FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2080900809> ?p ?o ?g. }

• W2080900809 endingPage "3475" @default.
• W2080900809 startingPage "3468" @default.
• W2080900809 abstract "ActA is a bacterially encoded protein that enables Listeria monocytogenes to hijack the host cell actin cytoskeleton. It promotes Arp2/3-dependent actin nucleation, but its interactions with cellular components of the nucleation machinery are not well understood. Here we show that two domains of ActA (residues 85–104 and 121–138) with sequence similarity to WASP homology 2 domains bind two actin monomers with submicromolar affinity. ActA binds Arp2/3 with a K dof 0.6 μm and competes for binding with the WASP family proteins N-WASP and Scar1. By chemical cross-linking, ActA, N-WASP, and Scar1 contact the same three subunits of the Arp2/3 complex, p40, Arp2, and Arp3. Interestingly, profilin competes with ActA for binding of Arp2/3, but actophorin (cofilin) does not. The minimal Arp2/3-binding site of ActA (residues 144–170) is C-terminal to both actin-binding sites and shares sequence homology with Arp2/3-binding regions of WASP family proteins. The maximal activity at saturating concentrations of ActA is identical to the most active domains of the WASP family proteins. We propose that ActA and endogenous WASP family proteins promote Arp2/3-dependent nucleation by similar mechanisms and require simultaneous binding of Arp2 and Arp3. ActA is a bacterially encoded protein that enables Listeria monocytogenes to hijack the host cell actin cytoskeleton. It promotes Arp2/3-dependent actin nucleation, but its interactions with cellular components of the nucleation machinery are not well understood. Here we show that two domains of ActA (residues 85–104 and 121–138) with sequence similarity to WASP homology 2 domains bind two actin monomers with submicromolar affinity. ActA binds Arp2/3 with a K dof 0.6 μm and competes for binding with the WASP family proteins N-WASP and Scar1. By chemical cross-linking, ActA, N-WASP, and Scar1 contact the same three subunits of the Arp2/3 complex, p40, Arp2, and Arp3. Interestingly, profilin competes with ActA for binding of Arp2/3, but actophorin (cofilin) does not. The minimal Arp2/3-binding site of ActA (residues 144–170) is C-terminal to both actin-binding sites and shares sequence homology with Arp2/3-binding regions of WASP family proteins. The maximal activity at saturating concentrations of ActA is identical to the most active domains of the WASP family proteins. We propose that ActA and endogenous WASP family proteins promote Arp2/3-dependent nucleation by similar mechanisms and require simultaneous binding of Arp2 and Arp3. WASP homology 2 dithiothreitol 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride N-hydroxysuccinimide The actin cytoskeleton participates in many essential functions in eukaryotic cells including motility, endocytosis, and cytokinesis. These processes rely on the rapid and localized assembly and disassembly of actin filaments. Cellular signals, such as activated Rho family G-proteins, direct construction of new actin filaments de novo by localizing and activating the nucleation machinery. The actin nucleation machinery consists of the Arp2/3 complex, a multiprotein complex that nucleates and cross-links actin filaments into orthogonal arrays, and a nucleation promoting factor that activates or enhances the activity of the Arp2/3 complex. Both the mechanism of Arp2/3-mediated nucleation and its enhancement by nucleation promoting factors are poorly understood. Cellular nucleation promoting factors identified to date are all members of the WASP family of proteins, which includes isoforms of WASP, N-WASP, and Scar. Other proteins, including fungal myosin I (1Lechler T. Shevchenko A. Li R. J. Cell Biol. 2000; 148: 363-373Crossref PubMed Scopus (175) Google Scholar, 2Evangelista M. Klebl B.M. Tong A.H. Webb B.A. Leeuw T. Leberer E. Whiteway M. Thomas D.Y. Boone C. J. Cell Biol. 2000; 148: 353-362Crossref PubMed Scopus (193) Google Scholar) and p150 Spir (a possible c-Jun N-terminal kinase substrate in humans and Drosophila(3Otto I.M. Raabe T. Rennefahrt U.E. Bork P. Rapp U.R. Kerkhoff E. Curr. Biol. 2000; 10: 345-348Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar)), have been identified as potential nucleation promoting factors based on genetic and biochemical interactions with Arp2/3 and/or sequence similarity with regions of WASP family proteins. The bacterium Listeria monocytogenes recruits the host cell cytoskeleton to power its own motility and migrate from cell to cell to avoid the humoral immune system. The only bacterial protein required for this activity is ActA (4Kocks C. Gouin E. Tabouret M. Berche P. Ohayon H. Cossart P. Cell. 1992; 68: 521-531Abstract Full Text PDF PubMed Scopus (658) Google Scholar, 5Smith G.A. Portnoy D.A. Theriot J.A. Mol. Microbiol. 