FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2081618275> ?p ?o ?g. }

• W2081618275 endingPage "21355" @default.
• W2081618275 startingPage "21349" @default.
• W2081618275 abstract "The Na+-translocating NADH:quinone oxidoreductase from Vibrio cholerae is a six subunit enzyme containing four flavins and a single motif for the binding of a Fe-S cluster on its NqrF subunit. This study reports the production of a soluble variant of NqrF (NqrF′) and its individual flavin and Fe-S-carrying domains using V. cholerae or Escherichia coli as expression hosts. NqrF′ and the flavin domain each contain 1 mol of FAD/mol of enzyme and exhibit high NADH oxidation activity (20,000 μmol min-1 mg-1). EPR, visible absorption, and circular dichroism spectroscopy indicate that the Fe-S cluster in NqrF′ and its Fe-S domain is related to 2Fe ferredoxins of the vertebrate-type. The addition of NADH to NqrF′ results in the formation of a neutral flavosemiquinone and a partial reduction of the Fe-S cluster. The NqrF subunit harbors the active site of NADH oxidation and acts as a converter between the hydride donor NADH and subsequent one-electron reaction steps in the Na+-translocating NADH:quinone oxidoreductase complex. The observed electron transfer NADH → FAD → [2Fe-2S] in NqrF requires positioning of the FAD and the Fe-S cluster in close proximity in accordance with a structural model of the subunit. The Na+-translocating NADH:quinone oxidoreductase from Vibrio cholerae is a six subunit enzyme containing four flavins and a single motif for the binding of a Fe-S cluster on its NqrF subunit. This study reports the production of a soluble variant of NqrF (NqrF′) and its individual flavin and Fe-S-carrying domains using V. cholerae or Escherichia coli as expression hosts. NqrF′ and the flavin domain each contain 1 mol of FAD/mol of enzyme and exhibit high NADH oxidation activity (20,000 μmol min-1 mg-1). EPR, visible absorption, and circular dichroism spectroscopy indicate that the Fe-S cluster in NqrF′ and its Fe-S domain is related to 2Fe ferredoxins of the vertebrate-type. The addition of NADH to NqrF′ results in the formation of a neutral flavosemiquinone and a partial reduction of the Fe-S cluster. The NqrF subunit harbors the active site of NADH oxidation and acts as a converter between the hydride donor NADH and subsequent one-electron reaction steps in the Na+-translocating NADH:quinone oxidoreductase complex. The observed electron transfer NADH → FAD → [2Fe-2S] in NqrF requires positioning of the FAD and the Fe-S cluster in close proximity in accordance with a structural model of the subunit. The ability to diminish the intracellular Na+ concentration by specific transporters is common to many organisms. The uphill transport of Na+ against an electrochemical potential catalyzed by Na+/H+ antiporters is driven by the proton motive force (1Padan E. Venturi M. Gerchman Y. Dover N. Biochim. Biophs. Acta. 2001; 1505: 144-157Crossref PubMed Scopus (276) Google Scholar). In addition, some bacteria and archaea possess Na+ pumps that directly couple an exergonic reaction to the endergonic transport of Na+ across the membrane (2Dimroth P. Biochim. Biophys. Acta. 1997; 1318: 11-51Crossref PubMed Scopus (199) Google Scholar). For example, the oxidation of NADH with quinone catalyzed by membrane-bound NADH dehydrogenases generates an electrochemical Na+ gradient that can be used to drive the uptake of nutrients. Two distinct classes of bacterial Na+-translocating NADH dehydrogenases are known. Enterobacteria like Escherichia coli possess a Na+-dependent NADH dehydrogenase that is homologous to complex I of the mitochondrial respiratory chain (3Steuber J. Schmid C. Rufibach M. Dimroth P. Mol. Microbiol. 2000; 35: 428-434Crossref PubMed Scopus (89) Google Scholar, 4Gemperli A.C. Dimroth P. Steuber J. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 839-844Crossref PubMed Scopus (51) Google Scholar, 5Steuber J. J. Biol. Chem. 2003; 278: 26817-26822Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). Another type of NADH-driven redox pump (called Na+-NQR) 1The abbreviations used are: Na+-NQR, Na+-translocating NADH: quinone oxidoreductase; FNR, ferredoxin:NADP+ oxidoreductase; BenC, benzoate 1,2-dioxygenase reductase; LB, Luria-Bertani; Ni-NTA, nickel-nitrilotriacetic acid; Em, midpoint redox potential; W, watt. 1The abbreviations used are: Na+-NQR, Na+-translocating NADH: quinone oxidoreductase; FNR, ferredoxin:NADP+ oxidoreductase; BenC, benzoate 1,2-dioxygenase reductase; LB, Luria-Bertani; Ni-NTA, nickel-nitrilotriacetic acid; Em, midpoint redox potential; W, watt. is found in marine bacteria like Vibrio alginolyticus or the human pathogen V. cholerae (6Barquera B. Hellwig P. Zhou W. Morgan J.E. Häse C.C. Gosink K.K. Nilges M. Bruesehoff P.J. Roth A. Lancaster C.R. Gennis R.B. Biochemistry. 2002; 41: 3781-3789Crossref PubMed Scopus (98) Google Scholar, 7Bogachev A.V. Bertsova Y.V. Ruuge E.K. Wikström M. Verkhovsky M.I. Biochim. Biophys. Acta. 2002; 1556: 113-120Crossref PubMed Scopus (34) Google Scholar, 8Häse C.C. Mekalanos J.J. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 3183-3187Crossref PubMed Scopus (128) Google Scholar, 9Nakayama Y. Hayashi M. Unemoto T. FEBS Lett. 1998; 422: 240-242Crossref PubMed Scopus (56) Google Scholar, 10Steuber J. Rufibach M. Fritz G. Neese F. Dimroth P. Eur. J. Biochem. 2002; 269: 1287-1292Crossref PubMed Scopus (7) Google Scholar, 11Tokuda H. Unemoto T. J. Biol. Chem. 1982; 257: 10007-10014Abstract Full Text PDF PubMed Google Scholar). The Na+-NQR is encoded by the nqr operon that comprises the structural genes nqrA-nqrF (12Beattie P. Tan K. Bourne R.M. Leach D. Rich P.R. Ward F.B. FEBS Lett. 1994; 356: 333-338Crossref PubMed Scopus (52) Google Scholar, 13Hayashi M. Hirai K. Unemoto T. FEBS Lett. 1995; 363: 75-77Crossref PubMed Scopus (69) Google Scholar) encoding for six different subunits present in the complex (9Nakayama Y. Hayashi M. Unemoto T. FEBS Lett. 1998; 422: 240-242Crossref PubMed Scopus (56) Google Scholar). NqrF is the only subunit that contains four closely spaced cysteine residues 70Cys-Xaa5-Cys-Xaa2-Cys-Xaa31-Cys111 (V. cholerae numbering) required for the ligation of an Fe-S cluster. In addition, motifs for the binding of flavin and NADH were identified on NqrF (14Rich P.R. Meunier B. Ward F.B. FEBS Lett. 1995; 375: 5-10Crossref PubMed Scopus (68) Google Scholar). Subunits NqrB and NqrC each contain one FMN that is covalently linked to a threonine residue (15Zhou W. Bertsova Y.V. Feng B. Tsatsos P. Verkhovskaya M.L. Gennis R.B. Bogachev A.V. Barquera B. Biochemistry. 1999; 38: 16246-16252Crossref PubMed Scopus (79) Google Scholar, 16Hayashi M. Nakayama Y. Yasui M. Maeda M. Furuishi K. Unemoto T. FEBS Lett. 2001; 488: 5-8Crossref PubMed Scopus (75) Google Scholar, 17Barquera B. Häse C.C. Gennis R.B. FEBS Lett. 2001; 492: 45-49Crossref PubMed Scopus (45) Google Scholar). Recently, riboflavin was identified as a component of the Na+-NQR complex from V. cholerae (18Barquera B. Zhou W. Morgan J.E. Gennis R.B. Proc. Natl. Sci. U. S. A. 2002; 99: 10322-10324Crossref PubMed Scopus (69) Google Scholar). In summary, the known prosthetic groups of the Na+-NQR are one non-covalently bound FAD, two covalently bound FMNs (on NqrB and NqrC, respectively), one riboflavin, one Fe-S cluster (on NqrF), and ubiquinone-8 (6Barquera B. Hellwig P. Zhou W. Morgan J.E. Häse C.C. Gosink K.K. Nilges M. Bruesehoff P.J. Roth A. Lancaster C.R. Gennis R.B. Biochemistry. 2002; 41: 3781-3789Crossref PubMed Scopus (98) Google Scholar, 19Pfenninger-Li X.D. Albracht S.P. van Belzen R. Dimroth P. Biochemistry. 1996; 35: 6233-6242Crossref PubMed Scopus (76) Google Scholar). The central question is how electron transfer from NADH to the substrate quinone proceeds and how this redox reaction is coupled to the translocation of Na+ by the Na+-NQR. Here we demonstrate that the NqrF subunit catalyzes the initial electron transfer reactions NADH → FAD → [2Fe-2S] in the Na+-NQR complex. Construction of Expression Vectors—V. cholerae O395 N1 (20Mekalanos J.J. Swartz D.J. Pearson G.D. Harford N. Groyne F. de Wilde M. Nature. 1983; 306: 551-557Crossref PubMed Scopus (451) Google Scholar) served as a source of genomic DNA for PCR cloning of nqrF constructs. Cloning was carried out in E. coli DH5α using standard techniques (21Ausubel F. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology. John Wiley & Sons, Inc., New York1995Google Scholar). Gene sequences encoding the shortened NqrF subunit, its Fe-S domain, or flavin domain were amplified from chromosomal DNA by PCR. The forward primers for amplification of sequences encoding a truncated NqrF subunit or its Fe-S domain were designed to excise bp 7-75 of nqrF. Hereby, amino acids Thr3-Ala25 including the predicted single N-terminal transmembrane helix (Val8-Ala25) of the NqrF subunit were removed, and soluble variants of NqrF (NqrF′) and its Fe-S domain were produced (see Fig. 1). Primer sequences and restriction sites are given in Table I. The 3′-ends of the reverse primers for NqrF′ and the flavin domain construct were homologous to sequences downstream of the stop codon of nqrF. PCR amplification by Pfu polymerase (Stratagene) was carried out as described by the supplier with an annealing temperature of 56 °C and an amplification time of 2 min and 40 s. PCR products encoding for NqrF′ or the flavin domain were digested with NdeI and EcoRI and ligated into the arabinose-inducible expression vector pEC422 (22Schulz H. Fabianek R.A. Pellicioli E.C. Hennecke H. Thöny-Meyer L. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 6462-6467Crossref PubMed Scopus (101) Google Scholar), yielding pNF3 and pFNF8. The PCR fragment encoding the Fe-S domain was digested by NdeI and XhoI and inserted into pET-16b (Novagene) to give pFS224. The translation product of pFS224 has a C-terminal extension of 21 amino acids, and the stop codon is conferred by the vector. All three constructs add N-terminal His tags to the target proteins consisting of six histidine residues in the case of the NqrF′ and its flavin domain and ten histidine residues in the case of the Fe-S domain. The expression vectors pNF3 or pFNF8 were transformed into V. cholerae as described in Ref. 23Hamashima H. Nakano T. Tamura S. Arai T. Microbiol. Immunol. 1990; 34: 703-708Crossref PubMed Scopus (18) Google Scholar. E. coli BL21 (DE3) (Stratagene) was transformed with pFS224. The cloned gene fragments were sequenced, and in the case of the fragments encoding the NqrF′ and the flavin domain the fragments were found to be identical to the corresponding genomic sequence of V. cholerae El Tor N16961 (GenBank™ accession number AAF95434) (24Heidelberg J.F. Eisen J.A. Nelson W.C. Clayton R.A. Gwinn M.L. Dodson R.J. Haft D.H. Hickey E.K. Peterson J.D. Umayam L. Gill S.R. Nelson K.E. Read T.D. Tettelin H. Richardson D. Ermolaeva M.D. Vamathevan J. Bass S. Qin H. Dragoi I. Sellers P. McDonald L. Utterback T. Fleishmann R.D. Nierman W.C. White O. Nature. 2000; 406: 477-483Crossref PubMed Scopus (1413) Google Scholar). The cloned gene fragment encoding the Fe-S domain contained a silent G→ A mutation at bp 273 (nqrF numbering). The identity of the Fe-S and the flavin domains with the predicted polypeptides derived from nqrF from V. cholerae El Tor N16961 was further supported by matrix-assisted laser desorption ionization-mass spectrometry. The observed mass was 17895 Da (calculated, 17873 Da) for the Fe-S domain and 33983 Da for the flavin domain (calculated, 34047 Da). NqrF′, the FAD, and the Fe-S domain showed the expected N-terminal sequences.Table ICloning of nqrF constructsProductPCR primers (5′-3′)VectorExpression hostNqrF′ForwardCGATATACATATGTCTAAATCCAAGCTAGTACCAACAGGpNF3V. cholerae O395 N1ReverseCGATAGAATTCCAATTTGTAAAAAACAATGGCFAD domainForwardGCATATACATATGGGCGTGAAGAAGTGGGAATGTACpFNF8V. cholerae O395 N1ReverseGCATAGAATTCGAACGAGCCAGCCATCFe-S domainForwardGGAATTCATATGTCTAAATCCAAGCTAGTACCAACAGGTGpFS224E. coli BL21 (DE3)ReverseCATACTCGAGACTCTTTGATGAAAGTGGCTTTG Open table in a new tab Cultivation of Bacteria—All strains were cultivated aerobically in Luria-Bertani (LB) medium (21Ausubel F. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology. John Wiley & Sons, Inc., New York1995Google Scholar). V. cholerae O395 N1 was cultivated in LB medium supplemented with 10 mm glucose and 50 mm potassium phosphate buffer, pH 7.3, in the presence of 50 μg ml-1 streptomycin and 200 μg ml-1 ampicillin. For the production of NqrF′ or the flavin domain, 10 liters of medium were inoculated with 250 ml of V. cholerae O395 N1 transformed with pNF3 or pFNF8. The cells were grown in a 12-liter fermenter (Bioengineering AG) at 37 °C to an A600 nm of 0.8 or 1.0, respectively. Expression was induced by adding 10 mm L-arabinose. Four hours after induction (A600 nm of ∼2) the bacteria were harvested by centrifugation. For