FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2080919449> ?p ?o ?g. }

• W2080919449 endingPage "21677" @default.
• W2080919449 startingPage "21668" @default.
• W2080919449 abstract "The human immunodeficiency virus (HIV) transactivator Tat is a potent activator of transcription from the HIV long terminal repeat and is essential for efficient viral gene expression and replication. Tat has been shown to interact with components of the basal transcription machinery and transcriptional activators. Here we identify the cellular coactivator PC4 as a Tat-interacting protein using the yeast two-hybrid system and confirmed this interaction both in vitro and in vivo by coimmunoprecipitation. We found that this interaction has a functional outcome in that PC4 overexpression enhanced activation of the HIV long terminal repeat in transient transfection studies in a Tat-dependent manner. The domains of PC4 and Tat required for the interaction were mapped. In vitro binding studies showed that the basic transactivation-responsive binding domain of Tat is required for the interaction with PC4. The minimum region of PC4 required for Tat binding was amino acids 22–91, whereas mutation of the lysine-rich domain between amino acids 22 and 43 prevented interaction with Tat. Tat-PC4 interactions may be controlled by phosphorylation, because phosphorylation of PC4 by casein kinase II inhibited interactions with Tat both in vivo and in vitro. We propose that PC4 may be involved in linking Tat to the basal transcription machinery. The human immunodeficiency virus (HIV) transactivator Tat is a potent activator of transcription from the HIV long terminal repeat and is essential for efficient viral gene expression and replication. Tat has been shown to interact with components of the basal transcription machinery and transcriptional activators. Here we identify the cellular coactivator PC4 as a Tat-interacting protein using the yeast two-hybrid system and confirmed this interaction both in vitro and in vivo by coimmunoprecipitation. We found that this interaction has a functional outcome in that PC4 overexpression enhanced activation of the HIV long terminal repeat in transient transfection studies in a Tat-dependent manner. The domains of PC4 and Tat required for the interaction were mapped. In vitro binding studies showed that the basic transactivation-responsive binding domain of Tat is required for the interaction with PC4. The minimum region of PC4 required for Tat binding was amino acids 22–91, whereas mutation of the lysine-rich domain between amino acids 22 and 43 prevented interaction with Tat. Tat-PC4 interactions may be controlled by phosphorylation, because phosphorylation of PC4 by casein kinase II inhibited interactions with Tat both in vivo and in vitro. We propose that PC4 may be involved in linking Tat to the basal transcription machinery. human immunodeficiency virus transactivation-responsive positive transcription factor b cyclin-dependent kinase nuclear factor KB phorbol myristate acetate glutathione S-transferase long terminal repeat polymerase chain reaction hemagglutinin polyacrylamide gel electrophoresis serine-enriched acidic cytomegalovirus casein kinase II The human immunodeficiency virus (HIV)1 transactivator Tat is an 86–101-amino acid protein that is a potent transcriptional activator of expression of all HIV proteins, including Tat itself. Tat expression is essential for HIV viral replication, because Tat defective viruses are unable to replicate or express viral proteins efficiently (1.Dayton A.I. Sodroski J.G. Rosen C.A. Goh W.C. Haseltine W.A. Cell. 1986; 44: 941-947Abstract Full Text PDF PubMed Scopus (411) Google Scholar, 2.Fisher A.G. Feinberg M.B. Josephs S.F. Harper M.E. Marselle L.M. Reyes G. Gonda M.A. Aldovini A. Debouk C. Gallo R.C. Wong-Staal F. Nature. 1986; 320: 367-371Crossref PubMed Scopus (426) Google Scholar). The Tat-responsive region of the HIV LTR has been mapped to an element immediately downstream of the transcription start site (3.Muesing M.A. Smith D.H. Capon D.J. Cell. 1987; 48: 691-701Abstract Full Text PDF PubMed Scopus (444) Google Scholar, 4.Rosen C.A. Sodroski J.G. Haseltine W.A. Cell. 1985; 41: 813-823Abstract Full Text PDF PubMed Scopus (500) Google Scholar). Tat is unusual in that it is targetted to the promoter by binding to a 59-nucleotide stem-loop structure in the nascent RNA called the transactivation-responsive (TAR) element, which is found at the 5′ end of all HIV viral RNAs (5.Dingwall C. Ernberg I. Gait M.J. Green S.M. Heaphy S. Karn J. Lowe A.D. Singh M. Skinner M.A. Valerio R. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 6925-6929Crossref PubMed Scopus (398) Google Scholar, 6.Berhkout B. Silverman R.H. Jeang K. Cell. 1989; 59: 273-282Abstract Full Text PDF PubMed Scopus (507) Google Scholar, 7.Dingwall C. Ernberg I. Gait M.J. Green S.M. Heaphy S. Karn J. Lowe A.D. Singh M. Skinner M.A. EMBO J. 1990; 9: 4145-4153Crossref PubMed Scopus (338) Google Scholar, 8.Hauber J. Cullen B.R. J. Virol. 1988; 62: 673-679Crossref PubMed Google Scholar). Although Tat has been demonstrated to have effects on transcriptional initiation (9.Laspia M.F. Rice A.P. Mathews M.B. Cell. 1989; 59: 283-292Abstract Full Text PDF PubMed Scopus (424) Google Scholar), it differs from conventional activators in that its primary effect appears to be on transcriptional elongation (9.Laspia M.F. Rice A.P. Mathews M.B. Cell. 1989; 59: 283-292Abstract Full Text PDF PubMed Scopus (424) Google Scholar, 10.Rosen C.A. Sodroski J.G. Goh W.C. Dayton A.I. Lippke J. Haseltine W.A. Nature. 1986; 319: 555-559Crossref PubMed Scopus (176) Google Scholar, 11.Kao S.Y. Calman A.F. Luciw P.A. Peterlin B.M. Nature. 1987; 330: 489-493Crossref PubMed Scopus (615) Google Scholar). In the absence of Tat, short prematurely terminated RNA transcripts are produced, but Tat appears to modify RNA polymerase II to a form that elongates more efficiently (12.Kato H. Sumimoto H. Pognonec P. Chen C. Rosen C.A. Roeder R.G. Genes Dev. 1992; 6: 655-666Crossref PubMed Scopus (156) Google Scholar). Recently a mechanism has been established to explain how Tat promotes transcriptional elongation. Phosphorylation of the C-terminal domain of RNA polymerase II by cellular kinases marks the transition from an initiation complex to an efficiently elongating polymerase complex, and a primary role of Tat appears to be to recruit such kinases. Tat targets two cyclin-dependent kinases, cdk7, the kinase component of TFIIH, and cdk9, the kinase component of positive transcription elongation factor b (pTEFb), which together are proposed to hyperphosphorylate RNA polymerase II (reviewed in Refs. 13.Jones K.A. Genes Dev. 1997; 11: 2593-2599Crossref PubMed Scopus (195) Google Scholar and 14.Yankulov K. Bentley D. Curr. Biol. 1998; 8: R447-R449Abstract Full Text Full Text PDF PubMed Google Scholar). Tat, through its activation domain, interacts with the general transcription factor, TFIIH (15.Blau J. Xiao H. McCracken S. O'Hare P. Greenblatt J. Bentley D. Mol. Cell. Biol. 1996; 16: 2044-2055Crossref PubMed Scopus (235) Google Scholar), and stimulates the phosphorylation of the C-terminal domain of RNA polymerase II by its kinase component, cdk7 (16.Parada C.A. Roeder R.G. Nature. 1996; 384: 375-378Crossref PubMed Scopus (237) Google Scholar, 17.Cujec T.P. Okamoto H. Fujinaga K. Meyer J. Chamberlin H. Morgan D.O. Peterlin B.M. Genes Dev. 1997; 11: 2645-2657Crossref PubMed Scopus (180) Google Scholar). Similarly, the activation domain of Tat interacts with the cyclin T component of pTEFb, forming a complex with high affinity for the TAR element and recruiting the cdk9 component of pTEFb, which can phosphorylate RNA polymerase II (18.Fujinaga K. Cujec T.P. Peng J. Garriga J. Price D.H. Grana X. Peterlin B.M. J. Virol. 1998; 72: 7154-7159Crossref PubMed Google Scholar, 19.Wei P. Garber M.E. Fang S. Fischer W.H. Jones K.A. Cell. 1998; 92: 451-462Abstract Full Text Full Text PDF PubMed Scopus (1038) Google Scholar, 20.Zhou Q. Chen D. Pierstorff E. Luo K. EMBO J. 1998; 17: 3681-3691Crossref PubMed Scopus (178) Google Scholar). It is therefore proposed that Tat stimulates hyperphosphorylation of RNA polymerase II by recruiting cdk7 and cdk9 and thus creates a highly efficient and processive RNA polymerase II complex. However, Tat has been shown to interact with a wide range of cellular proteins, and it is unclear how these interactions fit into the above model of Tat transactivation. For example, Tat is found complexed to components of the basal machinery such as the core RNA polymerase II itself (21.Mavankal G. Ou S.H.I. Oliver H. Sigman D. Gaynor R.B. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 2089-2094Crossref PubMed Scopus (62) Google Scholar, 22.Cujec T.P. Cho H. Maldonado E. Meyer J. Reinberg D. Peterlin B.M. Mol. Cell. Biol. 1997; 17: 1817-1823Crossref PubMed Scopus (108) Google Scholar), the TATA-binding protein (TBP) subunit of TFIID (23.Kashanchi F. Piras G. Radonovich M.F. Duvall J.F. Fattaey A. Chiang C.M. Roeder R.G. Brady J.N. Nature. 1994; 367: 295-299Crossref PubMed Scopus (228) Google Scholar,24.Veschambre P. Simard P. Jalinot P. J. Mol. Biol. 1995; 7: 169-180Crossref Scopus (66) Google Scholar), and the TFIID associated factor, TAFII55 (25.Chiang C.M. Roeder R.G. Science. 1995; 267: 531-536Crossref PubMed Scopus (351) Google Scholar). Replication of the HIV virus is regulated by both viral and cellular proteins, and Tat also functions in concert with cellular transcription factors, which bind to and activate the HIV LTR. For example, the core region of the HIV LTR contains three SP1-binding sites. Tat, via its basic domain, interacts with SP1 (26.Jeang K.T. Chun R. Lin N.H. Gatignol A. Glabe C.G. Fan H. J. Virol. 1993; 67: 6224-6233Crossref PubMed Google Scholar), and this interaction has been shown to enhance phosphorylation of SP1 by double-stranded DNA-dependent protein kinase (DNA-PK) (27.Chun, R. F., Semmes, O. J., Neuveut, C., and Jeang, K. T. (1998) 72, 2615–2629Google Scholar). The phosphorylation of SP1 has been correlated to enhanced HIV LTR function. The enhancer region of the HIV LTR contains binding sites for transcription factors such as NF-KB, nuclear factor of activated T cells, and activator protein 1. This region includes a tandem NF-KB repeat, which is essential for viral replication and gene expression (28.Alcami J. de Lera T.L. Folgueira L. Pedraza M. Jacque J. Bachelerie F. Noriega A.R. Hay R.T. Harrich D. Gaynor R.B. Virelizier J. Arenzana-Seisdedos F. EMBO J. 1995; 14: 1552-1560Crossref PubMed Scopus (218) Google Scholar). Maximal activation of the HIV LTR results from the co-operative actions of Tat and the NF-KB proteins, which bind to these elements (29.Liu J. Perkins N.D. Schmid R.M. Nabel G.J. J. Virol. 1992; 66: 3883-3887Crossref PubMed Google Scholar). In contrast the transcription factor nuclear factor of activated T cells, which has been shown to compete with NF-KB for occupancy of these sites, interacts directly with the N-terminal region of Tat and represses Tat activation of the HIV LTR (30.Macian F. Rao A. Mol. Cell. Biol. 1999; 19: 3645-3653Crossref PubMed Scopus (67) Google Scholar). Furthermore, Tat via its basic domain has been shown to interact with the transcriptional coactivators p300 and CREB-binding protein (31.Hottiger M.O. Nabel G.J. J. Virol. 1998; 72: 8252-8256Crossref PubMed Google Scholar, 32.Benkarine M. Chun R.F. Xiao X. Ogryzko V.V. Howard B.H. Nakatani Y. Jeang K.T. J. Biol. Chem. 1998; 273: 24898-24905Abstract Full Text Full Text PDF PubMed Scopus (251) Google Scholar), which may serve to complex Tat with the basal transcription machinery. These coactivators are also associated with histone acetylation and chromatin remodelling. Other cellular cofactors may also interact with Tat and mediate interactions with the transcription machinery or enhancer complex. In fact, there are presently several other cellular proteins of unknown function that have been isolated as Tat interactors (33.Fridell R.A. Harding L.S. Bogerd H.P. Cullen B.R. Virology. 1995; 209: 347-357Crossref PubMed Scopus (113) Google Scholar, 34.Yu L. Zhang A. Lowenstein P.M. Desai K. Tang Q. Mao D. Symington J.S. Grenn M. J. Virol. 1995; 69: 3007-3016Crossref PubMed Google Scholar, 35.Shibuya H. Irie K. Ninomiya-Tsuji J. Goebl M. Taniguchi T. Matsumoto K. Nature. 1992; 357: 700-702Crossref PubMed Scopus (141) Google Scholar, 36.Nelbock P. Dillon P.J. Perkins A. Rosen C.A. Science. 1990; 248: 1650-1653Crossref PubMed Scopus (195) Google Scholar). We used the yeast two-hybrid system to screen for cellular proteins in CD28 activated T cells that might interact with Tat and modulate its function. There is recent evidence that Tat may modify T cell gene expression through the CD28 costimulatory receptor signaling pathway (37.Ott M. Emiliani S. Lint C.V. Herbein G. Lovett J. Chirmule N. McClosky T. Pahwa S. Verdin E. Science. 1997; 275: 1481-1485Crossref PubMed Scopus (186) Google Scholar, 38.Ott M. Lovett J.L. Mueller L. Verdin E. J. Immunol. 