1995; 17: 945-951Crossref PubMed Scopus (109) Google Scholar), a nucleation promoting factor that recruits and activates Arp2/3. Although ActA was the first protein found to stimulate Arp2/3-dependent actin nucleation (6Welch M.D. Rosenblatt J. Skoble J. Portnoy D.A. Mitchison T.J. Science. 1998; 281: 105-108Crossref PubMed Scopus (418) Google Scholar), we know much less about how actin and Arp2/3 interact with ActA than with the WASP family proteins. WASP family proteins contain an acidic C-terminal domain that binds Arp2/3 (7Machesky L.M. Insall R.H. Curr. Biol. 1998; 8: 1347-1356Abstract Full Text Full Text PDF PubMed Scopus (749) Google Scholar) and one or two WASP homology 2 (WH2)1 domains that bind actin (8Miki H. Miura K. Takenawa T. EMBO J. 1996; 15: 5326-5335Crossref PubMed Scopus (555) Google Scholar, 9Symons M. Derry J.M. Karlak B. Jiang S. Lemahieu V. McCormick F. Francke U. Abo A. Cell. 1996; 84: 723-734Abstract Full Text Full Text PDF PubMed Scopus (748) Google Scholar). Biochemical analysis of truncation mutants suggests that both the acidic and WH2 domains are required to promote Arp2/3-dependent nucleation (10Machesky L.M. Mullins R.D. Higgs H.N. Kaiser D.A. Blanchoin L. May R.C. Hall M.E. Pollard T.D. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 3739-3744Crossref PubMed Scopus (614) Google Scholar, 11Higgs H.N. Blanchoin L. Pollard T.D. Biochemistry. 1999; 38: 15212-15222Crossref PubMed Scopus (241) Google Scholar). The nucleation promoting activity of ActA has been shown to reside in the N-terminal 262 amino acids of the molecule (6Welch M.D. Rosenblatt J. Skoble J. Portnoy D.A. Mitchison T.J. Science. 1998; 281: 105-108Crossref PubMed Scopus (418) Google Scholar), but the location, number, and activity of actin- and Arp2/3-binding sites have not been determined. Understanding the structure and function of ActA provides insight into the mechanism of Arp2/3-mediated actin polymerization. In addition, comparison of ActA with endogenous nucleation promoting factors shows us how relevant conclusions based on studying Listeria motility are to normal cellular motility. In the present study we find that ActA binds two actin monomers with submicromolar affinity using domains with some sequence similarity to WH2 domains from endogenous nucleation promoting factors. The binding site for Arp2/3 is located C-terminal to the actin-binding sites, and although it does not contain the characteristic cluster of acidic residues, it shares limited sequence homology with the Arp2/3-binding domains found in WASP family proteins. By chemical cross-linking and polarization anisotropy, we show that ActA and the WASP family proteins hScar1 and N-WASP contact the same subunits on Arp2/3 and compete for the same binding site. This binding site is much more extensive than previously thought and includes both of the actin-related proteins, Arp2 and Arp3. In vitro the maximal activity of full-length ActA is nearly identical to the endogenous nucleation promoting factor N-WASP. L. monocytogenes 4035 genomic DNA was a generous gift from A. K. Benson, University of Nebraska, Lincoln. Oligonucleotide primers were designed that correspond to the following: FACTA30N, GATCGAATTCTCCAGTCTGAACACAGATGAATGGG; FACTA120N, GATCGGATCCATGGCTTCAGGAGCCGACCGACC; FACTA152N, GATCGGATCCATGATAGCATCATCGGATAGTGAGC; FACT180N, GGATCCATGTCAGTTGCGGATGCTTCTGAA; RACTA170N, GATCGAATTCTTAACATTTTGTTGGTTTATCCGGATAAGTAAGGC; and RACTA612, GAATTCTTAACACGTCGTATGGTTCCCTGGTTCTTCCTTCGC. Polymerase chain reactions were performed with proofreading polymerase (Roche Molecular Biochemicals) under standard conditions. DNA fragments were subcloned into the pET-5a expression vector (Novagen, Madison, WI). ActA-(30–120) and ActA-(121–170) were constructed either by dropout and/or Eco RI partial digestion of the ActA-(30–170) construct. All