the production of the Fe-S domain 150 liters of LB medium containing 100 μg ml-1 ampicillin were inoculated with 4 liters of E. coli BL21 (DE3)-pFS224 in a bioreactor (Bioengineering AG). The cells were grown at 37 °C to an A600 nm of 1.1. After the addition of 0.5 mm isopropyl-1-thio-β-d-galactopyranoside, growth was continued at 30 °C overnight. The cells were harvested by centrifugation (d3A 112M-4 centrifuge, Loher) and washed with 10 mm Tris/HCl, pH 7.4, 0.3 M NaCl. Concentrated cell suspensions were frozen in liquid nitrogen and stored at -80 °C. Purification of Recombinant NqrF′ and Its Flavin and Fe-S Domains—Prior to use all solutions were thoroughly degassed and purged with N2 followed by equilibration in a Coy glove box (95% N2, 5% H2) at least overnight (O2 < 0.3 μm in buffers). Five g wet weight cells of E. coli BL21 (DE3) or V. cholerae O395 N1 were resuspended in 25 ml of 10 mm Tris/HCl, pH 7.4, 0.3 M NaCl, 1.0 mm phenylmethylsulfonyl fluoride, 1.0 mm dithiothreitol, 5 mm MgCl2, and traces of DNase I (Roche Diagnostics). In the case of the flavin domain, 0.1 mm diisopropylfluorophosphate was added instead of phenylmethylsulfonyl fluoride. The cell suspension was passed once through a French pressure cell at 83 millipascal, and the eluate was collected under a stream of N2. Unbroken cells and large debris were removed by centrifugation at 35,000 × g for 20 min. If not indicated otherwise, all subsequent manipulations were performed in the glove box at room temperature. Soluble proteins were separated from the membrane fraction by ultracentrifugation (150,000 × g, 1 h, 4 °C). The soluble fraction from V. cholerae was loaded onto a Ni-NTA superflow column (3-ml bed volume, 1.4-cm diameter, Qiagen) equilibrated with buffer A (20 mm Tris/HCl, pH 8.0, 0.5 M NaCl). The column was washed with 30 mm imidazole in buffer A, and NqrF′ or the flavin domain was eluted with 400 mm imidazole. NqrF′ from the Ni-NTA column was diluted 10-fold in 50 mm Tris/HCl, pH 7.5 (buffer B), and loaded on a Fractogel TSK DEAE 650 column (1-ml bed volume, 1.4-cm diameter, Merck). Concentrated NqrF′ was obtained by elution with buffer B containing 0.3 M NaCl. A major contaminant identified in NqrF′ and in the flavin domain was the VC2333 gene product, a putative ribosomal protein S6 modification protein. This protein was removed by further purification of the flavin domain in the presence of oxygen using a MonoQ HR5/5 anionic exchange column connected to an Äkta FPLC station (Amersham Biosciences). The flavin domain was diluted 10-fold in 50 mm Hepes/NaOH, pH 7.0, and loaded onto the MonoQ column. A linear gradient of 15 volumes from 0-0.40 M NaCl led to the elution of the flavin domain at 0.32 m NaCl. The soluble fraction containing the Fe-S domain was loaded onto a Ni-NTA-agarose column (Qiagen) equilibrated with 10 mm Tris/HCl, pH 7.4, 1 mm phenylmethylsulfonyl fluoride, 0.5 mm dithiothreitol, 0.5 M NaCl (buffer C). The column was washed with 80 mm imidazole in buffer C, and the Fe-S domain was eluted with 400 mm imidazole. Fractions containing the Fe-S domain were combined (∼8 ml) and dialyzed against 50 mm Tris/HCl, pH 7.8, 1.0 mm dithiothreitol at 4 °C overnight. The purification yields from 5 g of cells (wet weight) were ∼10, 4, and 5 mg of Fe-S domain, flavin domain, and NqrF′, respectively. In Vitro Reconstitution of the Fe-S Cluster—Insertion of the Fe-S cluster was performed by means of the cysteine desulfurase NifS from Azotobacter vinelandii (25Zheng L. White R.H. Cash V.L. Jack R.F. Dean D.R. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 2754-2758Crossref PubMed Scopus (493) Google Scholar) under exclusion of oxygen. NifS (50 μg/ml) was added to the Fe-S domain (<0.5 mm in 50 mm Tris/HCl, pH 7.8, containing 10 mol of (NH4)2Fe(SO4)2/mol of Fe-S domain and 10 mm dithiothreitol), and the reaction was started by the addition of 2 mm cysteine, pH 7.5, acting as sulfide donor. After 45 min, the reconstituted Fe-S domain was purified from the reaction mixture by affinity chromatography on the Ni-NTA-agarose column. Reduction and Determination of Midpoint Potential—The reduction of NqrF′, the FAD, or the Fe-S domain was followed spectrophotometrically under exclusion of oxygen in cuvettes sealed with a rubber stopper. NADH or sodium