm EDTA, 150 mm NaCl, collected by low speed centrifugation (800 ×g, 4 °C), and then resuspended in 40 μl of buffer containing 20 mm Tris-HCl, pH 7.4, 0.4 m KCl, 2 mm dithiothreitol, 10% glycerol. Cells were broken by freezing and thawing (three times), cell debris were removed by centrifugation (800 × g, 10 min., 4 °C), and the supernatant (whole cell extract) was aliquoted and stored at −70 °C. A fragment of the heNOS gene promoter region (−4907 to −4638) was obtained by PCR amplification using primers flanking the enhancer. For radioactive labeling, one primer (1.5 pmol) was end-labeled with [γ-32P]ATP by T4 DNA polynucleotide kinase (Life Technologies, Inc.) before a 20-cycle PCR amplification using 10 pmol of the second primer. DNase I footprinting analyses were performed by incubating 5,000 cpm of probe with 20–30 μg of nuclear extracts for 15 min, at room temperature, in 25 mm Hepes, 50 mm KCl, 0.1 mm EDTA, 5 mm MgCl2, 5 mm CaCl2, 0.5 mmphenylmethylsulfonyl fluoride, 1 mm dithiothreitol, and 10% glycerol before submission to increasing amounts of DNase I for 2 min. Control reactions were performed in the absence of proteins. Reactions were stopped by addition of stop buffer (200 μg of proteinase K, 50 mm EDTA, 100 μg/ml tRNA, and 1% SDS) and incubated 1 h at 50 °C. Samples were phenol extracted, ethanol precipitated, and recovered in (98% formamide, 10 mm EDTA, 0.1% bromphenol blue, 0.1% xylene cyanol), denatured, and loaded, together with a G+A Maxam-Gilbert sequence of the probe, on a 6% acrylamide, 8 m urea sequencing gel. Seven linker-scanning mutations were introduced in the pGL3-p2 construct. For each mutant, two amplicons, the 5′ and the 3′, were synthesized using a PCR-based method with Pfu polymerase. Primers used to create the linker-scanning mutants are listed in Table I. The 5′ amplicon was generated using two primers designated MluB10 and Brx. MluB10 is a gene-specific, sense primer that corresponds to the −4907/−4883 region of the heNOS promoter and has a Mlu I restriction site at its 5′ end. Brx primers, where x corresponds to the location of the specific bases to be mutated, are 24–29 base antisense primers containing a sequence identical to the promoter sequence linked to a mutated region at the 5′-end, heterologous to the heNOS sequence and containing a restriction site. The 3′ amplicon was generated similarly using a common antisense primer HSFP3′ (positions −4684/−4638) and different Scx primers containing a sequence identical to heNOS promoter and a 5′-end heterologous to the heNOS sequence and containing a restriction site identical to the corresponding Brx oligonucleotide. After restriction digestion and purification, each 5′ amplicon was ligated to its corresponding 3′ amplicon, and the ligation product was submitted to a further Pfu amplification reaction. The 269-bp mutated product was then subcloned in front of the 1703-bp promoter in pGL3–1703 construct. Clones obtained were checked by sequencing.Table IPrimer pairs used to construct all pGL3-p2 linker-scanning mutants and mutations introducedPrimer nameMutant namePrimer sequenceMutation introducedMlu-B105′-CGTGACGCGTCAGCACTCAGCATGAGTTACA-3′Br-Nhe-4802/4793pGL3-LS-A5′-CTAGGCTAGCGCGGGGAAAGGGAAGGGAG-3′ WT 5′-GCTCCCCACCCGTCT-3′Sc-Nhe-4802/4793pGL3-LS-A5′-GCGAGCTAGCACTCCTTGCCAGCAGGC-3′ LSA 5′-GCGCTAGCACTCCCT-3′Br-Bgl-4792/4785pGL3-LS-B1 5′-CGAGATCTACCGGGTGGGGAGCGG-3′ WT 5′-CGTCCTTGCCAGCA-3′Sc-Bgl-4792–4785pGL3-LS-B1 5′-GTAGATCTCGCAGGCAGGAAGGAA-3′LSB1 5′-CGGTAGATCTCGCA-3′Br-Bgl-4784/4776pGL3-LS-B2 5′-CGAGATCTATGGCAAGGACGGGTG-3′ WT 5′-CCAGCAGGCAGGAA-3′Sc-Bgl-4784/4776pGL3-LS-B2 5′-ATAGATCTCGAAGGAAGCTGCTCA-3′LSB2 5′-CCATAGATCTCGAA-3′Br-Eco-4765/4756pGL3-LS-C15′-GTGAATTCGTCAGCTTCCTTCCTGC-3′ WT 5′-CTGACGAATTCACAA-3′Sc-Eco-4765/4756pGL3-LS-C15′-ACGAATTCACAAGGGTGGGGTACT-3′LSC1 5′-CTGACGAATTCACAA-3′Br-Eco-4765/4756pGL3-LS-C25′-CTGAATTCGTCACTATGAGCAGCTT-3′ WT 5′-GTGCAAGGGTGGGGT-3′Sc-Eco-4755/4746pGL3-LS-C2 5′-ACGAATTCAGGTACTTCCAGCTCA-3′LSC2 5′-GTGACGAATTCAGGT-3′Br-Eco-4755/4746pGL3-LS-C35′-GTGAATTCGTCCACCCTTGCACTAT-3′ WT 5′-GGGGTACTTCCAGCT-3′Sc-Eco-4745/4745pGL3-LS-C35′-ACGAATTCACGCTCACACTGAACAG-3′LSC3 5′-GGACGAATTCACGCT-3′Br-Bam-4697/4687pGL3-LS-D5′-ACGGATCCACGACTCTTTATAGCCC-3′WT 5′-GTCAGGGACTTCCGCT-3′Sc-Bam-4697/4687pGL3-LS-D5′-GTGGATCCGTGCTCAGTCACCCCTG-3′LSD 5′-GTCGTGAATCCGTGCT-3′HSFP3′5′-GGCCTGGGGTGTGTGCATTGG-3′Wild type (WT) sequences are underlined, and mutations are italicized. Open table in a new tab Wild type (WT) sequences are underlined, and mutations are italicized. Oligonucleotides corresponding to DNase I protected regions were designed according to the sequence established previously (see Table II). Crude nuclear extracts (5–7 μg) or whole cell extracts of cells transfected with expression vector (4 μg) were incubated with approximately 0.15 pmol of [γ-32P]ATP end-labeled double-stranded oligonucleotides in 20 mm Hepes, pH 7.9, 50 mmKCl, 3 mm MgCl2, 10% glycerol, 1 mm dithiothreitol, 0.5 mm phenylmethylsulfonyl fluoride, 1 μg of poly(dI·dC), and 10 μg of bovine serum albumin. Complexes were resolved by electrophoresis on prerun acrylamide:bisacrylamide (29:1) native gels. Supershift experiments were performed by preincubating nuclear or cell extracts with relevant polyclonal antiserum or purified polyclonal antibody prior to addition of labeled probes. Antibodies against MZF-1/1b or MZF-1b from J. Morris (Indiana University Medical Center, Indianapolis, IN), anti-NERF 1/1b/2 and anti-Erg 1/2 antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA.).Table IIOligonucleotides used in EMSA and for point mutation generationOligonucleotidesSequence (5′ to 3′: sense strand)FPA-WTTTTCCCCGCTCCCCACCCGTCCTTGCCAGCGTACFPA-MTTTCCCCGCGCTAGCGAT ATCCTTGCCAGCGTACFPA-m1TTTCCCCGCGCTACACCCGTCCTTGCCAGCGTACFPA-m2TTTCCCCGCTCCCAGCGCGTCCTTGCCAGCGTACFPB2-WTCTTGCCAGCAGGCAGGAAGGAAFPB2mCTTGCCAGCAGGCAGATAGGAAEts −4775 mutCCTTGCCAGCAGGCAGCTAGGAAGCTGCTCFPC1–3-WTGCTCATAGTGCAAGGGTGGGGTACTTCCAGCTCACFPC-mGCTCATAGTGCAAGGGTGGGGTACTATCAGCTCACFPD-WTGAGTCAGGGACTTCCGCTCAGTCAFPD-mGAGTCAGGCACTCGTGCTCAGTCAEts −4688 mutGAGTCAGGGACTCGAGCTCAGTCACCCMZF consensusCGCCAGGCCTCCCCCTCCCGAGGATGTAACMZF consensus mutantCGCCAGGCCTCCTTTTCCCGAGGATGTAACEts consensusTCGAGGGGAGGAAATGGGTGTCGAAP2 consensusGATCGAACTGACCGCCCGCGGCCCGTSP1 consensusATTCGATCGGGGCGGGGCGAGBinding sites are underlined, and mutations are bold and italicized. Open table in a new tab Binding sites are underlined, and mutations are bold and italicized. Enhancer sequences were checked for transcription binding sites using Transfac data base and MatInspector 2.0 software (22Quandt K. Frech K. Karas H. Wingender E. Werner T. Nucleic Acids Res. 1995; 23: 4878-4884Crossref PubMed Scopus (2427) Google Scholar). All transfection data are expressed as the means ± S.E., quantitative results were analyzed by the Student's t test. Analysis of cotransfections experiments in HMEC-1 and HeLa cells were performed using a two-way analysis of variance, with a test of interaction. DNase I hypersensitivity experiments were performed on permeabilized cells as well as on isolated nuclei. Results obtained with permeabilized cells are shown, but similar results were obtained with the two methods. Using a probe located at the 3′ edge of a large HindIII restriction fragment located in the 5′ region of the heNOS gene (Fig. 1 A), three hypersensitive sites were detected by Southern blot experiments in the heNOS gene in HMEC-1 (Fig. 1 B). From the size of