ActA proteins were expressed and purified as follows. Fresh transformations of BL-21(DE3) cells were grown at 37 °C in TPM (20 g of tryptone, 15 g of yeast extract, 8 g of NaCl, 2 g of Na2HPO4, 0.2% glucose, 50 μg/ml ampicillin) to A 650 of ∼0.6, then induced with 0.25 mm isopropyl-1-thio-β-d-galactopyranoside (Sigma), and grown an additional 2 h. Cells were harvested at 5000 rpm and pellets stored −80 °C. Cells were thawed and resuspended in lysis buffer (10 mm Tris, pH 8, 0.2 m sucrose, 1000 units of DNase, 1000 units of RNase, 5 mm DTT, 5 mm phenylmethylsulfonyl fluoride) and lysed by three passes in a microfluidizer (Microfluidics International Corp., Newton, MA). The extract was spun at 15,000 rpm, and the supernatant was fractionated by gel filtration on a 500-ml Sephacryl S-300 column equilibrated in high salt buffer (10 mm Tris, pH 8, 500 mm KCl, 1 mm EDTA, 1 mm DTT). ActA-containing fractions were pooled and dialyzed against DEAE buffer (10 mm Tris, pH 8, 1 mm EDTA, 1 mmDTT). Protein was then purified by anion exchange chromatography using DE52 resin. Proteins were concentrated either by dialysis against solid sucrose or with a Centriprep spin column. Purified proteins were flash-frozen and stored at −80 °C. The WA constructs of hSCAR1 and N-WASP were expressed with C-terminal His tags and purified on nickel-nitrilotriacetic acid-agarose (Qiagen, Valencia, CA). Cell growth conditions, buffers, and lysis conditions were identical to those used for ActA mutants. Arp2/3 was purified as described previously (12Kelleher J.F. Mullins R.D. Pollard T.D. Methods Enzymol. 1998; 298: 42-51Crossref PubMed Scopus (8) Google Scholar) but with a few modifications. Poly-l-proline flow-through was passed over a C-200 cation exchange column. The flow-through was adsorbed onto a C-500 anion exchange column and eluted with a linear gradient from 0 to 0.2 m KCl in column buffer. Protein-containing fractions were concentrated by dialysis against solid sucrose and run on an S-300 column equilibrated in high salt complex buffer (10 mm imidazole, pH 7.5, 150 mm NaCl, 750 mm KCl, 0.1 mm EGTA, 0.2 mmMgCl2, 1 mm DTT, 0.2 mm ATP). Purified Arp2/3 was stored in complex buffer supplemented with 35–50% sucrose. Acanthamoeba actin and rabbit skeletal muscle actin were purified according to Refs. 13Spudich J.A. Watt S. J. Biol. Chem. 1971; 246: 4866-4871Abstract Full Text PDF PubMed Google Scholar and 14MacLean-Fletcher S. Pollard T.D. Cell. 1980; 20: 329-341Abstract Full Text PDF PubMed Scopus (546) Google Scholar. Plasma gelsolin was purified as described previously (15Mullins R.D. Heuser J.A. Pollard T.D. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 6181-6186Crossref PubMed Scopus (1036) Google Scholar, 16Bryan J. Coluccio L.M. J. Cell Biol. 1985; 101: 1236-1244Crossref PubMed Scopus (51) Google Scholar). Purified proteins were dialyzed against 50 mm KCl, 1 mm MgSO4, 1 mm EGTA, 10 mm imidazole, pH 7, and incubated with a 4–7-fold molar excess of rhodamine maleimide (Molecular Probes, Eugene, OR) for 1 h at room temperature and overnight at 4 °C. Samples were spun at 65,000 rpm, and the supernatant was chromatographed on a Sephacryl S-300 column to remove unreacted dye. In Arp2/3-mediated polymerization assays, the activity of the rhodamine-labeled ActA was indistinguishable from that of unlabeled ActA. Freshly purified Arp2/3 was dialyzed into labeling buffer (10 mm imidazole, pH 7, 50 mm KCl, 0.1 mm MgCl2, 0.1 mm ATP, 0.5 mm TCEP) overnight and centrifuged at 13,000 rpm to remove precipitated protein. The supernatant was concentrated to 1–2 mg/ml with a microcon concentrator and mixed with an equimolar amount of rhodamine maleimide for 1.5 h at 24 °C under cover of darkness. The reaction was quenched with excess DTT, and the sample was spun at 70,000 rpm for 30 min at 4 °C to remove precipitated dye. The supernatant was chromatographed on a 10-ml Sephadex G-25 column to remove unreacted dye. This labeling protocol results in ∼15% labeling of Arp2/3, almost exclusively on the Arp3 subunit. Higher concentrations of rhodamine maleimide produce elevated percentages of labeling, and the complex becomes labeled on both the Arp3 and p18 subunits. To determine the effect of labeling on Arp2/3 activity, we tested 60% rhodamine-labeled Arp2/3 and found no effect on either nucleation or pointed end capping. Acanthamoeba and Rabbit skeletal muscle actin were labeled with pyrene iodoacetamide as described (17Cooper J.A. Walker S.B. Pollard T.D. J. Muscle Res. Cell Motil. 