dithionite were added in the glove box or with gas-tight syringes. The standard reduction potential of the FAD of the flavin domain was determined by the xanthine/xanthine oxidase method (26Massey V. Curti B. Ronchi S. Zanetti G. Flavins and Flavoproteins: Proceedings of the Tenth International Symposium on Flavins and Flavoproteins. Walter de Gruyter & Co., Berlin1990: 59-66Google Scholar) in 100 mm Tris/HCl, pH 7.5, using 10-20 μm phenosafranin (Em = -266 mV at pH 7.5, n = 2) as suitable redox indicator. Benzyl viologen (Em = -359 mV, pH 7.5, n = 2) and methyl viologen (Em = -440 mV, pH 7.5, n = 2) were used as redox mediators (27Hunt J. Massey V. Dunham W.R. Sands R.H. J. Biol. Chem. 1993; 268: 18685-18691Abstract Full Text PDF PubMed Google Scholar) at final concentrations of 1.8 μm each. The redox state of FAD or phenosafranin was monitored at 404 or 518 nm, respectively. The Nernst coefficient was determined from the slope of the line ln(FADox/FADred) versus ln(PSox/PSred). The difference between the Em of FAD in the flavin domain and the Em of phenosafranin was calculated from the vertical intercept of the line. Analytical Methods—Protein was determined by the bicinchoninic acid method using the reagent from Pierce (28Smith P.K. Krohn R.I. Hermanson G.T. Mallia A.K. Gartner F.H. Provenzano M.D. Fujimoto E.K. Goeke N.M. Olson B.J. Klenk D.C. Anal. Biochem. 1985; 150: 76-85Crossref PubMed Scopus (18348) Google Scholar) or by the microbiuret method (29Goa J. Scand. J. Clin. Lab. Investig. 1953; 5: 219-222Crossref Scopus (794) Google Scholar) preceded by trichloroacetic acid precipitation. Bovine serum albumin served as the standard. The concentration of active NqrF′ and the flavin domain was estimated from the content of FAD after extraction. The protein concentration of the flavin domain and the Fe-S domain was standardized by UV spectroscopy using the calculated extinction coefficients at 280 nm based on the content of aromatic amino acid residues of the apoproteins. The concentrations of NADH (ϵ340 = 6.22 mm-1 cm-1), ubiquinone-1 (ϵ275 = 13.7 mm-1 cm-1 in ethanol or ϵ275 = 7.8 mm-1 cm-1 in H2O) (30Fato R. Estornell E. Bernardo S.D. Pallotti F. Castelli G.P. Lenaz G. Biochemistry. 1996; 35: 2705-2716Crossref PubMed Scopus (149) Google Scholar) and FAD (ϵ450 = 11.3 mm-1 cm-1) (31Macheroux P. Chapman S.K. Reid G.A. Flavoprotein Protocols. Humana Press, Totowa, New Jersey1999: 1-8Google Scholar) were calculated based on their absorption coefficients. SDS-PAGE was performed with 12.5% polyacrylamide (32Schägger H. von Jagow G. Anal. Biochem. 1987; 166: 368-379Crossref PubMed Scopus (10410) Google Scholar). The expression of the nqrF constructs was confirmed by Western blotting using an antibody directed against histidine tags (Tetra-His Antibody, Qiagen). Non-covalently bound flavins were extracted from protein and subjected to high pressure liquid chromatography analysis (33Gemperli A.C. Dimroth P. Steuber J. J. Biol. Chem. 2002; 277: 33811-33817Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar). Iron was determined colorimetrically by the 3-(2-pyridyl)-5,6-bis(5-sulfo-2-furyl)-1,2,4-triazinedissodium salt trihydrate (ferene) complex (34Beinert H. Methods Enzymol. 1978; 54: 435-445Crossref PubMed Scopus (107) Google Scholar). For the determination of acid-labile sulfur the methylene blue method (35Beinert H. Anal. Biochem. 1983; 131: 373-378Crossref PubMed Scopus (394) Google Scholar) was applied. NADH dehydrogenase activity was assayed in 20 mm Tris/H2SO4,pH 7.5, containing 50 mm Na2SO4,50 μg/ml bovine serum albumin, and 0.1 ubiquinone-1 (Sigma). The reaction was started by the addition of NADH. The kinetics were followed at 25 °C in the presence of oxygen using a dual wavelength/double beam recording spectrophotometer (UV-3000, Shimadzu) operating in the dual wavelength mode at 340-370 nm (36Chance B. Science. 