these fragments, it can be deduced that these sites are located approximately at 5 kb (HS1), 1.9 kb (HS2), and 0.9 kb (HS3) upstream from the major transcription start site (Fig. 1 A). The distal hypersensitive site (HS1) does not correspond to any previously identified regulatory regions of the heNOS promoter. Using HeLa cells that do not express eNOS, as observed by reverse transcription-PCR (data not shown), none of these hypersensitive sites could be detected in similar experiments (Fig. 1 C). A 6-kb promoter fragment was obtained, using a PCR-based method, and cloned 5′ to a luciferase reporter gene (pGL3-basic). After exonuclease III digestion of this plasmid (pGL3–6090), different deletion mutant constructs of the heNOS promoter were obtained and transfected into HMEC-1. As shown in Fig. 2 A, transfections of HMEC-1 performed with pGL3–6090 construct showed a 5-fold increase of the promoter activity, compared with that obtained with the 1703-bp promoter fragment (pGL3–1703). Progressive deletions from −6090 to −4907 did not show significant reduction of transcriptional activity. Deletions from −4907 to −4638 returned transcription to the level obtained with pGL3–1703, indicating the existence of an activator element located between positions −4907 and −4638 of the promoter. Deletion of the promoter from −4638 to −1703 did not significantly influence the promoter activity (data not shown). Deletions from −1703 to −782 showed a slight decrease in the promoter activity (30%; data not shown). To investigate the enhancer characteristics of the distal activator element (−4907/−4638), it was cloned in both orientations immediately 5′ to the 1703-bp promoter (pGL3-p2 and pGL3-p42) or 5′ to an heterologous SV40 promoter (pGL3-SV40-Enh). Transfection experiments performed in HMEC-1 with pGL3-p2 (sense construct) and pGL3-p42 (antisense construct) showed a transcriptional activity similar to pGL3–4907 (Fig. 2 B). Similarly, transfection experiments using pGL3-SV40-Enh showed an enhanced transcriptional activity as compared with the SV40 promoter (Fig. 2 B). A similar pattern of transcriptional activation was observed with the different constructs in human umbilical vein endothelial cells (Fig. 2 C), demonstrating similar mechanisms of activation in the two endothelial cell models. In contrast, transfection experiments using HeLa cells showed no transcriptional activation of the native promoter by the heNOS distal enhancer, because no difference in transcriptional activity was observed between pGL3–4638 and pGL3–4907 (Fig. 2 D). However, the pGL3-p2 construct showed a 3-fold increase in transcriptional activity in HeLa cells compared with the 1703-bp promoter (Fig. 2 D). A large increase of transcriptional activity was also observed when using the pGL3-SV40-Enh construct compared with pGL3-SV40 in HeLa (Fig. 2 D). DNase I footprint experiments were performed to identify regulatory elements involved in the heNOS distal enhancer activity. An end-labeled PCR-product corresponding to the 269-bp activator element of the promoter was used as a probe in footprint experiments with HMEC-1 nuclear extracts. As shown in Fig. 3, nuclear proteins protected the sense probe in four regions, named A, B, C, and D (Fig. 3 A). The protected element A spans 8 bp and is limited in its 3′ part by a DNase I-hypersensitive site. Element B spans approximately 15 bp, and element C spans 30 bp. Element D spans 6 bp and exhibits an hypersensitive site immediately downstream. Using an antisense probe, we observed protection over elements A, B, and C, but element D was not protected (Fig. 3 A). To understand the role of each DNase I protected element, a systematic mutational analysis was conducted