1983; 4: 253-262Crossref PubMed Scopus (369) Google Scholar). We mixed unlabeledAcanthamoeba actin with pyrene-labeled amoeba or rabbit skeletal muscle actin to 10–15% of final actin concentration. Polymerization reactions contained 50 mm KCl, 1 mm MgSO4, 1 mm EGTA, 10 mm imidazole, pH 7. Ca2+-actin was converted to Mg2+-actin prior to each polymerization reaction by a 2-min incubation with 50 μm MgCl2, 200 μm EGTA. Gelsolin-actin dimers were prepared according to Ref. 15Mullins R.D. Heuser J.A. Pollard T.D. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 6181-6186Crossref PubMed Scopus (1036) Google Scholar. Pyrene fluorescence was measured by a K2 Multifrequency Fluorometer (ISS, Champagne, IL). Data were analyzed using KaleidaGraph (Synergy Software, Reading, PA). Rhodamine-labeled ActA-(30–170) (500 nm) or Arp2/3 (750 nm) was mixed with the appropriate unlabeled proteins to the indicated concentrations. Samples were degassed under vacuum at room temperature before data collection. Data were collected with a K2 Multifrequency Fluorometer and analyzed using KaleidaGraph. Under the conditions used in our study, anisotropy is a measure of the rotational mobility of the fluorescently labeled protein. We excited the fluorophore with plane polarized light at 543 nm, and measured emission at 575 nm at polarizations both parallel (I ∥) and perpendicular (I ⊥) to the excitation source. We then calculated anisotropy (r) as shown in Equation 1, r=I∥−I⊥I∥+2I⊥Equation 1 We determined dissociation equilibrium constants by fitting anisotropy data to the function shown in Equation 2,r=rf+(rb−rf)(Kd+[R]+[A])−(Kd+[R]+[A])2−4[R][A]2[R]Equation 2 where r f and r b are the anisotropies of free and bound rhodamine ActA; [A] and [R] are the total concentrations of ActA and Arp2/3, andK d is the dissociation equilibrium constant. Fitting with this function makes no assumptions about the relative concentrations of ActA and Arp2/3. In experiments where nonfluorescent ligands compete with rhodamine-labeled ActA (Fig. 4), we determined dissociation constants by fitting anisotropy data to the function (18Vinson V.K. De La Cruz E.M. Higgs H.N. Pollard T.D. Biochemistry. 1998; 37: 10871-10880Crossref PubMed Scopus (131) Google Scholar) shown in Equation3,r=rf+(rb−rf)Kd[C]+Kd2Kd,2[Ro]+1Equation 3 where K d,2 is the dissociation constant of the nonfluorescent competitor; [C] is the total concentration of the competitor, and [R o] is the concentration of free Arp2/3 when [C] = 0. For this analysis [R o] and K d are determined from the anisotropy in the absence of competitor andK d,2 is determined from fitting Equation3 to experimental data. This function is an approximation and only valid when Arp2/3 and the competitor are in excess over labeled ActA. These conditions were met in all our competition binding experiments. The indicated concentrations of ActA-(121–170) and Arp2/3 were dialyzed into 50 mm KCl, 1 mm MgSO4, 1 mm EGTA, 10 mm imidazole, pH 7, to facilitate cross-linking. Stock solutions of 100 mm1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) andN-hydroxysuccinimide (NHS) (Pierce) were prepared in Me2SO. Cross-linking reactions were carried out at room temperature at the indicated concentrations of proteins and cross-linkers for 45 min. The reaction was quenched with 10 mm Tris, 100 mm glycine. Reaction products were precipitated with methanol and chloroform and analyzed by SDS-polyacrylamide gel electrophoresis and immunoblotting. The atomic model for actin was taken from Schutt et al. (19Schutt C. Myslik J.C. Rozychi M.D. Goonesekere N.C.W. Lindberg U. Nature. 1993; 365: 810-816Crossref PubMed Scopus (600) Google Scholar), and the model of Arp2 was constructed by Joe Kelleher based on homology with conventional actin combined with molecular dynamics simulations (20Kelleher J.F. Atkinson S.J. Pollard T.D. J. Cell Biol. 1995; 131: 385-397Crossref PubMed Scopus (161) Google Scholar). Visualization and rendering were performed with Molscript (21Kraulis P.K. J. Appl. Crystallogr. 1991; 24: 946-950Crossref Google Scholar) and Raster3d (22Merritt E. Murphy M. Acta Crystallogr. Sect. D Biol. Crystallogr. 