1954; 120: 767-775Crossref PubMed Scopus (134) Google Scholar). Prior to activity assays NqrF′ and the flavin domain were diluted to an appropriate concentration in 20 mm Tris/H2SO4, pH 7.5, supplemented with 1 mg/ml bovine serum albumin. During the activity measurements, diluted NqrF′ was kept on ice under the exclusion of oxygen. Spectroscopy—UV-visible spectroscopy was performed with a Cary 50 spectrophotometer (Varian) or a UV-3000 dual wavelength/double beam recording spectrophotometer. X-band EPR spectra were recorded with an Elexsys E-500 spectrometer equipped with a helium flow cryostat (Oxford Instruments ESR 410), a NMR Gaussmeter, and a Hewlett Packard Frequency counter. Simulation of EPR spectra was carried out by means of the program EPR (37Neese F. Quant. Chem. Progr. Exch. Bull. 1995; 136 (abstr.): 5Google Scholar). Spin concentrations were determined by comparison of simulated spectra to a CuSO4 standard (38Neese F. Zumft W.G. Antholine W.E. Kroneck P.M. J. Am. Chem. Soc. 1996; 118: 8692-8699Crossref Scopus (142) Google Scholar). CD spectroscopy of the Fe-S domain was performed using a MOS-450 spectropolarimeter (Biologics) at a scan rate of 10 nm/s at 25 °C. The cuvette was flushed with N2. Model Building—The sequence of the NqrF subunit from V. cholerae was aligned with the sequences of the benzoate 1,2-dioxygenase reductase (BenC) (39Karlsson A. Beharry Z.M. Matthew Eby D. Coulter E.D. Neidle E.L. Kurtz Jr., D.M. Eklund H. Ramaswamy S. J. Mol. Biol. 2002; 318: 261-272Crossref PubMed Scopus (53) Google Scholar) and the cytochrome b reductase fragment of nitrate reductase (40Lu G. Lindqvist Y. Schneider G. Dwivedi U. Campbell W. J. Mol. Biol. 1995; 248: 931-948Crossref PubMed Scopus (86) Google Scholar) using the program 3D-PSSM (41Kelley L.A. MacCallum R.M. Sternberg M.J. J. Mol. Biol. 2000; 299: 499-520Crossref PubMed Scopus (1119) Google Scholar). These alignments were combined and verified using structural information of BenC (Protein Data Bank entry 1KRH), of cytochrome b reductase (1CNF), and of adrenodoxin (42Müller A. Müller J.J. Muller Y.A. Uhlmann H. Bernhardt R. Heinemann U. Structure. 1998; 6: 269-280Abstract Full Text Full Text PDF PubMed Scopus (146) Google Scholar) (1AYF). The resulting multiple sequence alignment was the basis for a three-dimensional model of NqrF generated by the program modeler (43Marti-Renom M.A. Stuart A.C. Fiser A. Sanchez R. Melo F. Sali A. Annu. Rev. Biophys. Biomol. Struct. 2000; 29: 291-325Crossref PubMed Scopus (2505) Google Scholar). Cofactor Content and Activity of NqrF-derived Polypeptides—The N-terminal half of NqrF with its binding motif for an Fe-S cluster is related to ferredoxins, whereas the C-terminal half comprises motifs for the binding of flavin and NADH (Fig. 1). Three NqrF-derived polypeptides were produced, the NqrF subunit devoid of a putative N-terminal α-helix with a molecular mass of 44,596 Da (NqrF′) and its Fe-S and flavin-carrying domains with molecular masses of 17,873 and 34 047 Da, respectively (Fig. 2). NqrF′ contained 0.94 ± 0.06 mol of FAD/mol (21.1 ± 1.3 nmol of non-covalently bound FAD/mg). In addition, less than 3.2 nmol/mg FMN and 0.3 nmol of riboflavin/mg were present in NqrF′. The FAD domain contained 0.95 ± 0.06 mol of non-covalently bound FAD/mol (29.6 ± 1.9 nmol of FAD/mg). Again, small amounts of FMN (<2.8 nmol/mg) and riboflavin (<0.2 nmol/mg) were also detected. These results demonstrate that the non-covalently bound FAD present in the Na+·NQR complex resides in the NqrF subunit. Both NqrF′ and the flavin domain exhibited high NADH dehydrogenase activities with ubiquinone-1 as an artificial electron acceptor (up to 20,000 μmol min-1 mg-1), depending on the FAD content of the enzyme specimens. The increase of enzymatic activity with increasing concentrations of NADH was very similar for NqrF′ and the flavin domain, with half-maximal activities observed in the presence of 2-4 μm NADH. A characteristic property of Na+-NQR is its inhibition by silver ions (44Steuber J. Krebs W. Dimroth P. Eur. J. Biochem. 1997; 249: 770-776Crossref PubMed Scopus (39) Google Scholar). Half-maximal inhibition of the flavin domain by Ag+ was observed in the presence of 670 nm Ag+. NqrF′ produced in V. cholerae contained 0.35 ± 0.02 mol of Fe and 0.38 ± 0.12 mol of acid-labile sulfide/mol of NqrF′. Although FAD was efficiently inserted during overproduction of NqrF′, the assembly of the Fe-S cluster was clearly substoichiometric. Assuming that the Fe-S cluster on NqrF′ is of the 2Fe-2S type (see below), our results indicate that 18% of NqrF′ overproduced in V. cholerae contained an Fe-S cluster. Treatment with the cysteine desulfurase NifS did not increase the amounts