1998; 160: 2872-2880PubMed Google Scholar), and therefore CD28 activated cells may have unique Tat-interacting proteins. We isolated a transcriptional cofactor known as PC4 (positive cofactor 4) in this screen. We have demonstrated a specific interaction between Tat and PC4 and identified the regions of the proteins involved. In addition we have shown a functional consequence of this interaction on transcription from the HIV LTR. Yeast two-hybrid plasmids, pEG202, pSH18-34, pJG4–5 and the yeast strain EGY48 were donated by Dr. R. Brent and have been described previously (39.Gyuris J. Golemis E. Chertkov H. Brent R. Cell. 1993; 75: 791-803Abstract Full Text PDF PubMed Scopus (1316) Google Scholar). Tat (amino acids 1–86) was amplified by PCR from the clone pCDM-Tat (40.Peng H. Reinhart T.A. Retzel E.F. Staskus K.A. Zupancic M. Haase A.T. Virology. 1995; 206: 16-27Crossref PubMed Scopus (32) Google Scholar) and ligated into pEG202 in frame and C-terminal to the LexA DNA-binding domain, usingEcoRI and XhoI sites generated in the PCR, forming pEG-Tat86. Similarly, Tat86 was ligated into pGEX-4T-1 (Amersham Pharmacia Biotech), in frame with the bacterial glutathioneS-transferase (GST) gene to generate the plasmid pGEX-Tat86. The deletion constructs GST-Tat 1–48, 49–86, and 1–57 were generated similarly, by cloning the respective PCR products into pGEX-4T-1. GST-Tat Basic and Tat 1–57Basic were generated using PCR products amplified from pDex-Tat K/R (50.Kaiser K. Stelzer G. Meisterernst M. EMBO J. 1995; 14: 3520-3527Crossref PubMed Scopus (90) Google Scholar, 51.Ge H. Zhao Y. Chait B.T. Roeder R.G. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 12691-12695Crossref PubMed Scopus (62) Google Scholar, 52.Kannan P. Tainsky M.A. Mol. Cell. Biol. 1999; 19: 899-908Crossref PubMed Scopus (52) Google Scholar, 53.Chang Y.N. Keang K.T. Nucleic Acids Res. 1992; 20: 5465-5472Crossref PubMed Scopus (31) Google Scholar, 54.Werten S. Stelzer G. Goppelt A. Langen F.M. Gros P. Timmers H.T.M. Van der Vliet P.C. Meisterernst M. EMBO J. 1998; 17: 5103-5111Crossref PubMed Scopus (56) Google Scholar, 55.Brandsen J. Werten S. Van der Vliet P.C. Meisterernst M. Kroon J. Gros P. Nat. Struct. Biol. 1997; 4: 900-903Crossref PubMed Scopus (65) Google Scholar, 56.Werten S. Langen F.W.M. Van Schaik R. Timmers H.T.M. Meisterernst M. Van der Vliet P.C. J. Mol. Biol. 1998; 276: 367-377Crossref PubMed Scopus (44) Google Scholar, 57.Currie R.A. J. Biol. Chem. 1998; 273: 18220-18229Abstract Full Text Full Text PDF PubMed Scopus (17) Google Scholar)G, which has been described previously (41.Ulich C. Dunne A. Parry E. Hooker C.W. Gaynor R.B. Harrich D. J. Virol. 1999; 73: 2499-2508Crossref PubMed Google Scholar). pGEX-Myb was provided by Dr. T. Gonda and has been described previously (pGEX2TK-NRD2, 42). PC4 cDNA was released from the library vector pJG4.5 by digestion with EcoRI and XhoI and ligated into the eukaryotic expression vector pSG5 (Stratagene) to generate SG5-PC4. PC4 was amplified by PCR and cloned into pSG5 in the reverse orientation to generate SG5-αPC4. The N-terminal 1–62 amino acids and C-terminal 63–127 amino acids of PC4 (see Fig. 1) were amplified by PCR from pJG-PC4 and ligated into RcCMV (Invitrogen) to generate the constructs CMV-PC4NT and CMV-PC4CT, respectively. Tat86 was amplified by PCR from pCDM-Tat and ligated into RcCMV in frame and N-terminal to a synthetic influenza hemagglutinin (HA) tag using HindIII andSacII sites generated by the PCR to produce the construct CMV-TatHA. PC4 was amplified from pJG-PC4 and ligated into RcCMV in frame and N-terminal to a synthetic c-Myc tag to produce the construct CMV-PC4Myc. The PC4 bacterial expression plasmid pet11a PC4WT and derivatives have been described previously (43.Kretzschmar M. Kaiser K. Lottspeich F. Meisterernst M. Cell. 1994; 78: 525-534Abstract Full Text PDF PubMed Scopus (164) Google Scholar). Lysine mutants were generated using the following oligonucleotides: K23E/K26E (GGAATTCCATATGGACGAAAA GTTAGA GAGGAAAA) and K24E/K28E (GGAATTCCATATGGACAAAGAGTTAAAGAGGGAAA). The bacterial expression plasmids pBAD-PC4, 43–127, 31–127, and 1–62 (see Fig. 1) were generated by cloning the respective PCR products into pBAD/Myc-HisB (Invitrogen) N-terminal and inframe with the Myc-His tag. The scanning PC4 mutants that replace 6 wild type amino acids with the sequence AAASAA where constructed using a PCR technique (44.Zaret K.S. Lin J. DiPersio C.M. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 5469-5473Crossref PubMed Scopus (69) Google Scholar). Briefly, two external primers were designed complementary to the pBad-PC4 plasmid, 5′ and 3′ to the PC4 insert and containing a BstEII and XbaI restriction site, respectively. For each mutant two internal primers were designed. The primer for the 5′ product contained gcg, 6 bases forming a NheI site (gctagc), ggcagc, and 15 bases complementary to the PC4 sequence. The primer for the 3′ product contained cgc, 6 bases forming a NheI site (gctagc), gctgct and 15 bases complementary to the PC4 sequence. Using the appropriate external and internal primer, the two products were generated by PCR, cleaved with BstEII and NheI or NheI and XbaI, gel purified, and ligated together. The full-length product was then gel purified and ligated into aBstEII/XbaI-digested pBad vector. The HIV LTR reporter construct (pHIVluc) was generated by cloning −453 to +80 of the HIV LTR into the HindIII and XhoI sites of the luciferase reporter pXp1. Jurkat T cells were stimulated for 9 h with 20 ng/ml PMA, 1 μm calcium ionophore A23187 (Roche Diagnostics), and a 1:10,000 dilution of α-CD28 ascites (Bristol Myers Squibb). Total RNA was isolated by a modification of the method of Chomczynski and Sacchi (45.Chomczynski P. Sacchi N. Anal. Biochem. 1987; 162 (159): 256Crossref Scopus (62909) Google Scholar). Briefly, cells were lysed in guanidinium solution (4 m guanidinium thiocyanate, 25 mm sodium citrate, pH 7, 0.5% sarcosyl, 0.1 m β-mercaptoethanol), phenol/chloroform extracted, ethanol precipitated, and dissolved in DEPC-treated water. Poly(A)+ mRNA was isolated using the Dynabeads mRNA purification kit (DYNAL), according to the manufacturers instructions. A cDNA library was prepared by a modification of the method of Gubler and Hoffman (46.Gubler U. Hoffman B.J. Gene (Amst.). 1983; 25: 263-269Crossref PubMed Scopus (3065) Google Scholar). Briefly, oligo(dT) primers incorporating aXhoI restriction site were hybridized to the mRNA, and the first strand was synthesized using MMLV reverse transcriptase (Supercript II, Life Technologies, Inc.) and dNTP mix including 5-methyl-dCTP rather than dCTP. The RNA was removed and second strand generated using RNaseH and Escherichia coli DNA polymerase I. The cDNA was blunt-ended using Vent DNA Polymerase andEcoRI adaptors (Promega) ligated onto the blunt ends. The cDNA was digested with XhoI, with any internalXhoI sites being protected by 5-methyl-dCTP incorporation, and ligated into the vector pJG4.5 at the unique EcoRI andXhoI restriction sites. A yeast two-hybrid screen was performed as detailed elsewhere (47.Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. John Wiley & Sons, Inc., New York1993: 20.1.1-20.1.23Google Scholar). Briefly, the yeast strain EGY48 (ura3 trp1 his3 3LexA-operator-LEU2) was cotransformed by the lithium acetate method, with pEG-Tat86 and the LacZ reporter pSH18-34, which contains eight LexA operator-binding sites (LexAop). The yeast were then transformed with the pJG4.5 activated Jurkat T cell cDNA library and plated onto galactose-containing minimal medium. 74 Leu+ colonies were replica plated onto β-galactosidase assay plates containing galactose or dextrose as the carbon source. Of these, 17 colonies that demonstrated β-galactosidase activity on galactose- but not dextrose- containing medium were further characterized. Plasmid DNA was isolated from these colonies transformed into MC1061 E. coli by electroporation, and the plasmid DNA was subsequently isolated from ampicillin-resistant colonies. Rescued library plasmids were transformed back into EGY48 with the Tat86 bait to confirm an interaction and also with unrelated baits to test for specificity. Clones that specifically interacted with pEG-Tat86 were sequenced using the ABI PRISM Dye terminator Cycle Sequencing protocol (Perkin-Elmer). BL21 E. coli were transformed with pGEX constructs. Expression of fusion proteins was induced in exponentially growing bacteria with 0.1 mmisopropyl-1-thio-β-d-galactopyranoside for 4 h at 37 °C. GST proteins were purified from cell lysates using glutathione-Sepharose (Amersham Pharmacia Biotech) according