1994; 50: 869-873Crossref PubMed Scopus (2857) Google Scholar). Full-length ActA (amino acids 30–612) and several smaller truncation mutants inhibit spontaneous actin polymerization and elongation from the pointed end of existing actin filaments but have no effect on elongation from the barbed end (Fig. 1,A and B, inset). This activity is similar to that reported for fragments of N-WASP (23Laurent V. Loisel T.P. Harbeck B. Wehman A. Grobe L. Jockusch B.M. Wehland J. Gertler F.B. Carlier M.F. J. Cell Biol. 1999; 144: 1245-1258Crossref PubMed Scopus (297) Google Scholar) and Scar1 (11Higgs H.N. Blanchoin L. Pollard T.D. Biochemistry. 1999; 38: 15212-15222Crossref PubMed Scopus (241) Google Scholar). Unlike Scar and N-WASP, which almost completely inhibit pointed end elongation, saturating concentrations of ActA inhibit pointed end elongation by 80%.Figure 1ActA binds two actin monomers. A, inhibition of spontaneous actin polymerization by ActA-(30–612). 5 μm actin monomers were polymerized by addition of KCl and MgCl2 in the presence of the following concentrations of ActA-(30–612): ○, 0.0 μm; ●, 3 μm; ■, 5 μm; ▪, 10 μm(conditions, actin was 15% pyrene-labeled; buffer, 50 mmKCl, 1 mm MgSO4, 1 mm EGTA, 10 mm imidazole, pH 7, temperature, 24 °C). B, ActA-(30–612) blocks addition of actin monomers to the pointed ends of existing filaments. We polymerized 3 μm actin (10% pyrene-labeled) from the pointed ends of gelsolin-capped actin seeds in the presence of various concentrations of ActA-(30–612).Inset, time courses of polymerization in the presence of 0.0, 0.8, 1.6, 3.0, 4.0, and 6.0 μm ActA-(30–612) (conditions, buffer, and temperature same as A).Straight lines represent infinitely tight binding to either one (right) or two (left) binding sites. The heavy curve is the best fit to a two binding site model with equal dissociation equilibrium constants of 0.7 ± 0.2 μm. C, domain organization of ActA. ActA truncation mutants used in this study and their relative activities in inhibiting spontaneous actin polymerization and promoting Arp2/3-dependent nucleation activity. D, actin and Arp2/3-binding sites in the N-terminal portion of ActA. Theheavy dark lines indicate the minimal fragment of ActA capable of promoting Arp2/3-dependent nucleation (top) and the putative actin and Arp2/3-binding sites identified by homology with domains from WASP family proteins (bottom). The domains from WASP family proteins begin at the following amino acids: Bee1p, 547, 570, and 613; human N-WASP, 345, 372, and 413; Rat N-WASP, 401, 428, and 469; Mouse WASP, 447 and 490; Human Scar1, 495 and 533; and Dicty Scar, 380 and 418.View Large Image Figure ViewerDownload Hi-res image Download (PPT) We used the effect on pointed end elongation to quantitate actin monomer binding by ActA-(30–612) (Fig. 1 B). The decrease in elongation rate as a function of ActA concentration is not well fit by a model in which an individual ActA molecule binds a single actin monomer (right line). The data fit much better to a model in which one ActA binds two actin monomers, each with aK d of 0.7 ± 0.2 μm suggesting that ActA contains at least two actin monomer-binding sites. Previous studies identified a putative actin-binding site (24Cicchetti G. Maurer P. Wagener P. Kocks C. J. Biol. Chem. 1999; 274: 33616-33626Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar, 25Lasa I. Gouin E. Goethals M. Vancompernolle K. David V. Vandekerckhove J. Cossart P. EMBO J. 1997; 16: 1531-1540Crossref PubMed Scopus (113) Google Scholar) between amino acids 60 and 90. To extend this work we used truncation mutants to perform a systematic search for actin-binding sites throughout the entire molecule. We expressed truncation mutants spanning the entire molecule (Fig. 1 C) and assayed the monomer binding activity of each by its effect in three assays as follows: spontaneous actin polymerization, elongation from the barbed end, and elongation from the pointed end of existing filaments. The construct spanning amino acids 30–120 weakly inhibited spontaneous polymerization (data not shown), consistent with previous reports of an actin-binding site between amino acids 60 and 100 (24Cicchetti G. Maurer P. Wagener P. Kocks C. J. Biol. Chem. 1999; 274: 33616-33626Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar). In addition, the construct spanning amino acids 120–612 inhibited spontaneous polymerization and