of iron and acid-labile sulfide in NqrF′ and did not result in higher spin concentrations monitored by EPR. Attempts to reconstitute the Fe-S cluster under slightly denaturing conditions resulted in the loss of the FAD. The situation was different in the isolated Fe-S domain of the NqrF subunit. Here, the amount of Fe-S cluster inserted in vivo (0.40 ± 0.08 mol of Fe and 0.40 ± 0.10 mol of acid-labile sulfide/mol) could be increased by subsequent in vitro assembly with the help of NifS (1.61 ± 0.28 mol of Fe and 1.31 ± 0.11 mol of acid-labile sulfide/mol). The NifS-catalyzed insertion of the Fe-S cluster was accompanied by an increase in absorption with typical maxima at 340, 410, 451, and 560 nm. The content of iron and acid-labile sulfide indicated that the reconstituted Fe-S domain harbors a 2Fe-2S cluster in accordance with its spectroscopic properties (see below). We observed a rapid degradation of the Fe-S cluster in NqrF′ and the Fe-S domain during few minutes after exposure to air. The NqrF′ domain lost its brown-yellow color typical for Fe-S-containing flavoproteins and turned yellow, whereas the Fe-S domain bleached completely. A loss of the Fe-S center during purification in the presence of oxygen was also observed with the Na+-NQR complex from V. alginolyticus (10Steuber J. Rufibach M. Fritz G. Neese F. Dimroth P. Eur. J. Biochem. 2002; 269: 1287-1292Crossref PubMed Scopus (7) Google Scholar). Midpoint Redox Potential of the FAD in the Flavin Domain—The flavin domain exhibited an optical spectrum typical for oxidized flavoproteins with maxima at 396 and 454 nm and a shoulder at 480 nm (Fig. 3). Upon addition of substoichiometric amounts of NADH (10 μm) to the flavin domain (14 μm), the transient formation of a blue neutral flavosemiquinone with a characteristic absorbance in the range from 520 to 660 nm was observed (Fig. 3A). The flavosemiquinone was stable for 20-30 min. From the difference in absorbance at 580 nm and the absorption coefficient of the neutral flavosemiquinone in flavodoxin (ϵ580 = 4.5 mm-1 cm-1) (45Massey V. Palmer G.H. Biochemistry. 1966; 5: 3181-3189Crossref PubMed Scopus (343) Google Scholar), a flavosemiquinone concentration of 4 μm was calculated indicating that ∼30% of the FAD cofactor in the flavin domain was in the one-electron-reduced state under these conditions. The formation of the one-electron-reduced flavin from the obligate two-electron donor NADH is unexpected and might be the result of a comproportionation reaction between two FAD domains in the fully oxidized and the fully reduced state, respectively (46McLean K.J. Scrutton N.S. Munro A.W. Biochem. J. 2003; 372: 317-327Crossref PubMed Scopus (45) Google Scholar). Addition of excess NADH (73 μm) to the FAD domain (30 μm) resulted in the complete reduction of the FAD (Fig. 3B). The Na+-NQR complex purified in the presence of oxygen stabilized a neutral flavosemiquinone in the as isolated state, whereas an anionic flavosemiquinone was observed in the Na+-NQR after addition of excess dithionite (7Bogachev A.V. Bertsova Y.V. Ruuge E.K. Wikström M. Verkhovsky M.I. Biochim. Biophys. Acta. 2002; 1556: 113-120Crossref PubMed Scopus (34) Google Scholar, 47Barquera B. Morgan J.E. Lukoyanov D. Scholes C.P. Gennis R.B. Nilges M.J. J. Am. Chem. Soc. 2003; 125: 265-275Crossref PubMed Scopus (72) Google Scholar). We did not detect radicals in the flavin domain as isolated or in the flavin domain treated with an excess of NADH by EPR spectroscopy. The midpoint redox potential of the FAD in the flavin domain was determined by comparison with a suitable redox indicator of known midpoint potential. Using the two-electron donor phenosafranin, a theoretical Nernst coefficient of 1.0 is expected if the FAD in the flavin domain undergoes a two-electron reduction. A Nernst coefficient of 1.33 was obtained for the FAD in the flavin domain indicating that the FAD acted as two-electron acceptor during the redox titration. The FAD in the flavin domain" @default.
• W2081618275 created "2016-06-24" @default.
• W2081618275 creator A5007038761 @default.
• W2081618275 creator A5014724545 @default.
• W2081618275 creator A5046820685 @default.
• W2081618275 creator A5054622284 @default.
• W2081618275 creator A5058428073 @default.
• W2081618275 creator A5090355454 @default.
