FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2081614212> ?p ?o ?g. }

• W2081614212 endingPage "23552" @default.
• W2081614212 startingPage "23541" @default.
• W2081614212 abstract "In Arabidopsis the NRT2.1 gene encodes a main component of the root high-affinity nitrate uptake system (HATS). Its regulation has been thoroughly studied showing a strong correlation between NRT2.1 expression and HATS activity. Despite its central role in plant nutrition, nothing is known concerning localization and regulation of NRT2.1 at the protein level. By combining a green fluorescent protein fusion strategy and an immunological approach, we show that NRT2.1 is mainly localized in the plasma membrane of root cortical and epidermal cells, and that several forms of the protein seems to co-exist in cell membranes (the monomer and at least one higher molecular weight complex). The monomer is the most abundant form of NRT2.1, and seems to be the one involved in NO3− transport. It strictly requires the NAR2.1 protein to be expressed and addressed at the plasma membrane. No rapid changes in NRT2.1 abundance were observed in response to light, sucrose, or nitrogen treatments that strongly affect both NRT2.1 mRNA level and HATS activity. This suggests the occurrence of post-translational regulatory mechanisms. One such mechanism could correspond to the cleavage of NRT2.1 C terminus, which results in the presence of both intact and truncated proteins in the plasma membrane. In Arabidopsis the NRT2.1 gene encodes a main component of the root high-affinity nitrate uptake system (HATS). Its regulation has been thoroughly studied showing a strong correlation between NRT2.1 expression and HATS activity. Despite its central role in plant nutrition, nothing is known concerning localization and regulation of NRT2.1 at the protein level. By combining a green fluorescent protein fusion strategy and an immunological approach, we show that NRT2.1 is mainly localized in the plasma membrane of root cortical and epidermal cells, and that several forms of the protein seems to co-exist in cell membranes (the monomer and at least one higher molecular weight complex). The monomer is the most abundant form of NRT2.1, and seems to be the one involved in NO3− transport. It strictly requires the NAR2.1 protein to be expressed and addressed at the plasma membrane. No rapid changes in NRT2.1 abundance were observed in response to light, sucrose, or nitrogen treatments that strongly affect both NRT2.1 mRNA level and HATS activity. This suggests the occurrence of post-translational regulatory mechanisms. One such mechanism could correspond to the cleavage of NRT2.1 C terminus, which results in the presence of both intact and truncated proteins in the plasma membrane. The NRT2.1 gene of Arabidopsis thaliana is part of a small multigene family comprising 7 members, which with the exception of NRT2.7, are predominantly expressed in the roots (1Orsel M. Filleur S. Fraisier V. Daniel-Vedele F. J. Exp. Bot. 2002; 53: 825-833Crossref PubMed Scopus (135) Google Scholar, 2Okamoto M. Vidmar J.J. Glass A.D. Plant Cell Physiol. 2003; 44: 304-317Crossref PubMed Scopus (261) Google Scholar). NRT2 genes are found in a large variety of organisms (fungi, certain yeasts, green algae, and plants) and belong to the nitrate nitrite porter family of transporter genes (3Forde B.G. Biochim. Biophys. Acta. 2000; 1465: 219-235Crossref PubMed Scopus (436) Google Scholar). It is generally assumed that NRT2 genes encode high-affinity nitrate ( NO3−) or nitrite transporters (4Filleur S. Daniel-Vedele F. Planta. 1999; 207: 461-469Crossref PubMed Scopus (114) Google Scholar, 5Galvan A. Fernandez E. Cell Mol. Life Sci. 2001; 58: 225-233Crossref PubMed Scopus (115) Google Scholar, 6Gao-Rubinelli F. Marzluf G.A. Biochem. Genet. 2004; 42: 21-34Crossref PubMed Scopus (16) Google Scholar, 7Perez M.D. Gonzalez C. Avila J. Brito N. Siverio J.M. Biochem. J. 1997; 321: 397-403Crossref PubMed Scopus (70) Google Scholar, 8Quesada A. Krapp A. Trueman L.J. Daniel-Vedele F. Fernandez E. Forde B.G. Caboche M. Plant Mol. Biol. 1997; 34: 265-274Crossref PubMed Scopus (103) Google Scholar, 9Unkles S.E. Hawker K.L. Grieve C. Campbell E.I. Montague P. Kinghorn J.R. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 204-208Crossref PubMed Scopus (190) Google Scholar, 10Unkles S.E. Zhou D. Siddiqi M.Y. Kinghorn J.R. Glass A.D. EMBO J. 2001; 20: 6246-6255Crossref PubMed Scopus (66) Google Scholar, 11Zhuo D. Okamoto M. Vidmar J.J. Glass A.D. Plant J. 1999; 17: 563-568Crossref PubMed Scopus (226) Google Scholar), and that in higher plants, they play a key role in the root high-affinity transport system (HATS), 3The abbreviations used are: HATS, high-affinity transport system; GFP, green fluorescent protein; MES, 4-morpholineethanesulfonic acid; ER, endoplasmic reticulum; ELISA, enzyme-linked immunosorbent assay; PM, plasma membrane; WT, wild type; PIP2, plasma membrane intrinsic protein. 3The abbreviations used are: HATS, high-affinity transport system; GFP, green fluorescent protein; MES, 4-morpholineethanesulfonic acid; ER, endoplasmic reticulum; ELISA, enzyme-linked immunosorbent assay; PM, plasma membrane; WT, wild type; PIP2, plasma membrane intrinsic protein. which ensures uptake of NO3− from the soil solution (3Forde B.G. Biochim. Biophys. Acta. 2000; 1465: 219-235Crossref PubMed Scopus (436) Google Scholar, 12Crawford N.M. Glass A.D.M. Trends Plant Sci. 1998; 3: 389-395Abstract Full Text Full Text PDF Scopus (703) Google Scholar, 13Daniel-Vedele F. Filleur S. Caboche M. Curr. Opin. Plant Biol. 1998; 1: 235-239Crossref PubMed Scopus (147) Google Scholar, 14Williams L. Miller A. Annu. Rev. Plant Physiol. Plant. Mol. Biol. 2001; 52: 659-688Crossref PubMed Scopus (233) Google Scholar). In all plant species investigated to date, the NO3− HATS displays a saturable activity, with a Vmax generally reached for NO3− concentrations comprised between 0.2 and 0.5 mm (3Forde B.G. Biochim. Biophys. Acta. 2000; 1465: 219-235Crossref PubMed Scopus (436) Google Scholar, 12Crawford N.M. Glass A.D.M. Trends Plant Sci. 1998; 3: 389-395Abstract Full Text Full Text PDF Scopus (703) Google Scholar, 14Williams L. Miller A. Annu. Rev. Plant Physiol. Plant. Mol. Biol. 2001; 52: 659-688Crossref PubMed Scopus (233) Google Scholar). Although the functional characterization of almost all higher plant NRT2 transporters remains to be done, it is now well documented that NRT2.1 is a major component of the HATS in A. thaliana as shown by the fact that (i) of the seven NRT2 members, only NRT2.1 transcript abundance showed significant correlation (r2 = 0.74) with HATS activity (2Okamoto M. Vidmar J.J. Glass A.D. Plant Cell Physiol. 2003; 44: 304-317Crossref PubMed Scopus (261) Google Scholar, 11Zhuo D. Okamoto M. Vidmar J.J. Glass A.D. Plant J. 1999; 17: 563-568Crossref PubMed Scopus (226) Google Scholar) and (ii) several mutants disrupted for the NRT2.1 gene (15Li W. Wang Y. Okamoto M. Crawford N.M. Siddiqi M.Y. Glass A.D. Plant Physiol. 2007; 143: 425-433Crossref PubMed Scopus (261) Google Scholar, 16Little D.Y. Rao H. Oliva S. Daniel-Vedele F. Krapp A. Malamy J.E. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 13693-13698Crossref PubMed Scopus (290) Google Scholar) or for both NRT2.1-NRT2.2 genes (17Cerezo M. Tillard P. Filleur S. Munos S. Daniel-Vedele F. Gojon A. Plant Physiol. 2001; 127: 262-271Crossref PubMed Scopus (187) Google Scholar, 18Filleur S. Dorbe M.F. Cerezo M. Orsel M. Granier F. Gojon A. Daniel-Vedele F. FEBS Lett. 2001; 489: 220-224Crossref PubMed Scopus (234) Google Scholar) have lost up to 75% of the high-affinity NO3− uptake activity. As a consequence, growth of these mutants is severely impaired at low NO3− concentration (15Li W. Wang Y. Okamoto M. Crawford N.M. Siddiqi M.Y. Glass A.D. Plant Physiol. 2007; 143: 425-433Crossref PubMed Scopus (261) Google Scholar, 19Orsel M. Chopin F. Leleu O. Smith S.J. Krapp A. Daniel-Vedele F. Miller A.J. Plant Physiol. 2006; 142: 1304-1317Crossref PubMed Scopus (231) Google Scholar, 20Orsel M. Eulenburg K. Krapp A. Daniel-Vedele F. Planta. 