elongation from both the pointed and barbed ends of existing filaments. We further localized this second actin-binding site to a region of the protein between amino acids 121 and 152. We estimated a dissociation constant of 2.1 ± 0.5 μmfor the actin-binding site on ActA-(120–612) from barbed end elongation assays (data not shown). The lower affinity of this binding site compared with that predicted from ActA-(30–612) and the fact that it blocks barbed as well as pointed end elongations are probably artifacts caused by some degree of misfolding of the ActA-(120–612) construct. Cicchetti et al. (24Cicchetti G. Maurer P. Wagener P. Kocks C. J. Biol. Chem. 1999; 274: 33616-33626Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar) found that deletions in the N-terminal region of ActA perturb the secondary structure and decrease the stability of the protein. We conclude that full-length ActA contains two actin monomer-binding sites. We further localized them based on sequence similarity to the actin-binding WH2 domains from WASP family proteins (Fig.1 D). Amino acids 143–169 of ActA constitute a minimal Arp2/3-binding site. Full-length ActA and truncations spanning residues 30–170, 120–612, and 121–170 all stimulated Arp2/3-dependent nucleation (Figs. 1 C and 2 A). Therefore, residues 121–170 contain the minimal requirements to promote nucleation - actin monomer binding activity and an Arp2/3-binding site. Within this region we identified residues 143–169 as the Arp2/3-binding site by sequence similarity to the C-terminal portions of WASP, Scar, and N-WASP (Fig. 1 D). This domain contains very few acidic residues compared with the Arp2/3-binding sites of most WASP family proteins but is most similar to the yeast protein Las17p/Bee1p. At saturating concentrations the ActA-(120–612) truncation is less efficient at stimulating actin polymerization than proteins containing amino acids 30–120. Under our assay conditions (2 μm actin, 50 nm Arp2/3), the time to half-maximal polymerization stimulated by saturating concentrations of ActA-(30–612) and ActA-(30–170) is ∼75 s compared with t 12 of ∼500 s for ActA-(120–612) (Fig.2 A). We determined the affinity of the 30–612 and 30–170 ActA proteins for Arp2/3 by polarization anisotropy (Fig. 2 B). To characterize the interaction with ActA-(30–612) we labeled Arp2/3 with rhodamine maleimide. Our labeling conditions produced 5–15% labeling, almost exclusively on the Arp3 subunit. From preparation to preparation, free Arp2/3 had an anisotropy that varied between 0.215 and 0.26. Addition of saturating concentrations of ActA-(30–612) consistently increased the steady-state anisotropy by 0.015. From this change we measured aK d of 0.5 ± 0.2 μm. To measure Arp2/3 binding to the smaller truncation mutants, we labeled ActA with rhodamine maleimide. We designed all our ActA proteins with a cysteine at the extreme C terminus for efficient labeling with sulfhydryl-reactive fluorophores. We labeled each construct with rhodamine maleimide and measured its anisotropy alone and in the presence of Arp2/3. ActA-(30–612) had a very low anisotropy (0.05) similar to that of free dye, which did not change upon addition of Arp2/3 suggesting that the C terminus of the protein is flexible and possibly disordered. ActA-(30–170) was much more well behaved, and in the absence of Arp2/3 it had an anisotropy of 0.095 and in the presence of saturating Arp2/3 concentrations of 0.21. From this anisotropy change, we measured a K d of 4.8 ± 0.3 μm. The lower affinity of ActA-(30–170) suggests that residues C-terminal to 170 may also interact with Arp2/3. To localize the binding sites for nucleation promoting factors on Arp2/3, we carried out identical cross-linking experiments with the active fragment of hScar1 and the smallest fragment of ActA capable of stimulating Arp2/3-dependent nucleation, ActA-(121–170). We identified three Arp2/3 subunits that directly contact both ActA and hScar1 by cross-linking each protein to Arp2/3 with the zero-length cross-linker EDC together with NHS. After cross-linking, antibodies that recognize the T7 tag on ActA-(121–170) or the His6 tag on hScar1 react with three prominent new bands (Fig. 3, A andB). The new bands are also recognized by monospecific antibodies against the p40, Arp2, and Arp3 subunits of Arp2/3. We next investigated whether the binding site