by mutating 8–10 bp of each element (Table I). These linker-scanning studies allowed functional binding sites to be identified among the four DNase I protected elements. Five linker-scanning mutants (pGL3-p2-LSA, pGL3-p2-LSB2, pGL3-p2-LSC2, pGL3-p2-LSC3, and pGL3-p2-LSD) showed a clear, significant decrease in transcriptional activity compared with the pGL3-p2 wild type construct in HMEC-1 (Fig. 4). The mutants pGL3-p2-LSA, pGL3-p2-LSC2, and pGL3-p2-LSD conserved 30–35% of the enhancer activity, whereas pGL3-p2-LSB2 and pGL3-p2-LSC3 no longer exhibited an enhancer effect. In contrast, the linker-scanning mutant pGL3-p2-LSB1 kept 60% of the enhancer activity, and the linker-scanning mutant pGL3-p2-LSC1 had no effect on enhancer activity. These data demonstrate the functional role of five regions of the enhancer in the regulation of basal heNOS expression.Figure 4Transcriptional activities of the linker-scanning mutants in HMEC-1. Linker-scanning mutations were introduced in pGL3-p2 construct by substituting 8–10 bp in the different regions protected by DNase I footprinting (Table I).Boxes represent DNase I protected elements A–D. Black crosses represent linker-scanning mutations. Sequence of mutations are described in Table I. Transcriptional activities of enhancer construct pGL3-p2 and of the different linker-scanning mutants were compared with that of pGL3–1703 promoter. Data are expressed as the means ± S.E. of five independent experiments (duplicate determination). *, p < 0.05, relative to pGL3-p2.View Large Image Figure ViewerDownload (PPT) A 34-bp oligonucleotide (FPA-WT) was designed to be centered on footprint element A, overlapping 15 bp of footprint B (Fig. 5 A). Several DNA-protein complexes were observed when using a labeled FPA-WT probe in EMSA experiments (Fig. 5 C, lanes 2 and 12). Addition of 10–100-fold molar excess of cold competitor FPA-WT oligonucleotide, suppressed all the complexes (lanes 3,4, 13, and 14). Computer analysis of the FPA-WT sequence revealed putative binding sites for several transcription factors located in element A, in particular for MZF-1 zinc finger transcription factors and for Krüppel-like transcription factors family members (Fig. 5 A). FPA-derived oligonucleotides were designed (Fig. 5 B and TableII). Oligonucleotides mutated for the entire A site (FPA-M) or for the MZF-1 consensus sequence 5′-TCCCCA-3′ (FPA-m2) failed to compete for complexes formation (Fig. 5 C, lanes 5, 6,9, and 10, respectively), suggesting a major effect of this core element in the protein binding. An FPA-m1 oligonucleotide, mutated in the EKLF consensus sequence 5′-CACCC-3′, competed formation of all complexes (Fig. 5 C, lanes 7 and 8). An oligonucleotide, bearing a consensus MZF-1 binding site (MZF consensus), with unrelated flanking sequences, prevented the formation of complex I (Fig. 5 C, lanes 15 and16). The same oligonucleotide with a 3-bp mutation in the MZF binding site (MZF consensus mutant) failed to compete (lanes 17 and 18). These results suggest that MZF-like factors bind element A, whereas EKLF factors do not. Despite the fact that HMEC-1 cells seem to express MZF-1 (as seen with reverse transcription-PCR and Western blot analysis; data not shown) and MZF-1b (Western blot analysis; data not shown), we were unable to observe any supershift using either the MZF-1/1b antibody or an antibody specifically targeted against the N-terminal domain of MZF-1b (data not shown). Similarly, coexpression of MZF-1 expression vector with pGL3-p2 plasmid had no effect on the enhancer transcriptional activation (data not shown). Footprint element C was functionally restricted to base position −4755/−4735 by linker-scanning analysis (linker-scanning mutants