2004; 219: 714-721Crossref PubMed Scopus (103) Google Scholar), but not at high NO3− concentration when low-affinity transporters, most probably those of the NRT1 family (3Forde B.G. Biochim. Biophys. Acta. 2000; 1465: 219-235Crossref PubMed Scopus (436) Google Scholar, 12Crawford N.M. Glass A.D.M. Trends Plant Sci. 1998; 3: 389-395Abstract Full Text Full Text PDF Scopus (703) Google Scholar, 14Williams L. Miller A. Annu. Rev. Plant Physiol. Plant. Mol. Biol. 2001; 52: 659-688Crossref PubMed Scopus (233) Google Scholar), are active. Despite its firmly established role in root NO3− uptake, several aspects of NRT2.1 function remain enigmatic. First, unlike the Aspergillus nidulans or Chlorella sorokiniana NRT2 transporters (CRNA or ChNRT2.1, respectively) (21Zhou J.J. Trueman L.J. Boorer K.J. Theodoulou F.L. Forde B.G. Miller A.J. J. Biol. Chem. 2000; 275: 39894-39899Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar, 22Koltermann M. Moroni A. Gazzarini S. Nowara D. Tischner R. Plant Mol. Biol. 2003; 52: 855-864Crossref PubMed Scopus (14) Google Scholar), but similarly to NRT2 proteins of Chlamydomonas reinhardtii, NRT2.1 does not seem to be able to mediate NO3− transport on its own. In Xenopus oocytes, CrNRT2 and AtNRT2.1 (as well as its Hordeum vulgare homologue, HvNRT2.1) need to be co-expressed with a NAR2 protein, to yield NO3− transport (19Orsel M. Chopin F. Leleu O. Smith S.J. Krapp A. Daniel-Vedele F. Miller A.J. Plant Physiol. 2006; 142: 1304-1317Crossref PubMed Scopus (231) Google Scholar, 23Zhou J.J. Fernandez E. Galvan A. Miller A.J. FEBS Lett. 2000; 466: 225-227Crossref PubMed Scopus (93) Google Scholar, 24Tong Y. Zhou J.J. Li Z. Miller A.J. Plant J. 2005; 41: 442-450Crossref PubMed Scopus (149) Google Scholar). This has suggested that the actual transport system corresponds in fact to a dual component (NRT2/NAR2) transporter (19Orsel M. Chopin F. Leleu O. Smith S.J. Krapp A. Daniel-Vedele F. Miller A.J. Plant Physiol. 2006; 142: 1304-1317Crossref PubMed Scopus (231) Google Scholar, 24Tong Y. Zhou J.J. Li Z. Miller A.J. Plant J. 2005; 41: 442-450Crossref PubMed Scopus (149) Google Scholar). Indeed, a crucial role of the NRT2.1 putative partner, NAR2.1 (also called NRT3.1), is confirmed by the observation that mutants disrupted in the NAR2.1 gene (At5g50200) display an even stronger defect in HATS activity than the NRT2.1 mutants in Arabidopsis (19Orsel M. Chopin F. Leleu O. Smith S.J. Krapp A. Daniel-Vedele F. Miller A.J. Plant Physiol. 2006; 142: 1304-1317Crossref PubMed Scopus (231) Google Scholar, 25Okamoto M. Kumar A. Li W. Wang Y. Siddiqi M.Y. Crawford N.M. Glass A.D. Plant Physiol. 2006; 140: 1036-1046Crossref PubMed Scopus (193) Google Scholar). A second surprising aspect of NRT2.1 function is that it seems to be involved in the control of lateral root initiation, in a way that is independent from its transport activity (16Little D.Y. Rao H. Oliva S. Daniel-Vedele F. Krapp A. Malamy J.E. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 13693-13698Crossref PubMed Scopus (290) Google Scholar, 26Remans T. Nacry P. Pervent M. Girin T. Tillard P. Lepetit M. Gojon A. Plant Physiol. 2006; 140: 909-921Crossref PubMed Scopus (302) Google Scholar). Because NO3− is not only a major nitrogen source for nutrition of the plants, but also acts as a signal to modulate plant metabolism and development (27Crawford N.M. Plant Cell. 1995; 7: 859-868Crossref PubMed Scopus (736) Google Scholar, 28Stitt M. Curr. Opin. Plant Biol. 1999; 2: 178-186Crossref PubMed Scopus (477) Google Scholar), this gave rise to the hypothesis that NRT2.1 may also be a NO3− sensor, or a signal transducer (16Little D.Y. Rao H. Oliva S. Daniel-Vedele F. Krapp A. Malamy J.E. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 13693-13698Crossref PubMed Scopus (290) Google Scholar). The regulation of NRT2.1 expression has been thoroughly investigated at the mRNA level. NRT2.1 transcript accumulation predominantly occurs in epidermis and cortex of the mature root regions (29Nazoa P. Vidmar J.J. Tranbarger T.J. Mouline K. Damiani I. Tillard P. Zhuo D. Glass A.D. Touraine B. Plant Mol. Biol. 2003; 52: 689-703Crossref PubMed Scopus (163) Google Scholar), and is affected by a wide range of environmental changes. Expression of NRT2.1 is induced by low NO3− concentration (2Okamoto M. Vidmar J.J. Glass A.D. Plant Cell Physiol. 2003; 44: 304-317Crossref PubMed Scopus (261) Google Scholar, 4Filleur S. Daniel-Vedele F. Planta. 