to the manufacturer's instructions. Protein concentrations were determined by SDS-PAGE, using bovine serum albumin as a standard. BL21(DE3) E. coli were transformed with pET11a-PC4 plasmids. Expression of PC4 proteins was induced as above. Alternatively, TOP10E. coli were transformed with pBAD-PC4 plasmids and expression of PC4 proteins induced with 0.02% arabinose. Bacterial cells were lysed in lysis buffer (50 mm Tris-HCl, pH 7.4, 150 mm NaCl, 1% Nonidet P-40, 10% glycerol) by sonication, and cell debris was removed by centrifugation at 13,000 × g. Transfected COS-7 cells were released from flasks with 0.1 mm EDTA in phosphate-buffered saline and incubated in lysis buffer for 30 min, and cell debris was removed by centrifugation at 13,000 × g. Binding assays were performed for 1 h at 4 °C in lysis buffer containing 0.1 mg/ml bovine serum albumin using 10 μg of GST proteins bound to Sepharose beads and 20 μl of cell lysate containing approximately 1 μg of PC4 protein. The Sepharose beads were washed in lysis buffer, and bound complexes were eluted by boiling in SDS-PAGE load buffer. Proteins were resolved by SDS-PAGE in 15% polyacrylamide, transferred to nitrocellulose for 16 h and subjected to Western analysis using anti-PC4 antibodies (rabbit polyclonal) or anti-Myc antibodies (monoclonal, 9E10). Cell lysates containing approximately 1 μg of PC4 were treated with 10 units alkaline phosphatase (calf intestinal alkaline phosphatase, New England Biolabs) in phosphatase buffer (New England Biolabs) for 30 min at 37 °C in a 20-μl reaction. Alternatively, lysates were treated with 1 unit of casein kinase II (New England Biolabs) in CKII buffer (New England Biolabs) for 30 min at 30 °C. Human Jurkat T cells were cultured in RPMI supplemented with 10% fetal calf serum. Jurkat T cells (4.5 × 106 cells in 300 μl of RPMI supplemented with 20% fetal calf serum) were transfected by electroporation using a Bio-Rad Gene Pulser II at 280 V and a capacitance of 975 microfarads. In all transfections 5 μg of reporter plasmid was used, and varying amounts of expression constructs were equalized by addition of parent plasmids, pSG5, or RcCMV. Cells were stimulated with a final concentration of 20 ng/ml PMA and 1 μm calcium ionophore at 24 h post transfection. For HIV LTR transfections, 1 × 105 cells were aliquotted into 96-well trays before stimulation. Luciferase assays were performed according to the previously published method (48.Himes S.R. Katsikeros R. Shannon M.F. J. Virol. 1996; 70: 4001-4008Crossref PubMed Google Scholar). Light emission was measured using a Packard Top Count Luminescence Counter. COS-7 cells were cultured in RPMI supplemented with 10% fetal calf serum. COS cells were released from flasks with trypsin, washed in phosphate-buffered saline, and resuspended in 0.8 ml of phosphate-buffered saline. Cells were transfected by electroporation at 280 V and a capacitance of 500 microfarads. COS cells were transfected with a total of 20 μg of expression plasmids. Transfected COS cells (1 × 106) were lysed 48 h post transfection in 0.4 ml of lysis buffer (25 mm Tris, pH 7.4, 150 mm NaCl, 10% glycerol, 1% Nonidet P-40) containing protease inhibitors (10 μg/ml leupeptin, 2 mm phenylmethylsulfonyl fluoride, 10 μg/ml aprotinin). Lysates were precleared for 1 h by incubation with 50 μl of 50% Sepharose CL4B slurry. Proteins were immunoprecipitated for 16 h with 100 μl of 50% anti-HA-Sepharose slurry. After washing in lysis buffer, proteins were subjected to SDS-PAGE and analyzed by Western blotting. Proteins were detected using ECL (Amersham Pharmacia Biotech) and visualized by autoradiography. Alternatively, for quantitation proteins were visualized using the Fuji luminescent image analyzer (LAS-1000 plus) and quantitated using the Fuji Image Gauge software. The yeast two-hybrid system was used to screen for Tat-interacting proteins expressed in activated Jurkat T cells. A Tat bait construct (pEG-Tat86) was generated in the vector pEG202 to produce a fusion protein comprising the first 86 amino acids of HIV Tat as a C-terminal fusion to a LexA DNA-binding domain. The bait was targeted to LexA DNA-binding sites upstream of the endogenous LEU2 gene in the yeast strain EGY48 (ura3 trp1 his3 3LexA-operator-LEU2) and also upstream LexA DNA-binding sites of the LacZ reporter