LSC2 and LSC3). A labeled FPC1–3-WT probe, containing the total footprint element C sequence (−4765/−4735), formed multiple complexes in the presence of crude nuclear extracts (Fig. 6B, lanes 2 and 8), among which several were specifically competed by 100-fold molar excess of cold FPC1–3-WT oligonucleotide (Fig. 6 B,lanes 3 and 9). Computer analysis of −4755/−4738 region revealed putative binding sites for AP-2, Sp-1, MZF-1, and Ets. Competition experiments performed using an AP-2 consensus oligonucleotide showed competition for complex IV formation (Fig. 6 B, lane 6). In addition an Sp-1 consensus oligonucleotide competed for complexes IV-V formation (lane 5). Finer analysis of the sequences of AP-2 and Sp-1 consensus oligonucleotides revealed putative Sp-1 binding sites within the AP-2 oligonucleotide. Inversely the Sp-1 oligonucleotide had no binding site for AP-2. This suggests that the competition of AP-2 oligonucleotide for complex IV formation may be in fact Sp-1-dependent. Therefore, the relative contribution of AP-2 and Sp-1 for complex IV formation should be further investigated. MZF-1 consensus oligonucleotide exhibited a clear competition for complex I (lane 4), suggesting the binding of an MZF-like protein. Lastly, an FPC1–3-WT oligonucleotide bearing a mutation in the Ets-binding site still competed away all complexes with efficiency equivalent to that of the wild type FPC1–3-WT oligonucleotide (lane 10). Altogether, these results suggest an implication of Sp-1-related and MZF-like transcription factors in the formation of DNA-protein complexes in element C but not of Ets family members. Incubation of the labeled FPB2-WT probe centered on the region B2 (Fig. 7iA) with HMEC-1 nuclear extracts resulted in a DNA-protein complex formation (Fig. 7 B,lane 2), which was completely prevented with cold FPB2-WT competitor (Fig. 7 B, lane 3). Computer analysis of FPB2-WT revealed a putative Ets-binding site possibly involved in the complex formation. Indeed, we observed a clear competition using a 100-fold molar excess of a consensus Ets-1 oligonucleotide (Fig. 7 B, lane 5), whereas an FPB2 oligonucleotide, mutated for the Ets-binding site (FPB2m) failed to prevent the complex formation (Fig. 7 B, lane 4). Using antibodies directed against Erg 1/2 transcription factors or NERF 1/1b/2 factors, we did not observe any supershift on DNA-protein complexes formed by HMEC-1 nuclear extracts and FPB2-WT probe (data not shown), suggesting that neither Erg nor NERF transcription factors were present in DNA-pr" @default.
• W2080776632 created "2016-06-24" @default.
• W2080776632 creator A5025610388 @default.
• W2080776632 creator A5028678474 @default.
• W2080776632 creator A5048546765 @default.
• W2080776632 creator A5052207646 @default.
• W2080776632 date "2000-12-01" @default.
• W2080776632 modified "2023-10-17" @default.
• W2080776632 title "Characterization of an Upstream Enhancer Region in the Promoter of the Human Endothelial Nitric-oxide Synthase Gene" @default.
• W2080776632 cites W1970121462 @default.
• W2080776632 cites W1976263779 @default.
• W2080776632 cites W1993243592 @default.
• W2080776632 cites W1994501148 @default.
• W2080776632 cites W1994950364 @default.
• W2080776632 cites W2011846765 @default.
• W2080776632 cites W2025125189 @default.
• W2080776632 cites W2041075406 @default.
• W2080776632 cites W2042543706 @default.
• W2080776632 cites W204536596 @default.
• W2080776632 cites W2064879068 @default.
• W2080776632 cites W2066010552 @default.
• W2080776632 cites W2070565041 @default.
• W2080776632 cites W2072589978 @default.
• W2080776632 cites W2072826773 @default.
• W2080776632 cites W2077366814 @default.
• W2080776632 cites W2080512950 @default.