1999; 207: 461-469Crossref PubMed Scopus (114) Google Scholar, 11Zhuo D. Okamoto M. Vidmar J.J. Glass A.D. Plant J. 1999; 17: 563-568Crossref PubMed Scopus (226) Google Scholar, 30Lejay L. Tillard P. Lepetit M. Olive F. Filleur S. Daniel-Vedele F. Gojon A. Plant J. 1999; 18: 509-519Crossref PubMed Scopus (322) Google Scholar), feedback repressed by NH4+ and amino acids (11Zhuo D. Okamoto M. Vidmar J.J. Glass A.D. Plant J. 1999; 17: 563-568Crossref PubMed Scopus (226) Google Scholar, 29Nazoa P. Vidmar J.J. Tranbarger T.J. Mouline K. Damiani I. Tillard P. Zhuo D. Glass A.D. Touraine B. Plant Mol. Biol. 2003; 52: 689-703Crossref PubMed Scopus (163) Google Scholar, 30Lejay L. Tillard P. Lepetit M. Olive F. Filleur S. Daniel-Vedele F. Gojon A. Plant J. 1999; 18: 509-519Crossref PubMed Scopus (322) Google Scholar, 31Gansel X. Munos S. Tillard P. Gojon A. Plant J. 2001; 26: 143-155Crossref PubMed Google Scholar), and stimulated by light and sugars (30Lejay L. Tillard P. Lepetit M. Olive F. Filleur S. Daniel-Vedele F. Gojon A. Plant J. 1999; 18: 509-519Crossref PubMed Scopus (322) Google Scholar, 32Lejay L. Gansel X. Cerezo M. Tillard P. Muller C. Krapp A. von Wiren N. Daniel-Vedele F. Gojon A. Plant Cell. 2003; 15: 2218-2232Crossref PubMed Scopus (200) Google Scholar). These mechanisms are postulated to modulate root NO3− uptake as a function of both nitrogen and carbon status of the plant. More recently, NRT2.1 has been shown to be down-regulated by NO3− itself, through a mechanism independent of the feedback repression exerted by nitrogen metabolites, but specifically triggered by the dual-affinity NRT1.1 NO3− transporter (33Munos S. Cazettes C. Fizames C. Gaymard F. Tillard P. Lepetit M. Lejay L. Gojon A. Plant Cell. 2004; 16: 2433-2447Crossref PubMed Scopus (184) Google Scholar, 34Krouk G. Tillard P. Gojon A. Plant Physiol. 2006; 142: 1075-1086Crossref PubMed Scopus (122) Google Scholar). The NO3− HATS is subjected to the same controls, and in all cases, a strong correlation was found between the changes in NRT2.1 transcript level and those in NO3− HATS activity, suggesting that the transcriptional regulation of NRT2.1 expression plays a major role in governing root high-affinity NO3− uptake. However, a yet limited number of reports suggest that post-transcriptional regulation of NRT2 transporters may also participate to the modulation of root NO3− uptake in response to environmental changes. In Nicotiana plumbaginifolia ectopic overexpression of the NpNRT2.1 gene did not prevent the inhibition of root e NO3− uptake by exogenous NO3− supply (35Fraisier V. Gojon A. Tillard P. Daniel-Vedele F. Plant J. 2000; 23: 489-496Crossref PubMed Google Scholar). Likewise, in barley NH4+ accumulation in roots of plants treated with the glutamine synthetase inhibitor methionine sulfoximine decreased root NO3− uptake but did not change HvNRT2.1 transcript level (36Vidmar J.J. Zhuo D. Siddiqi M.Y. Schjoerring J.K. Touraine B. Glass A.D. Plant Physiol. 2000; 123: 307-318Crossref PubMed Scopus (199) Google Scholar). Further evidence for post-translational control of NRT2 transporters is provided by the recent report on YNT1 in the yeast Hansenula polymorpha, showing that this protein undergoes trafficking to the vacuole and proteolysis in response to glutamine supply (37Navarro F.J. Machin F. Martin Y. Siverio J.M. J. Biol. Chem. 2006; 281: 13268-13274Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar). To gain further insights on NRT2.1 at the protein level in Arabidopsis we initiated the biochemical characterization of its localization and regulation, by combining a GFP fusion strategy and an immunological investigation. Our results provide strong evidence that NRT2.1 is predominantly localized in the plasma membrane of root cortical and epidermal cells of the mature regions of the roots, and show that NAR2.1 is essential for NRT2.1 expression. They also reveal that several forms of the protein seem to co-exist in the plasma membrane. Furthermore, treatments, which rapidly modulate both NRT2.1 transcript level and NO3− HATS activity, are shown to yield only very slow responses of the NRT2.1 protein, suggesting the occurrence of important post-translational regulatory mechanisms. One such putative mechanism is unraveled, which could be associated with partial proteolysis of NRT2.1 resulting in the cleavage of the C terminus of the protein. Production of the PNRT2.1-NRT2.1-GFP Construct—Cloning of PNRT2.1-NRT2.1 (3114 bp, including the 1335-bp 5′ untranslated region and promoting sequence upstream the ATG) and fusion with GFP coding sequence at the 3′ end