construct, pSH18-34. Target proteins encoded by a cDNA library were expressed as fusion proteins to an “acid blob” activation domain under the control of a GAL1 promoter. Interaction of the bait and a target protein activated the endogenous LEU2 gene, detected by growth of yeast on leucine-deficient medium and activation of the LacZ reporter, which was visualized by a β-galactosidase assay. A cDNA library was generated in the vector pJG4.5 from Jurkat T cells activated with PMA, calcium ionophore and an anti-CD28 antibody. This expression library was screened for proteins that interacted with the Tat86 bait. Three distinct clones were detected that interacted with the Tat86 bait but did not interact with several nonrelated baits, including a Drosophila bicoid protein bait and baits generated from human c-Rel cDNA. The cDNAs encoding the interacting proteins were recovered from the yeast and sequenced. A clone that represented a particularly strong Tat interactor as assessed by β-galactosidase activity was found to be a full-length cDNA clone of the previously characterized transcriptional coactivator, PC4 (Refs. 49.Ge H. Roeder R.G. Cell. 1994; 78: 513-523Abstract Full Text PDF PubMed Scopus (305) Google Scholar and 43.Kretzschmar M. Kaiser K. Lottspeich F. Meisterernst M. Cell. 1994; 78: 525-534Abstract Full Text PDF PubMed Scopus (164) Google Scholar and Fig. 1). PC4 is a 127-amino acid bipartite protein (Fig. 1). The N-terminal region of PC4 (amino acids 1–62) contains two serine-enriched acidic (SEAC) domains (43.Kretzschmar M. Kaiser K. Lottspeich F. Meisterernst M. Cell. 1994; 78: 525-534Abstract Full Text PDF PubMed Scopus (164) Google Scholar, 49.Ge H. Roeder R.G. Cell. 1994; 78: 513-523Abstract Full Text PDF PubMed Scopus (305) Google Scholar), whereas the C-terminal region of the protein (amino acids 63–127) contains a single-stranded DNA-binding motif (50.Kaiser K. Stelzer G. Meisterernst M. EMBO J. 1995; 14: 3520-3527Crossref PubMed Scopus (90) Google Scholar). A lysine-rich region, which may be involved in the nonsequence specific binding of PC4 to double-stranded DNA, is situated between the 2 SEAC domains in the N-terminal region of the protein (50.Kaiser K. Stelzer G. Meisterernst M. EMBO J. 1995; 14: 3520-3527Crossref PubMed Scopus (90) Google Scholar). PC4 has been demonstrated to function as a coactivator for a range of transcriptional activators in in vitro transcription systems. It has been suggested that PC4 may act as an adaptor type molecule linking activators with the preinitiation complex because PC4 has been shown to interact with both transcription factors and components of the basal transcription machinery (e.g.TFIIA). Therefore, PC4 is a candidate for a Tat coactivator involved in the interaction of Tat with the basal transcription machinery. To confirm the interaction between Tat and PC4, binding assays were performed between a GST-Tat protein expressed in bacteria and subsequently immobilized on glutathione-Sepharose beads and a bacterially expressed PC4 protein. Western analysis of E. coli lysates using an anti-PC4 antibody revealed a 16-kDa protein (Fig. 2 A, lane 1). This PC4 protein bound to the GST-Tat fusion protein (Fig.2 A, lane 3) but did not bind to a GST protein alone or to a GST-Myb fusion protein (Fig. 2 A, lanes 2 and 4, respectively). The presence of GST fusion proteins in the binding studies was confirmed by reprobing the blot with an anti-GST antibody (Fig. 2 A, lower panel). To determine whether Tat could also interact with endogenous cellular PC4, binding assays were performed between GST-Tat fusion protein immobilized on glutathione-Sepharose and COS cell lysates. Cell lysates were incubated with GST alone or GST-Tat protein. Western analysis of the COS cell lysate with an anti-PC4 antibody revealed a single 16-kDa protein (Fig. 2 B, lane 1). This protein bound to GST-Tat (Fig. 2 B, lane 3) but not to the GST control (lane 2). These experiments show that Tat can interact with both bacterially expressed and endogen" @default.
• W2080919449 created "2016-06-24" @default.
• W2080919449 creator A5010195864 @default.
• W2080919449 creator A5028262165 @default.
• W2080919449 creator A5088119801 @default.
• W2080919449 creator A5088912742 @default.
• W2080919449 creator A5091220852 @default.
• W2080919449 date "2000-07-01" @default.