• W2081618275 date "2004-05-01" @default.
• W2081618275 modified "2023-10-17" @default.
• W2081618275 title "NADH Oxidation by the Na+-translocating NADH:Quinone Oxidoreductase from Vibrio cholerae" @default.
• W2081618275 cites W1000442924 @default.
• W2081618275 cites W1503024947 @default.
• W2081618275 cites W1514974310 @default.
• W2081618275 cites W1548790826 @default.
• W2081618275 cites W1587211487 @default.
• W2081618275 cites W1589357676 @default.
• W2081618275 cites W1675570769 @default.
• W2081618275 cites W1964219210 @default.
• W2081618275 cites W1966052679 @default.
• W2081618275 cites W1968026877 @default.
• W2081618275 cites W1972538837 @default.
• W2081618275 cites W1975085160 @default.
• W2081618275 cites W1975579483 @default.
• W2081618275 cites W1976314697 @default.
• W2081618275 cites W1979225897 @default.
• W2081618275 cites W1982468096 @default.
• W2081618275 cites W1986422978 @default.
• W2081618275 cites W1993565599 @default.
• W2081618275 cites W1997200285 @default.
• W2081618275 cites W2001304636 @default.
• W2081618275 cites W2003831154 @default.
• W2081618275 cites W2004103100 @default.
• W2081618275 cites W2021437469 @default.
• W2081618275 cites W2026681275 @default.
• W2081618275 cites W2036223583 @default.
• W2081618275 cites W2036963341 @default.
• W2081618275 cites W2038485291 @default.
• W2081618275 cites W2046385480 @default.
• W2081618275 cites W2048842574 @default.
• W2081618275 cites W2052427648 @default.
• W2081618275 cites W2058959424 @default.
• W2081618275 cites W2061127684 @default.
• W2081618275 cites W2066249923 @default.
• W2081618275 cites W2073523604 @default.
• W2081618275 cites W2075040966 @default.
• W2081618275 cites W2075801933 @default.
• W2081618275 cites W2079938883 @default.
• W2081618275 cites W2081074633 @default.
• W2081618275 cites W2082337789 @default.
• W2081618275 cites W2084466582 @default.
• W2081618275 cites W2087921651 @default.
• W2081618275 cites W2088995397 @default.
• W2081618275 cites W2107109782 @default.
• W2081618275 cites W2107645256 @default.
• W2081618275 cites W2114520383 @default.
• W2081618275 cites W2129015460 @default.
• W2081618275 cites W2168855632 @default.
• W2081618275 cites W2170366101 @default.
• W2081618275 cites W4232534952 @default.
• W2081618275 doi "https://doi.org/10.1074/jbc.m311692200" @default.
• W2081618275 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15010474" @default.
• W2081618275 hasPublicationYear "2004" @default.
• W2081618275 type Work @default.
• W2081618275 sameAs 2081618275 @default.
• W2081618275 citedByCount "48" @default.
• W2081618275 countsByYear W20816182752012 @default.
• W2081618275 countsByYear W20816182752013 @default.
• W2081618275 countsByYear W20816182752014 @default.
• W2081618275 countsByYear W20816182752015 @default.
• W2081618275 countsByYear W20816182752016 @default.
• W2081618275 countsByYear W20816182752017 @default.
• W2081618275 countsByYear W20816182752021 @default.
• W2081618275 crossrefType "journal-article" @default.
• W2081618275 hasAuthorship W2081618275A5007038761 @default.
• W2081618275 hasAuthorship W2081618275A5014724545 @default.
• W2081618275 hasAuthorship W2081618275A5046820685 @default.
• W2081618275 hasAuthorship W2081618275A5054622284 @default.
• W2081618275 hasAuthorship W2081618275A5058428073 @default.
• W2081618275 hasAuthorship W2081618275A5090355454 @default.
• W2081618275 hasBestOaLocation W20816182751 @default.
• W2081618275 hasConcept C181199279 @default.
• W2081618275 hasConcept C185592680 @default.
• W2081618275 hasConcept C2778643871 @default.
• W2081618275 hasConcept C2779268744 @default.
• W2081618275 hasConcept C2780643102 @default.
• W2081618275 hasConcept C2991733762 @default.
• W2081618275 hasConcept C523546767 @default.
• W2081618275 hasConcept C54355233 @default.
• W2081618275 hasConcept C55493867 @default.
• W2081618275 hasConcept C75520062 @default.
• W2081618275 hasConcept C86803240 @default.
• W2081618275 hasConcept C89423630 @default.
• W2081618275 hasConceptScore W2081618275C181199279 @default.
• W2081618275 hasConceptScore W2081618275C185592680 @default.
• W2081618275 hasConceptScore W2081618275C2778643871 @default.
• W2081618275 hasConceptScore W2081618275C2779268744 @default.
• W2081618275 hasConceptScore W2081618275C2780643102 @default.

• next