of NRT2.1 was performed using Gateway™ Technology, according to the manufacturer’s instructions (Gateway cloning manual, Invitrogen). The primers NRT2.1 GATE forward (CACCCACGTCAGCGAGATTGATCG) and NRT2.1 GATE reverse (AACATTGTTGGGTGTGTTCTCAGGC) were used to amplify the PNRT2.1-NRT2.1 complete DNA sequence from the bac clone T6D22 (ARBC, Columbus, OH). After gel purification of the PCR product with the Nucleo Spin® Extract Kit (Machery Nagel), PNRT2.1-NRT2.1 was cloned into the pENTR™/D-Topo vector (Invitrogen) to create an entry clone. After transformation of One Shot TOP10 thermocompetent Escherichia coli (Invitrogen) the vector was sequenced. LR (Invitrogen) reaction was performed to transfer PNRT2.1-NRT2.1 from entry clone to the destination binary vector pGWB4 (no promoter, C-sGFP) obtained from Tsuyoshi Nakagawa (Research Institute of Molecular Genetics, Shimane University, Matsue, Japan). Following the LR reaction thermocompetent DH5α E. coli were transformed and positive clones were selected with hygromycin. Prior transformation of Agrobacterium, part of the expression construct was sequenced to verify the translational fusion of PNRT2.1-NRT2.1 with the GFP tag. In addition we used plants, called P43NRT2.1, transformed with NRT2.1 fused to GFP in N-terminal, under the control of the 35S promoter as described in Chopin et al. (38Chopin F. Wirth J. Dorbe M.F. Lejay L. Krapp A. Gojon A. Daniel-Vedele F. Plant Physiol. Biochem. 2007; (, in press)PubMed Google Scholar). Plant Transformation—Binary vectors containing the GFP fusion construct were introduced into Agrobacterium tumefaciens strain GC3101. A. thaliana nrt2.1-1 mutant plants, ecotype Wassilewskija (18Filleur S. Dorbe M.F. Cerezo M. Orsel M. Granier F. Gojon A. Daniel-Vedele F. FEBS Lett. 2001; 489: 220-224Crossref PubMed Scopus (234) Google Scholar), were transformed by dipping the flowers in the presence of Silwet L77 (39Clough S.J. Bent A.F. Plant J. 1998; 16: 735-743Crossref PubMed Google Scholar). The transformants were selected on a medium containing 30 mg/liter of hygromycin. For further analyses, T1 segregation ratios were analyzed to select transformants with one T-DNA insertion and to isolate T3-homozygous plants. Growth Conditions—For all experiments, except those devoted to confocal imaging, plants were grown hydroponically using the experimental set-up described previously (30Lejay L. Tillard P. Lepetit M. Olive F. Filleur S. Daniel-Vedele F. Gojon A. Plant J. 1999; 18: 509-519Crossref PubMed Scopus (322) Google Scholar). Briefly, seeds were sown directly on the surface of wet sand in modified 1.5-ml microcentrifuge tubes, with the bottom replaced by a metal screen. The tubes supporting the seeds were placed on polystyrene floating rafts, on the surface of a 10-liter tank filled with tap water. The culture was then performed in a controlled growth chamber with 8 h/16 h day/night cycle at 24/20 °C. Light intensity during the light period was at 250 μmol m-2 s-1. One week after sowing, the tap water was replaced by nutrient solution until the age of 6-7 weeks depending on the size of the plants. The basal nutrient solutions supplied to the plants are those described by Gansel et al. (31Gansel X. Munos S. Tillard P. Gojon A. Plant J. 2001; 26: 143-155Crossref PubMed Google Scholar) and contained either 0.3 mm NO3−, 1 mm NO3−, 5 mm NO3−, or 10 mm NH4NO3 as nitrogen source. The nutrient solution was replaced every week during this period and the day before the experiment. For confocal imaging, plants were grown in sterile conditions in vertical agar plates (12 × 12 cm) on the same basal medium as used for hydroponic cultures plus 2.5 mm MES and 1.2% (w/v) agar type A (Sigma, product A4550). It contained 1 mm NO3− as nitrogen source and either 3% sucrose (w/v) or no sugar. The pH was adjusted to 5.8 with KOH. After sowing, the plates were transferred in a growth chamber with 16 h/8 h day/night cycle at 21/18 °C and 70% relative humidity. Light intensity during the light period was at 125 μmol m-2 s-1. Observations were performed after 14 days of growth. In Vivo Protein Cross-linking—According to Rohila et al. (40Rohila J.S. Chen M. Cerny R. Fromm M.E. Plant J. 2004; 38: 172-181Crossref PubMed Scopus (196) Google Scholar) in vivo protein cross-linking was performed