• W2080776632 cites W2097513054 @default.
• W2080776632 cites W2097799015 @default.
• W2080776632 cites W2108116605 @default.
• W2080776632 cites W2121858640 @default.
• W2080776632 cites W2125293265 @default.
• W2080776632 cites W2145570729 @default.
• W2080776632 cites W2152724821 @default.
• W2080776632 cites W2157603347 @default.
• W2080776632 cites W2165039486 @default.
• W2080776632 cites W2211096163 @default.
• W2080776632 cites W2314872616 @default.
• W2080776632 doi "https://doi.org/10.1074/jbc.m004696200" @default.
• W2080776632 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11013235" @default.
• W2080776632 hasPublicationYear "2000" @default.
• W2080776632 type Work @default.
• W2080776632 sameAs 2080776632 @default.
• W2080776632 citedByCount "59" @default.
• W2080776632 countsByYear W20807766322012 @default.
• W2080776632 countsByYear W20807766322013 @default.
• W2080776632 countsByYear W20807766322014 @default.
• W2080776632 countsByYear W20807766322016 @default.
• W2080776632 countsByYear W20807766322017 @default.
• W2080776632 countsByYear W20807766322019 @default.
• W2080776632 countsByYear W20807766322022 @default.
• W2080776632 countsByYear W20807766322023 @default.
• W2080776632 crossrefType "journal-article" @default.
• W2080776632 hasAuthorship W2080776632A5025610388 @default.
• W2080776632 hasAuthorship W2080776632A5028678474 @default.
• W2080776632 hasAuthorship W2080776632A5048546765 @default.
• W2080776632 hasAuthorship W2080776632A5052207646 @default.
• W2080776632 hasBestOaLocation W20807766321 @default.
• W2080776632 hasConcept C104317684 @default.
• W2080776632 hasConcept C111936080 @default.
• W2080776632 hasConcept C112243037 @default.
• W2080776632 hasConcept C150194340 @default.
• W2080776632 hasConcept C153911025 @default.
• W2080776632 hasConcept C181199279 @default.
• W2080776632 hasConcept C185592680 @default.
• W2080776632 hasConcept C191172861 @default.
• W2080776632 hasConcept C2777622882 @default.
• W2080776632 hasConcept C2778326061 @default.
• W2080776632 hasConcept C2992676626 @default.
• W2080776632 hasConcept C31258907 @default.
• W2080776632 hasConcept C41008148 @default.
• W2080776632 hasConcept C54355233 @default.
• W2080776632 hasConcept C55493867 @default.
• W2080776632 hasConcept C86803240 @default.
• W2080776632 hasConcept C95444343 @default.
• W2080776632 hasConceptScore W2080776632C104317684 @default.
• W2080776632 hasConceptScore W2080776632C111936080 @default.
• W2080776632 hasConceptScore W2080776632C112243037 @default.
• W2080776632 hasConceptScore W2080776632C150194340 @default.
• W2080776632 hasConceptScore W2080776632C153911025 @default.
• W2080776632 hasConceptScore W2080776632C181199279 @default.
• W2080776632 hasConceptScore W2080776632C185592680 @default.
• W2080776632 hasConceptScore W2080776632C191172861 @default.
• W2080776632 hasConceptScore W2080776632C2777622882 @default.
• W2080776632 hasConceptScore W2080776632C2778326061 @default.
• W2080776632 hasConceptScore W2080776632C2992676626 @default.
• W2080776632 hasConceptScore W2080776632C31258907 @default.
• W2080776632 hasConceptScore W2080776632C41008148 @default.
• W2080776632 hasConceptScore W2080776632C54355233 @default.
• W2080776632 hasConceptScore W2080776632C55493867 @default.
• W2080776632 hasConceptScore W2080776632C86803240 @default.
• W2080776632 hasConceptScore W2080776632C95444343 @default.
• W2080776632 hasIssue "52" @default.
• W2080776632 hasLocation W20807766321 @default.
• W2080776632 hasLocation W20807766322 @default.
• W2080776632 hasLocation W20807766323 @default.
• W2080776632 hasOpenAccess W2080776632 @default.
• W2080776632 hasPrimaryLocation W20807766321 @default.
• W2080776632 hasRelatedWork W2061914098 @default.

• next