• W2080919449 modified "2023-10-14" @default.
• W2080919449 title "Functional Interaction between the HIV Transactivator Tat and the Transcriptional Coactivator PC4 in T Cells" @default.
• W2080919449 cites W1484941046 @default.
• W2080919449 cites W1570188208 @default.
• W2080919449 cites W1605613258 @default.
• W2080919449 cites W1622061844 @default.
• W2080919449 cites W1771551752 @default.
• W2080919449 cites W1957422323 @default.
• W2080919449 cites W1966425882 @default.
• W2080919449 cites W1968743207 @default.
• W2080919449 cites W1971336145 @default.
• W2080919449 cites W1972407993 @default.
• W2080919449 cites W1981735048 @default.
• W2080919449 cites W1982685209 @default.
• W2080919449 cites W1984064054 @default.
• W2080919449 cites W1988646837 @default.
• W2080919449 cites W1995472790 @default.
• W2080919449 cites W2005133363 @default.
• W2080919449 cites W2008391205 @default.
• W2080919449 cites W2012015834 @default.
• W2080919449 cites W2025485946 @default.
• W2080919449 cites W2028706937 @default.
• W2080919449 cites W2033217413 @default.
• W2080919449 cites W2046462022 @default.
• W2080919449 cites W2046854154 @default.
• W2080919449 cites W2052754749 @default.
• W2080919449 cites W2059391115 @default.
• W2080919449 cites W2060017591 @default.
• W2080919449 cites W2061601461 @default.
• W2080919449 cites W2064050331 @default.
• W2080919449 cites W2071993841 @default.
• W2080919449 cites W2072528655 @default.
• W2080919449 cites W2074395777 @default.
• W2080919449 cites W2076100163 @default.
• W2080919449 cites W2079470630 @default.
• W2080919449 cites W2080057367 @default.
• W2080919449 cites W2084627994 @default.
• W2080919449 cites W2086584161 @default.
• W2080919449 cites W2087123043 @default.
• W2080919449 cites W2089768147 @default.
• W2080919449 cites W2090084965 @default.
• W2080919449 cites W2091239909 @default.
• W2080919449 cites W2095839679 @default.
• W2080919449 cites W2102380059 @default.
• W2080919449 cites W2102716555 @default.
• W2080919449 cites W2108754630 @default.
• W2080919449 cites W2108857688 @default.
• W2080919449 cites W2114151755 @default.
• W2080919449 cites W2119043372 @default.
• W2080919449 cites W2119431042 @default.
• W2080919449 cites W2154743385 @default.
• W2080919449 cites W2160074522 @default.
• W2080919449 cites W2160557659 @default.
• W2080919449 cites W2163757819 @default.
• W2080919449 cites W2169824225 @default.
• W2080919449 cites W257400002 @default.
• W2080919449 cites W4294216491 @default.
• W2080919449 cites W4313333734 @default.
• W2080919449 doi "https://doi.org/10.1074/jbc.m909058199" @default.
• W2080919449 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10887206" @default.
• W2080919449 hasPublicationYear "2000" @default.
• W2080919449 type Work @default.
• W2080919449 sameAs 2080919449 @default.
• W2080919449 citedByCount "22" @default.
• W2080919449 countsByYear W20809194492014 @default.
• W2080919449 countsByYear W20809194492015 @default.
• W2080919449 countsByYear W20809194492016 @default.
• W2080919449 countsByYear W20809194492017 @default.
• W2080919449 countsByYear W20809194492021 @default.
• W2080919449 countsByYear W20809194492023 @default.
• W2080919449 crossrefType "journal-article" @default.
• W2080919449 hasAuthorship W2080919449A5010195864 @default.
• W2080919449 hasAuthorship W2080919449A5028262165 @default.
• W2080919449 hasAuthorship W2080919449A5088119801 @default.
• W2080919449 hasAuthorship W2080919449A5088912742 @default.
• W2080919449 hasAuthorship W2080919449A5091220852 @default.
• W2080919449 hasBestOaLocation W20809194491 @default.
• W2080919449 hasConcept C104317684 @default.
• W2080919449 hasConcept C1292079 @default.
• W2080919449 hasConcept C159047783 @default.
• W2080919449 hasConcept C185592680 @default.
• W2080919449 hasConcept C3013748606 @default.
• W2080919449 hasConcept C55493867 @default.
• W2080919449 hasConcept C77445288 @default.
• W2080919449 hasConcept C86339819 @default.
• W2080919449 hasConcept C86803240 @default.
• W2080919449 hasConcept C95444343 @default.
• W2080919449 hasConceptScore W2080919449C104317684 @default.
• W2080919449 hasConceptScore W2080919449C1292079 @default.
• W2080919449 hasConceptScore W2080919449C159047783 @default.

• next