by adding formaldehyde to the nutrient solution of hydroponically grown plants to get a final concentration of 1% (v/v). Plants were treated during 45 min before harvesting the roots for plasma membrane (PM) extraction. Confocal Microscopy—GFP images were acquired with a Zeiss LSM 510 axiovert 200M inverted microscope. GFP (excitation/emission maxima ∼488/507 nm) was excited with the 488 nm line of an Argon laser and detected via a 505-530 nm bandpass filter (green). Autofluorescence was detected via a 650-nm long pass filter (red). Dichroic mirrors used were HFT 488 and NFT 545. To visualize the different plant cell membranes, several stains were used. Images of the plasma membrane and the tonoplast were obtained after 5 min and at least 16 h of incubation with 8.2 μm of the endocytic tracer FM4-64 (Invitrogen, product F34653), respectively. The endoplasmic reticulum was visualized after 30 min staining with 5 μm endoplasmic reticulum (ER) Tracker (Blue-White DPX, Invitrogen). FM4-64 was visualized with the microscope used for GFP imaging. FM4-64 (excitation/emission maxima ∼515/640 nm) was excited with the 543-nm line and detected via LP 650 and LP 585, respectively. Dichroic mirrors used were HFT 488/543 and NFT 545. ER Tracker (excitation/emission maxima ∼347-640 nm) images were obtained with the Zeiss LSM 510 Meta Axioplan 2 microscope. ER Tracker was excited with the diode 405-nm laser for blue dye and detected via a 420-480 BP filter (blue). Dichroic mirrors used were HFT 405/488/543 and NFT 490. NRT2.1 Immunodetection and Membrane Purification—Root total proteins were extracted as described by Santoni et al. (41Santoni V. Bellini C. Caboche M. Planta. 1994; 192: 557-566Crossref Scopus (88) Google Scholar). Microsomes were prepared as described by Giannini et al. (42Giannini J.L. Gildensoph L.H. Reynolds-Niesman I. Briskin D.P. Plant Physiol. 1987; 85: 1129-1136Crossref PubMed Google Scholar) and plasma membrane vesicles were purified from microsomes by aqueous two-phase partitioning, as described by Santoni et al. (43Santoni V. Vinh J. Pflieger D. Sommerer N. Maurel C. Biochem. J. 2003; 373: 289-296Crossref PubMed Scopus (118) Google Scholar). Proteins were separated on denaturing SDS-PAGE followed by an electrotransfer at 4 °C onto a nitrocellulose membrane (0.2 μm, Sartorius, Goöttingen, Germany). NRT2.1 was detected using two different anti-NRT2.1 antisera produced by Eurogentec (Liege, Belgium) against either the synthetic peptide TLEKAGEVAKDKFGK (anti-NRT2.1 19) or CKNMHQGSLRFAENAK (anti-NRT2.1 20) (Fig. 2A). The two polyclonal anti-sera were affinity purified by Eurogentec. The immunodetection was performed with a chemiluminescent detection system kit (SuperSignal, Pierce). For ELISA, serial 2-fold dilutions in a carbonate buffer (30 mm Na2CO3, 60 mm NaHCO3, pH 9.5) of 500 ng of PM proteins were loaded in duplicate on Maxisorb immunoplates (Nunc, Denmark) and left overnight at 4 °C. The immunodetection was performed according to the manufacturer’s instructions. The primary anti-NRT2.1 20 antibody (1:2500 dilution) and a secondary peroxidase-coupled anti-rabbit antibody were successively applied for 2 h at 37 °C.A linear regression between the absorbance signal due to oxidized 2,2′-azinobis-3-ethylbenzothiazoline-6-sulfonic acid diammonium salt, as read with a multiplate reader (Victor, PerkinElmer Life Sciences), and the amount of proteins was obtained for each sample and used for relative comparison between samples. RNA Extraction and Reverse Transcription—RNA extraction was performed on roots as described previously (44Lobreaux S. Massenet O. Briat J.F. Plant Mol. Biol. 1992; 19: 563-575Crossref PubMed Scopus (136) Google Scholar) using guanidine hydrochloride and lithium chloride. Subsequently 40 μg of RNA were treated with DNase (RNase Free DNase Kit, Qiagen) and purified (RNeasy MinElute™ Cleanup Kit, Qiagen) following the manufacturer’s instructions. The absence of genomic DNA was verified by PCR using specific primers spanning an intron in the gene APTR (At1g27450). Reverse transcription was performed with 4 μg of purified RNA and oligo(dT)18 primers. The mixture was heated for 5 min at 72 °C and progressively (-1 °C per 10 s) cooled down to allow hybridization of the primers. The reaction was carried out