for ActA overlapped that of endogenous WASP family proteins by performing competition binding assays. Addition of the active C-terminal domain of N-WASP to a mixture of Arp2/3 and rhodamine ActA-(30–170) decreases the anisotropy of labeled ActA down to the level of free ActA (Fig.4), suggesting that the two proteins bind in a mutually exclusive manner. From these competition experiments we estimate a K d of 1.9 ± 0.3 μmfor N-WASP binding to Arp2/3. Similar results were obtained with hScar1 (Kd = 2.0 ± 0.4 μm, data not shown). Our results suggest that Arp2 interacts directly with ActA and WASP family proteins. To further localize the binding site for nucleation promoting factors, we tested the effects of two proteins known to bind Arp2, profilin and actophorin, on the binding of ActA to Arp2/3. Interestingly, profilin decreases the fraction of ActA bound to Arp2/3 in a dose-dependent manner, suggesting that its binding site overlaps that of ActA. Fitting the data with a competitive binding model yields a K d of 3.4 ± 0.3 for profilin binding, somewhat lower than our previous estimate of 7 μm from analytical ultracentrifugation (26Mullins R.D. Kelleher J.F. Xu J. Pollard T.D. Mol. Biol. Cell. 1998; 9: 841-852Crossref PubMed Scopus (75) Google Scholar). Profilin, however, is not as effective as N-WASP at displacing ActA from Arp2/3. In the presence of Arp2/3, saturating concentrations of profilin do not decrease the anisotropy of rhodamine ActA-(30–170) down to the levels of free protein suggesting that the binding sites do not completely overlap. The data are consistent with an increase in theK d for ActA binding from 4.8 to ∼30 μm. Although actophorin binds Arp2/3 with approximately the same affinity as profilin, actophorin does not displace rhodamine ActA even at high concentrations (Fig. 4). Although we do not understand the molecular details of Arp2/3-dependent nucleation, several characteristics of the process have been well described. Addition of WASP family proteins to Arp2/3 accelerates filament formation but, even at high concentrations, does not completely abolish the initial lag phase of polymerization (10Machesky L.M. Mullins R.D. Higgs H.N. Kaiser D.A. Blanchoin L. May R.C. Hall M.E. Pollard T.D. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 3739-3744Crossref PubMed Scopus (614) Google Scholar, 27Rohatgi R. Ma L. Miki H. Lopez M. Kirchhausen T. Takenawa T. Kirschner M.W. Cell. 1999; 97: 221-231Abstract Full Text Full Text PDF PubMed Scopus (1076) Google Scholar, 28Yarar D. To W. Abo A. Welch M.D. Curr. Biol. 1999; 20: 555-558Abstract Full Text Full Text PDF Scopus (221) Google Scholar). This suggests that nucleation promoting factors do not convert Arp2/3 into a bona fide actin nucleus but promote nucleation via a multistep mechanism. In addition, pre-existing filaments accelerate the nucleation reaction so that the majority of new actin filaments grow from the sides of pre-existing filaments in a characteristic branching pattern (7Machesky L.M. Insall R.H. Curr. Biol. 1998; 8: 1347-1356Abstract Full Text Full Text PDF PubMed Scopus (749) Google Scholar, 11Higgs H.N. Blanchoin L. Pollard T.D. Biochemistry. 1999; 38: 15212-15222Crossref PubMed Scopus (241) Google Scholar, 15Mullins R.D. Heuser J.A. Pollard T.D. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 6181-6186Crossref PubMed Scopus (1036) Google Scholar, 29Blanchoin L. Amann K.J. Higgs H.N. Marchand J.B. Kaiser D.A. Pollard T.D. Nature. 2000; 404: 1007-1011Crossref PubMed Scopus (439) Google Scholar). To compare the activity of ActA to that of endogenous nucleation promoting factors, we asked the following three questions. 1) Does addition of ActA abolish the lag phase of polymerization? 2) How does the maxi" @default.
• W2080900809 created "2016-06-24" @default.
• W2080900809 creator A5011698346 @default.
• W2080900809 creator A5027559931 @default.
• W2080900809 creator A5063899727 @default.
• W2080900809 date "2001-02-01" @default.
• W2080900809 modified "2023-09-28" @default.
• W2080900809 title "Activation of the Arp2/3 Complex by the Listeria ActA Protein" @default.
• W2080900809 cites W1538692246 @default.
• W2080900809 cites W1573417299 @default.
• W2080900809 cites W1575892864 @default.
• W2080900809 cites W1593929303 @default.
• W2080900809 cites W1635520329 @default.
• W2080900809 cites W1921408963 @default.