in a volume of 20 μl in the presence of 200 units of Moloney murine leukemia virus reverse transcriptase (Promega) at 42 °C during 90 min. The quality of the cDNA was verified by PCR using the primers for the gene APTR. Quantitative PCR—Real-time amplification was performed in a LightCycler (Roche Diagnostics) with the kit SYBR Green (LightCycler FastStart DNA Master SYBR Green1, Roche Diagnostics) according to the manufacturer’s instructions with 1 μl of cDNA in a total volume of 10 μl. The following conditions of amplifications were applied: 10 min at 95 °C; 45 cycles of 5 sat 95 °C; 7 sat 65 ° C; and 8 sat 72 °C. A melting curve was then performed to verify the specificity of the amplification. Successive dilutions of one sample were used as a standard curve. Amplification efficiency was around 1. All the results presented were standardized using the housekeeping gene Clathrin (At4g24550). The primers used were: NRT2.1 forward, AACAAGGGCTAACGTGGATG; NRT2.1 reverse, CTGCTTCTCCTGCTCATTCC; Clath forward, AGCATACACTGCGTGCAAAG; Clath reverse, TCGCCTGTGTCACATATCTC. Root NO3− Influx Measurements—Root 15 NO3− influx was assayed as described by Dehlon et al. (45Delhon P. Gojon A. Tillard P. Passama L. J. Exp. Bot. 1995; 46: 1585-1594Crossref Scopus (145) Google Scholar). Briefly, the plants were sequentially transferred to 0.1 mm CaSO4 for 1 min, to complete nutrient solution, pH 5.8, containing 0.2 mm 15 NO3− (99 atom % excess 15N) for 5 min, and finally to 0.1 mm CaSO4 for 1 min. Roots were then separated from shoots, and the organs dried at 70 °C for 48 h. After determination of their dry weight, the samples were analyzed for total nitrogen and atom % 15N using a continuous flow isotope ratio mass spectrometer coupled with a C/N elemental analyzer (model ANCA-MS; PDZ Europa, Crewe, UK) as described in Clarkson et al. (46Clarkson D.T. Gojon A. Saker L.R. Wiersema P.K. Purves J.V. Tillard P. Arnold G.M. Paans A.J.M. Vaalburg W. Stulen I. Plant Cell Environ. 1996; 19: 859-868Crossref Scopus (52) Google Scholar). Each influx value is the mean of 6 to 12 replicates. Tissular and Subcellular Localization of NRT2.1—To investigate the localization of NRT2.1 in the roots, NRT2.1-GFP transgenic lines were generated by expressing a GFP-tagged NRT2.1 protein (C-terminal translational fusion) in the nrt2.1-1 knock-out mutant of NRT2.1. The GFP coding sequence was fused in-frame to the 3′ end of the NRT2.1 gene under the control of its own promoter. Two transgenic lines (GFP10 and GFP12) displayed both a correct regulation of the expression of the transgene and a functional complementation of the mutant phenotype (supplemental materials Fig. S1). In these lines, the expression of PNRT2.1-NRT2.1-GFP was induced by both light and sucrose in the roots, as it was the case for NRT2.1 in WT plants. The NO3− HATS activity, determined by root 15 NO3− influx assays (0.2 mm external 15 NO3− concentration), was also stimulated by the light/sucrose treatments in both GFP10 and GFP12 plants, and restored at higher values than those measured in the nrt2.1-1 mutant. Cell-type specific expression of NRT2.1-GFP was therefore studied by confocal microscopy in both GFP10 and GFP12 plants grown in vitro. In roots of GFP10 plants, GFP fluorescence was mainly localized in the cortical cells along the primary and secondary roots (Fig. 1, A and C), except in the apical part of these roots where GFP was not present (Fig. 1B). No fluorescence was detected in the stele of the roots (Fig. 1C), and in the leaves (results not shown). These results were confirmed using the GFP12 line (data not shown). In plants grown hydroponically, NRT2.1-GFP was also found in mature regions of the roots, where in addition to the cortex, it was also expressed in the epidermal cells, and in root hairs (Fig. 1D). The subcellular localization of the NRT2.1-GFP protein was investigated in roots of plants grown in vitro, using specific markers for cellular membranes. The PM and the tonoplast were visualized after a short and a long incubation with the red fluorescent dye FM4-64, respectively (47Bolte S. Talbot C. Boutte Y. Catrice O. Read N.D. Satiat-Jeunemaitre B. J. Microsc. (Oxf.). 2004; 214: 1" @default.
• W2081614212 created "2016-06-24" @default.
• W2081614212 creator A5007124296 @default.
• W2081614212 creator A5009750136 @default.
• W2081614212 creator A5014923320 @default.
• W2081614212 creator A5036494631 @default.
• W2081614212 creator A5048677262 @default.
• W2081614212 creator A5057108463 @default.
• W2081614212 creator A5067804419 @default.
• W2081614212 creator A5075052344 @default.
• W2081614212 creator A5086300034 @default.
• W2081614212 date "2007-08-01" @default.
• W2081614212 modified "2023-10-17" @default.
• W2081614212 title "Regulation of Root Nitrate Uptake at the NRT2.1 Protein Level in Arabidopsis thaliana" @default.
• W2081614212 cites W118891069 @default.
• W2081614212 cites W1591364463 @default.
• W2081614212 cites W1903282025 @default.
• W2081614212 cites W1955406302 @default.
• W2081614212 cites W1964333761 @default.
• W2081614212 cites W1964945634 @default.
• W2081614212 cites W1967311801 @default.
• W2081614212 cites W1971297481 @default.
• W2081614212 cites W1971869342 @default.
• W2081614212 cites W1980622401 @default.
• W2081614212 cites W1994717043 @default.
• W2081614212 cites W1998141700 @default.
• W2081614212 cites W1998224739 @default.
• W2081614212 cites W2002158823 @default.
• W2081614212 cites W2006038336 @default.
• W2081614212 cites W2007494100 @default.
• W2081614212 cites W2010862757 @default.
• W2081614212 cites W2024332328 @default.
• W2081614212 cites W2024575298 @default.
• W2081614212 cites W2037132451 @default.
• W2081614212 cites W2038330351 @default.
• W2081614212 cites W2052868391 @default.
• W2081614212 cites W2065907584 @default.
• W2081614212 cites W2066314387 @default.
• W2081614212 cites W2068188105 @default.
• W2081614212 cites W2068665946 @default.
• W2081614212 cites W2069003130 @default.
• W2081614212 cites W2076510885 @default.
• W2081614212 cites W2078259845 @default.
• W2081614212 cites W2083002999 @default.
• W2081614212 cites W2088942495 @default.
• W2081614212 cites W2090467527 @default.
• W2081614212 cites W2090626249 @default.
• W2081614212 cites W2091653004 @default.
• W2081614212 cites W2105738981 @default.
• W2081614212 cites W2111065587 @default.
• W2081614212 cites W2112906590 @default.
• W2081614212 cites W2116122104 @default.
• W2081614212 cites W2117260419 @default.
• W2081614212 cites W2120571291 @default.
• W2081614212 cites W2124338947 @default.
• W2081614212 cites W2124490222 @default.
• W2081614212 cites W2126366476 @default.
• W2081614212 cites W2126533737 @default.
• W2081614212 cites W2126890802 @default.
• W2081614212 cites W2132970959 @default.
• W2081614212 cites W2134949965 @default.
• W2081614212 cites W2138416674 @default.
• W2081614212 cites W2142434082 @default.
• W2081614212 cites W2143687691 @default.
• W2081614212 cites W2150040878 @default.
• W2081614212 cites W2154832105 @default.
• W2081614212 cites W2155095521 @default.
• W2081614212 cites W2156797879 @default.
• W2081614212 cites W2157443208 @default.
• W2081614212 cites W2158170416 @default.
• W2081614212 cites W2163843948 @default.
• W2081614212 cites W2168847574 @default.
• W2081614212 cites W2169568012 @default.
• W2081614212 cites W2169761723 @default.
• W2081614212 cites W233273695 @default.
• W2081614212 cites W2338176590 @default.
• W2081614212 cites W246704918 @default.
• W2081614212 cites W321893662 @default.
• W2081614212 cites W64069334 @default.
• W2081614212 doi "https://doi.org/10.1074/jbc.m700901200" @default.
• W2081614212 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17573350" @default.
• W2081614212 hasPublicationYear "2007" @default.
• W2081614212 type Work @default.
• W2081614212 sameAs 2081614212 @default.
• W2081614212 citedByCount "144" @default.
• W2081614212 countsByYear W20816142122012 @default.
• W2081614212 countsByYear W20816142122013 @default.
• W2081614212 countsByYear W20816142122014 @default.
• W2081614212 countsByYear W20816142122015 @default.
• W2081614212 countsByYear W20816142122016 @default.
• W2081614212 countsByYear W20816142122017 @default.
• W2081614212 countsByYear W20816142122018 @default.
• W2081614212 countsByYear W20816142122019 @default.
• W2081614212 countsByYear W20816142122020 @default.
• W2081614212 countsByYear W20816142122021 @default.
• W2081614212 countsByYear W20816142122022 @default.
• W2081614212 countsByYear W20816142122023 @default.
• W2081614212 crossrefType "journal-article" @default.

• next