• W2080900809 cites W1964236906 @default.
• W2080900809 cites W1967955638 @default.
• W2080900809 cites W1972467203 @default.
• W2080900809 cites W1994621399 @default.
• W2080900809 cites W1996002116 @default.
• W2080900809 cites W2005548438 @default.
• W2080900809 cites W2007586038 @default.
• W2080900809 cites W2009068509 @default.
• W2080900809 cites W2027351170 @default.
• W2080900809 cites W2028193447 @default.
• W2080900809 cites W2028231353 @default.
• W2080900809 cites W2028642981 @default.
• W2080900809 cites W2036728243 @default.
• W2080900809 cites W2039723960 @default.
• W2080900809 cites W2045923054 @default.
• W2080900809 cites W2048432059 @default.
• W2080900809 cites W2049811440 @default.
• W2080900809 cites W2061207707 @default.
• W2080900809 cites W2071574336 @default.
• W2080900809 cites W2078248419 @default.
• W2080900809 cites W2078384542 @default.
• W2080900809 cites W2079099921 @default.
• W2080900809 cites W2082677295 @default.
• W2080900809 cites W2088899830 @default.
• W2080900809 cites W2094033469 @default.
• W2080900809 cites W2094070743 @default.
• W2080900809 cites W2094389804 @default.
• W2080900809 cites W2100990664 @default.
• W2080900809 cites W2107625881 @default.
• W2080900809 cites W2114061158 @default.
• W2080900809 cites W2122782850 @default.
• W2080900809 cites W2129652808 @default.
• W2080900809 cites W2140040046 @default.
• W2080900809 cites W2144177039 @default.
• W2080900809 cites W2160459388 @default.
• W2080900809 cites W2165471031 @default.
• W2080900809 cites W2166581533 @default.
• W2080900809 cites W2171956751 @default.
• W2080900809 cites W42483719 @default.
• W2080900809 doi "https://doi.org/10.1074/jbc.m006407200" @default.
• W2080900809 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11029465" @default.
• W2080900809 hasPublicationYear "2001" @default.
• W2080900809 type Work @default.
• W2080900809 sameAs 2080900809 @default.
• W2080900809 citedByCount "119" @default.
• W2080900809 countsByYear W20809008092012 @default.
• W2080900809 countsByYear W20809008092013 @default.
• W2080900809 countsByYear W20809008092014 @default.
• W2080900809 countsByYear W20809008092015 @default.
• W2080900809 countsByYear W20809008092016 @default.
• W2080900809 countsByYear W20809008092017 @default.
• W2080900809 countsByYear W20809008092018 @default.
• W2080900809 countsByYear W20809008092019 @default.
• W2080900809 countsByYear W20809008092020 @default.
• W2080900809 countsByYear W20809008092021 @default.
• W2080900809 countsByYear W20809008092022 @default.
• W2080900809 countsByYear W20809008092023 @default.
• W2080900809 crossrefType "journal-article" @default.
• W2080900809 hasAuthorship W2080900809A5011698346 @default.
• W2080900809 hasAuthorship W2080900809A5027559931 @default.
• W2080900809 hasAuthorship W2080900809A5063899727 @default.
• W2080900809 hasBestOaLocation W20809008091 @default.
• W2080900809 hasConcept C185592680 @default.
• W2080900809 hasConcept C2778682378 @default.
• W2080900809 hasConcept C2781350384 @default.
• W2080900809 hasConcept C523546767 @default.
• W2080900809 hasConcept C54355233 @default.
• W2080900809 hasConcept C86803240 @default.
• W2080900809 hasConcept C89423630 @default.
• W2080900809 hasConcept C95444343 @default.
• W2080900809 hasConceptScore W2080900809C185592680 @default.
• W2080900809 hasConceptScore W2080900809C2778682378 @default.
• W2080900809 hasConceptScore W2080900809C2781350384 @default.
• W2080900809 hasConceptScore W2080900809C523546767 @default.
• W2080900809 hasConceptScore W2080900809C54355233 @default.
• W2080900809 hasConceptScore W2080900809C86803240 @default.
• W2080900809 hasConceptScore W2080900809C89423630 @default.
• W2080900809 hasConceptScore W2080900809C95444343 @default.
• W2080900809 hasIssue "5" @default.
• W2080900809 hasLocation W20809008091 @default.
• W2080900809 hasOpenAccess W2080900809 @default.
• W2080900809 hasPrimaryLocation W20809008091 @default.
• W2080900809 hasRelatedWork W1582099015 @default.
• W2080900809 hasRelatedWork W1908789024 @default.

• next